18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

A Chromosome-Level Genome Assembly of the Non-Hematophagous Leech Whitmania pigra (Whitman 1884): Identification and Expression Analysis of Antithrombotic Genes.

Despite being a non-hematophagous leech, Whitmania pigra is widely used in traditional Chinese medicine for the treatment of antithrombotic diseases. In this study, we provide a high quality genome of W. pigra and based on which, we performed a systematic identification of the potential antithrombotic genes and their corresponding proteins. We identified twenty antithrombotic gene families including thirteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. Unexpectedly, a total of 79 antithrombotic genes were identified, more than a typical blood-feeding Hirudinaria manillensis, which had only 72 antithrombotic genes. In addition, combining with the RNA-seq data of W. pigra and H. manillensis, we calculated the expression levels of antithrombotic genes of the two species. Five and four gene families had significantly higher and lower expression levels in W. pigra than in H. manillensis, respectively. These results showed that the number and expression level of antithrombotic genes of a non-hematophagous leech are not always less than those of a hematophagous leech. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a non-hematophagous leech to date and will significantly enhance the investigation and utilization of leech derivatives in thrombosis therapy research and pharmaceutical applications.

Transcriptomic profiling and the first spatial expression analysis of candidate genes in the salivary gland of the East Asian medicinal leech, Hirudo nipponia.

Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.

Characterization of the natural peptidome of four leeches by integrated proteogenomics and pseudotargeted peptidomics.

Animal-derived drugs are an indispensable part of folk medicine worldwide. However, their chemical constituents are poorly approached, which leads to the low level of the quality standard system of animal-derived drugs and further causes a chaotic market. Natural peptides are ubiquitous throughout the organism, especially in animal-derived drugs. Thus, in this study, we used multi-source leeches, including Hirudo nipponica (HN), Whitmania pigra (WP), Whitmania acranulata (WA), and Poecilobdella manillensis (PM), as a model. A strategy integrating proteogenomics and novel pseudotargeted peptidomics was developed to characterize the natural peptide phenotype and screen for signature peptides of four leech species. First, natural peptides were sequenced against an in-house annotated protein database of closely related species constructed from RNA-seq data from the Sequence Read Archive (SRA) website, which is an open-sourced public archive resource. Second, a novel pseudotargeted peptidomics integrating peptide ion pair extraction and retention time transfer was established to achieve high coverage and quantitative accuracy of the natural peptides and to screen for signature peptides for species authentication. In all, 2323 natural peptides were identified from four leech species whose databases were poorly annotated. The strategy was shown to significantly improve peptide identification. In addition, 36 of 167 differential peptides screened by pseudotargeted proteomics were identified, and about one-third of them came from the leucine-rich repeat domain (LRR) proteins, which are widely distributed in organisms. Furthermore, six signature peptides were screened with good specificity and stability, and four of them were validated by synthetic standards. Finally, a dynamic multiple reaction monitoring (dMRM) method based on these signature peptides was established and revealed that one-half of the commercial samples and all of the Tongxinluo capsules were derived from WP. All in all, the strategy developed in this study was effective for natural peptide characterization and signature peptide screening, which could also be applied to other animal-derived drugs, especially for modelless species that are less studied in protein database annotation.

Life without blood: Molecular and functional analysis of hirudins and hirudin-like factors of the Asian non-hematophagous leech Whitmania pigra.

BACKGROUND: Several leech species of the genera Hirudo, Hirudinaria, and Whitmania are widely used in traditional Chinese medicine (TCM) for the oral treatment of disorders associated with blood stasis. Among them, the non-hematophagous leech Whitmania pigra expresses a variety of components that have the potential to act on the vertebrate blood coagulation system. OBJECTIVE: Whether the thrombin inhibitor hirudin, probably the most prominent leech-derived anticoagulant, is actually present in Whitmania pigra, is still a matter of debate. To answer that open question was the aim of the study. METHODS: We identified several putative hirudin-encoding sequences in transcriptome data of Whitmania pigra. Upon gene synthesis and molecular cloning the respective recombinant proteins were expressed in Escherichia coli, purified, processed, and eventually functionally characterized for thrombin-inhibitory potencies in coagulation assays. RESULTS: We were successful in the identification and functional characterization of several putative hirudins in Whitmania pigra. Some, but not all, of these factors are indeed thrombin inhibitors. Whitmania pigra hence expresses both hirudins (factors that inhibit thrombin) and hirudin-like factors (that do not or only very weakly inhibit thrombin). Furthermore, we revealed the exon/intron structures of the corresponding genes. Coding sequences of some putative hirudins of Whitmania pigra were present also in transcriptome datasets of Hirudo nipponia, a hematophagous leech that is likewise used in TCM. CONCLUSIONS: Based on both structural and functional data we provide very strong evidence for the expression of hirudins in Whitmania pigra. This is the first description of hirudins in a non-hematophagous leech.

The genome of medicinal leech (Whitmania pigra) and comparative genomic study for exploration of bioactive ingredients.

BACKGROUND: Leeches are classic annelids that have a huge diversity and are closely related to people, especially medicinal leeches. Medicinal leeches have been widely utilized in medicine based on the pharmacological activities of their bioactive ingredients. Comparative genomic study of these leeches enables us to understand the difference among medicinal leeches and other leeches and facilitates the discovery of bioactive ingredients. RESULTS: In this study, we reported the genome of Whitmania pigra and compared it with Hirudo medicinalis and Helobdella robusta. The assembled genome size of W. pigra is 177 Mbp, close to the estimated genome size. Approximately about 23% of the genome was repetitive. A total of 26,743 protein-coding genes were subsequently predicted. W. pigra have 12346 (46%) and 10295 (38%) orthologous genes with H. medicinalis and H. robusta, respectively. About 20 and 24% genes in W. pigra showed syntenic arrangement with H. medicinalis and H. robusta, respectively, revealed by gene synteny analysis. Furthermore, W. pigra, H. medicinalis and H. robusta expanded different gene families enriched in different biological processes. By inspecting genome distribution and gene structure of hirudin, we identified a new hirudin gene g17108 (hirudin_2) with different cysteine patterns. Finally, we systematically explored and compared the active substances in the genomes of three leech species. The results showed that W. pigra and H. medicinalis exceed H. robusta in both kinds and gene number of active molecules. CONCLUSIONS: This study reported the genome of W. pigra and compared it with other two leeches, which provides an important genome resource and new insight into the exploration and development of bioactive molecules of medicinal leeches.

Molecular mechanisms underlying hematophagia revealed by comparative analyses of leech genomes.

BACKGROUND: Leeches have been used in traditional Chinese medicine since prehistoric times to treat a spectrum of ailments, but very little is known about their physiological, genetic, and evolutionary characteristics. FINDINGS: We sequenced and assembled chromosome-level genomes of 3 leech species (bloodsucking Hirudo nipponia and Hirudinaria manillensis and nonbloodsucking Whitmania pigra). The dynamic population histories and genome-wide expression patterns of the 2 bloodsucking leech species were found to be similar. A combined analysis of the genomic and transcriptional data revealed that the bloodsucking leeches have a presumably enhanced auditory sense for prey location in relatively deep fