p53-mediated DNA renaturation can mimic strand exchange.

The process of strand exchange is considered to be the hallmark of DNA recombination. Proteins known to carry out such exchange are believed to operate via one or the other of two mechanisms. RecA-like proteins promote the formation of a three-stranded or triplex synaptic intermediate in which strand exchange occurs, whereas other proteins would allow the coordinated exonucleolytic degradation of one strand in the duplex DNA and its replacement by an invading strand of similar sequence and polarity. In view of properties ascribed to it, we have attempted to determine whether p53 belongs to one or the other of these groups of proteins. The in vitro assay used relies on a double-stranded (ds) oligonucleotide (oligo 1+2) and a single-stranded (ss) oligonucleotide (oligo 3), part of which is complementary to oligo 1. The data collected suggest that, under the conditions of the assay, oligo 1+2 undergoes partial denaturation; p53 then catalyzes renaturation of oligo 1 with oligo 3, rather than true strand exchange. Since p53 is not known for being able to 'melt' DNA, it would seem unlikely that this protein would effect strand exchange in vivo without assistance from another, denaturing, protein.

Activities of human recombination protein Rad51.

Homologous pairing and strand exchange, which are catalyzed by Escherichia coli RecA protein, are central to homologous recombination. Homologs of this protein are found in eukaryotes; however, little has been reported on the recombinase activities of the mammalian homologs, including the human protein, denoted HsRad51. For the studies described here, we purified HsRad51 form E. coli. Although the activities of HsRad51 and RecA were qualitatively similar in the presence of ATP, there were also striking differences. The stoichiometry of binding to DNA and the rate of renaturation of complementary strands were similar for the two proteins, but rates of ATP hydrolysis, homologous pairing, and subsequent strand exchange promoted by HsRad51 were less than 1/10 those of RecA. In addition, HsRad51 bound gamma-thio-ATP and formed stable presynaptic complexes that promoted renaturation as rapidly as RecA, but the recombinant human protein catalyzed neither strand exchange nor homologous pairing of a single strand with duplex DNA in the presence of the ATP analog. By contrast, RecA promoted both of the latter reactions in control experiments. These observations suggest that among RecA-like proteins, HsRad51 may be a variant in which homologous pairing and strand exchange are more closely linked to the hydrolysis of ATP.

Description of RNA folding by "simulated annealing".

An algorithm is proposed which describes the thermodynamically as well as the kinetically controlled folding process of RNA. The algorithm, based on a special Monte Carlo procedure known as "Simulated Annealing", takes into account the probabilities for opening and closing of single base-pairs. Thus, the algorithm is able to reach structures and structure distributions near the global minimum of structure space, and is not restricted by the tendency to halt in local minima. Three types of structural folding processes may be analysed by this algorithm. Firstly, using thermodynamic data, structure ensembles comparable to those obtained by dynamic programming are achieved. Secondly, using kinetic data, the processes of structure formation and structural rearrangement may be simulated. Thirdly, additionally taking into account RNA polymerase chain elongation rates, the process of "sequential folding" during transcription may be described. Analysis of all types of structural folding and refolding is performed for RNA sequences related to potato spindle tuber viroid (PSTVd). The computed results are in accordance with experimental data and biological functions known for PSTVd.

Fluorescence-detected interactions of oligonucleotides in RecA complexes.

A technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA. The 24-mer oligonucleotide 5'-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATP gamma S, binding of two oligonucleotides, identical or complementary in sequence, in the RecA filament is possible. The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed. In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changes, and we now find protein-mediated renaturation to occur.

Spectroscopic observation of renaturation between polynucleotides with RecA in the presence of ATP hydrolysis.

To obtain mechanistic insights about RecA-promoted base pairing between complementary polynucleotides, the complex formation of RecA with poly(dA) and poly(dT) in the presence of ATP (and ATP-regenerating system) has been studied. The reaction was followed using a fluorescent probe, benzopyrenediolepoxide (BPDE), covalently attached to less than 1% of the adenine bases of poly(dA). BPDE is sensitive to its environment and has been found useful for detection of interactions between DNA strands, in the three binding positions of the RecA filament, in the presence of adenosine 5'-O-3-thiotriphosphate (ATP[S]) [Wittung, P., Nordén, B. & Takahashi, M. (1994) J. Biol. Chem. 269, 5799-5803]. The emission spectrum of RecA:BPDE-poly(dA) formed in the presence of ATP is similar to that observed with ATP[S] supporting similar structures of the complexes. However, the fluorescence anisotropy is considerably reduced, suggesting a higher degree of freedom of DNA in the presence of ATP hydrolysis. Upon addition of a complementary strand, poly(dT), to a preformed filament of RecA:BPDE-poly(dA) in the presence of ATP, the fluorescence intensity slowly decreases and a change of emission profile consistent with Watson-Crick base pairing is observed. This contrasts with the case of ATP[S] in which normal base pairing is never observed. Hence, ATP hydrolysis appears necessary for the RecA filament to be able to promote true renaturation. The renaturation reaction is found more effective when one of the complementary DNA strands is bound in the primary RecA DNA-binding position and the other is added as the third strand, but the reaction can also occur between DNA strands in any combination of binding positions in the RecA filament. This observation suggests the importance of the third DNA-binding position of the RecA filament. Renaturation between DNA strands in the other two combinations of binding positions is speculated to have a role in aborting the strand-exchange reaction when the strands are insufficiently complementary.

Purification and characterization of the Escherichia coli RecO protein. Renaturation of complementary single-stranded DNA molecules catalyzed by the RecO protein.

The recO gene product is required for RecF pathway-mediated recombination and the repair of DNA damage after UV irradiation or mitomycin C exposure in Escherichia coli. In this study, the E. coli recO gene product was overexpressed and purified to at least 99% homogeneity. N-Terminal protein sequence analysis of the overexpressed 31 kDa polypeptide confirmed that this polypeptide was encoded by the recO gene. The N-terminal protein sequence of RecO also confirmed that the first 12 amino acids of functional RecO protein are encoded within the upstream era gene. The purified protein chromatographs with the same Stokes radius (25 A) as a globular protein having a molecular mass of 28 kDa, indicating that RecO is a monomer in solution. The purified RecO protein binds to both single-stranded and double-stranded DNA, and promotes renaturation of complementary single-stranded DNA molecules in the absence of any high energy cofactor. The rate constant for this reaction is independent of the concentration of DNA, suggesting that the reaction follows first-order reaction kinetics. In addition, this reaction is inhibited by 160 mM NaCl, requires Mg2+, and is not stimulated by ATP. These biochemical characteristics support a role for RecO protein in an early phase of homologous recombination.

ATP-dependent DNA renaturation and DNA-dependent ATPase reactions catalyzed by the Ustilago maydis homologous pairing protein.

Purification of the ATP-dependent homologous pairing activity from Ustilago maydis yields a protein preparation that is enriched for a 70-kDa polypeptide as determined by SDS-gel electrophoresis. The protein responsible for the ATP-dependent pairing activity, using renaturation of complementary single strands of DNA as an assay, has a Stokes radius of 3.6 nm and a sedimentation coefficient of 4.3 S consistent with the interpretation that the activity arises from a monomeric globular protein of 70 kDa. Including heparin-agarose and FPLC gel filtration chromatography steps in the previously published protocol improves the purification of the protein. ATP and Mg2+ are necessary cofactors for optimal DNA renaturation activity. ADP inhibits the reaction. Analysis of the ATP-dependent renaturation kinetics indicates the reaction proceeds through a first-order mechanism. The protein has an associated DNA-dependent ATPase as indicated by co-chromatography with the purified ATP-dependent renaturation activity through an FPLC gel-filtration column. Single-stranded DNA and Mg2+ are required for optimal ATP hydrolytic activity, although a number of other polynucleotides and divalent cations can substitute to varying degrees. Hydrolysis of ATP is activated in a sigmoidal manner with increasing amounts of the protein. At ATP concentrations below 0.1 mM the ATPase activity exhibits positive cooperativity as indicated from the Hill coefficient of 1.8 determined by steady-state kinetic analysis of the reaction. ADP and adenosine 5'-[beta,gamma-imido]triphosphate are inhibitors of the ATPase activity although they appear to exert their inhibitory effects through different modes. These results are interpreted as evidence for protein-protein interactions.

ATP-independent DNA renaturation catalyzed by a protein from Ustilago maydis.

A protein that catalyzes the renaturation of complementary strands of DNA has been purified from mitotic cells of the lower eukaryote Ustilago maydis. The most highly purified fraction contains a polypeptide with a molecular mass of 20 kDa as determined by SDS/PAGE and glycerol gradient sedimentation. DNA reannealing is enhanced by the presence of a divalent cation but does not require ATP nor any other nucleotide triphosphate. Reassociation proceeds with fast kinetics as more than 60% of the DNA is reannealed within 4 min at a 30:1 nucleotide/protein monomer ratio, results which suggest that the protein acts in a stoichiometric fashion. Amino acid analysis revealed that the protein contained an elevated level of basic residues and low levels of tryptophan and tyrosine. The protein binds to an oligonucleotide of ten residues but not to one having only five. As judged by agarose gel assays, the protein does not catalyze strand-transfer reactions but does promote the annealing of a 58-residue polynucleotide onto single-stranded circles and gapped linear duplexes. These latter reactions are dependent on the presence of DNA sequence similarity between the pairing partners.

Renaturation of complementary DNA strands by herpes simplex virus type 1 ICP8.

ICP8, the major single-stranded DNA-binding protein of herpes simplex virus type 1, promotes renaturation of complementary single strands of DNA. This reaction is ATP independent but requires Mg2+. The activity is maximal at pH 7.6 and 80 mM NaCl. The major product of the reaction is double-stranded DNA, and no evidence of large DNA networks is seen. The reaction occurs at subsaturating concentrations of ICP8 but reaches maximal levels with saturating concentrations of ICP8. Finally, the renaturation reaction is second order with respect to DNA concentration. The ability of ICP8 to promote the renaturation of complementary single strands suggests a role for ICP8 in the high level of recombination seen in cells infected with herpes simplex virus type 1.

Inactivation of the recA protein by mutation of histidine 97 or lysine 248 at the subunit interface.

We have used site-directed mutagenesis to prepare two new mutant recA proteins, one in which histidine 97 has been replaced by alanine, and another in which lysine 248 has been replaced by alanine. Although these mutant proteins were originally designed from different considerations, they turned out to have remarkably similar properties. Both the [H97A]recA protein and the [K248A]recA protein bind poorly to single-stranded DNA, have no single-stranded DNA-dependent ATP hydrolysis activity, and do not promote renaturation of complementary single-stranded DNA molecules or the ATP-dependent three-strand exchange reaction. Furthermore, both mutant proteins are defective in Mg(2+)-induced helical filament formation. To account for these results, we propose that the mutation of either histidine 97 or lysine 248 alters subunit interactions between recA monomers and that this leads to the loss of cooperative single-stranded DNA binding and DNA pairing activities. This proposal is consistent with the recently determined x-ray structure of the recA protein, which shows that although histidine 97 and lysine 248 are distant from one another in the monomer structure, these two residues are on the opposing complementary faces of the recA subunit and pack against each other at the interface between adjacent recA monomers in the helical filament (Story, R. M., Weber, I. T., and Steitz, T. A. (1992) Nature 355, 318-325).

Retroviral nucleocapsid proteins possess potent nucleic acid strand renaturation activity.

The nucleocapsid protein (NC) is the major genomic RNA binding protein that plays integral roles in the structure and replication of all animal retroviruses. In this report, select biochemical properties of recombinant Mason-Pfizer monkey virus (MPMV) and HIV-1 NCs are compared. Evidence is presented that two types of saturated Zn2 NC-polynucleotide complexes can be formed under conditions of low [NaCl] that differ in apparent site-size (n = 8 vs. n = 14). The formation of one or the other complex appears dependent on the molar ratio of NC to RNA nucleotide with the putative low site-size mode apparently predominating under conditions of protein excess. Both MPMV and HIV-1 NCs kinetically facilitate the renaturation of two complementary DNA strands, suggesting that this is a general property of retroviral NCs. NC proteins increase the second-order rate constant for renaturation of a 149-bp DNA fragment by more than four orders of magnitude over that obtained in the absence of protein at 37 degrees C. The protein-assisted rate is 100-200-fold faster than that obtained at 68 degrees C, 1 M NaCl, solution conditions considered to be optimal for strand renaturation. Provided that sufficient NC is present to coat all strands, the presence of 400-1,000-fold excess nonhomologous DNA does not greatly affect the reaction rate. The HIV-1 NC-mediated renaturation reaction functions stoichiometrically, requiring a saturated strand of DNA nucleotide:NC ratio of about 7-8, rather than 14. Under conditions of less protein, the rate acceleration is not realized. The finding of significant nucleic acid strand renaturation activity may have important implications for various events of reverse transcription particularly in initiation and cDNA strand transfer.

Kinetic modeling of the recA protein promoted renaturation of complementary DNA strands.

Quantitative agarose gel assays reveal that the recA protein promoted renaturation of complementary DNA strands (phi X DNA) proceeds in two stages. The first stage results in the formation of unit-length duplex DNA as well as a distribution of other products ("initial products"). In the second stage, the initial products are converted to complex multipaired DNA structures ("network DNA"). In the presence of ATP, the initial products are formed within 2 min and are then rapidly converted to network DNA. In the absence of ATP, the initial products are formed nearly as fast as with ATP present, but they are converted to network DNA at a much lower rate. The time-dependent formation of initial products and network DNA from complementary single strands for both the ATP-stimulated and ATP-independent reactions can be modeled by using a simple two-step sequential kinetic scheme. This model indicates that the primary effect of ATP in the recA protein promoted renaturation reaction is not on the initial pairing step (which leads to the formation of initial products) but rather is to increase the rate at which subsequent pairing events can occur.

ATP-independent renaturation of complementary DNA strands by the mutant recA1 protein from Escherichia coli.

In an effort to clarify the requirement for ATP in the recA protein-promoted renaturation of complementary DNA strands, we have analyzed the mutant recA1 protein which lacks single-stranded DNA-dependent ATPase activity at pH 7.5. Like the wild type, the recA1 protein binds to single-stranded DNA with a stoichiometry of one monomer per approximately four nucleotides. However, unlike the wild type, the mutant protein is dissociated from single-stranded DNA in the presence of ATP or ADP. The ATP analogue adenosine 5'-O-3' (thiotriphosphate) appears to stabilize the binding of recA1 protein to single-stranded DNA but does not elicit the stoichiometry of 1 monomer/8 nucleotides or the formation of highly condensed protein-DNA networks that are characteristic of the wild type recA protein in the presence of this analogue. The recA1 protein does not catalyze DNA renaturation in the presence of ATP, consistent with the dissociation of recA1 protein from single-stranded DNA under these conditions. However, it does promote a pattern of Mg2+-dependent renaturation identical to that found for wild type recA protein.

Kinetics of DNA renaturation catalyzed by the RecA protein of Escherichia coli.

The recA enzyme of Escherichia coli catalyzes renaturation of DNA coupled to hydrolysis of ATP. The rate of enzymatic renaturation is linearly dependent on recA protein concentration and shows saturation kinetics with respect to DNA concentration. The kinetic analysis of the reaction indicates that the Km for DNA is 65 microM while the kcat is approximately 48 pmol of duplex formed (pmol of recA)-1 (20 min)-1. RecA protein catalyzed renaturation has been characterized with respect to salt sensitivity, Mg2+ ion and pH optima, requirements for nucleoside triphosphates, and inhibition by nonhydrolyzable nucleoside triphosphates and analogues. These results are consistent with a Michaelis-Menten mechanism for DNA renaturation catalyzed by recA protein. A model is described in which oligomers of recA protein bind rapidly to single-stranded DNA, and in the presence of ATP, these nucleoprotein intermediates aggregate to bring complementary sequences into close proximity for homologous pairing. As with other DNA pairing reactions catalyzed by recA protein, ongoing DNA hydrolysis is required for renaturation. However, unlike the strand assimilation or transfer reaction, renaturation is inhibited by E. coli helix-destabilizing protein.

On the mechanism of renaturation of complementary DNA strands by the recA protein of Escherichia coli.

The renaturation of complementary DNA strands by the recA protein of Escherichia coli has been found to exhibit the following features. (i) Optimal renaturation occurs at recA protein levels below that required to saturate the DNA strands; saturating amounts of recA protein significantly reduce the rate of reaction. (ii) The reaction proceeds in the absence of a nucleotide cofactor but is markedly stimulated by ATP in the presence of 10 mM Mg2+. A similar stimulation occurs in the absence of ATP when the Mg2+ concentration is increased from 10 mM to 30-40 mM. (iii) Both the ATP-stimulated and the Mg2+-stimulated reactions follow apparent first-order kinetics. These results, taken together with the known effects of ATP and Mg2+ on the state of aggregation of recA protein, suggest that the association of recA monomers may play an important role in recA protein-promoted DNA renaturation.

Homologous pairing of DNA molecules promoted by a protein from Ustilago.

A protein from mitotic cells of Ustilago maydis was purified on the basis of its ability to reanneal complementary single strands of DNA. The protein catalyzed the uptake of linear single strands by super-helical DNA, but only in reactions with homologous combinations of single-strand fragments and super-helical DNA from phages phi X174 and fd. No reaction occurred with heterologous combinations. The protein also efficiently paired circular single strands and linear duplex DNA molecules. The product was a joint molecule in which the circular single strand displaced one strand of the duplex. Efficient pairing depended upon ATP, and ATPase activity was found associated with the purified protein. ATP-dependent reannealing of complementary single strands was not detectable in the rec1 mutant of Ustilago, which is deranged in meiotic recombination, as complete tetrads are rare, and is defective in radiation-induced mitotic gene conversion.

Evolutionary sequence divergence within repeated DNA families of higher plant genomes. I. Analysis of reassociation kinetics.

The higher proportion of repeated DNA sequences in the garden pea (Pisum sativum) than in the mung bean (Vigna radiata), as well as other differences between these legume genomes, are consistent with a higher rate of sequence amplification in the former. This hypothesis leads to a prediction that repeated sequence families in Pisum are mostly heterogeneous, as defined by Bendich and Anderson (1977), while Vigna families are homogeneous. An assay developed by these authors to distinguish between the two types of families, by comparison of reassociation rates at different temperatures, was utilized. The results for Vigna defied the predictions of the assay for either homogeneous or heterogeneous model. Evaluation of the kinetic data in light of the great diversity of repeated family copy numbers in both genomes enabled an interpretation of the results as consistent with heterogeneous families in Pisum and homogeneous families in Vigna. These tentative conclusions were supported by the results of a thermal denaturation (melting) assay described in the accompanying paper.

Novel histone H2A-like protein of escherichia coli.

A histone-like protein (H) from Escherichia coli has been purified to more than 98% homogeneity by using its capacity to inhibit DNA functions. H protein behaves as a dimer of 28,000-dalton subunits. The histone H2A-like properties of H protein are: (i) binding to DNA at a stoichiometry of 1 H protein dimer per 75 bases; (ii) abundance of about 30,000 molecules per cell, sufficient to bind about 20% of the chromosome; (iii) limiting digestion of double-stranded DNA by micrococcal nuclease; (iv) reannealing of complementary single-stranded DNA; (v) amino acid composition resembling that of eukaryotic histone H2A; (vi) neutralization of H protein by antibody specific for H2A; (vii) heat stability; and (viii) acid solubility. The capacity of H protein to bind DNA prevents its template or substrate functions n several reactions in vitro: DNA synthesis by several polymerases; transcription by RNA polymerase; DNA topoisomerase activity; and DNA-dependent ATP hydrolysis by rep protein, dnaB protein, or protein n'. Together with other histone-like proteins of E. coli, H protein may organize the E. coli chromosome into nucleosomes, such as in eukaryotic chromatin.

ATP-dependent renaturation of DNA catalyzed by the recA protein of Escherichia coli.

The product of the recA gene of Escherichia coli has been purified to near-homogeneity by a simple three-step procedure. Incubation of the recA protein with complementary single strands of DNA, Mg2+, and ATP results in the rapid formation of large DNA aggregates containing many branched structures. As judged by resistance to S1 nuclease and by electron microscopy, these aggregates contain both duplex and single-stranded regions. The renaturation and aggregation of DNA catalyzed by the recA protein is coupled to the hydrolysis of ATP. The recA protein purified from a cold-sensitive recA mutant does not catalyze DNA renaturation or aggregation at 28 degrees C, but does so at 37 degrees C, a finding which correlates with the recombination defect observed in vivo and indicates that this activity is an intrinsic function of the recA protein. These results suggest that the recA protein plays a specific role in strand transfer during recombination and possibly in postreplication repair of damaged DNA.

Localisation of foldback DNA sequences in nuclei chromosomes of Scilla, Secale, and of mouse.

Foldback DNA, prepared from mouse and Scilla sibirica main band DNA, and from rye (Secale cereale) total DNA, was characterised by denaturation, renaturation, and electron microscopy. 3H-cRNA of this DNA was hybridised in situ to nuclei and chromosomes of the respective species. There is no universal labelling pattern among the three species. In mouse, highly repetitive foldback DNA is present in the whole chromatin including the satellite DNA-containing regions. In Scilla sibirica, on the contrary, the highly repetitive foldback sequences are excluded form the satellite DNA loci and are arranged in clusters in the remaining chromatin. In rye, there is a clear preferential labelling of the chromocenters in the interphase nuclei as well as metaphase chromosomes, indicating that highly repetitive foldback DNA is preferentially located among other highly repetitive sequences.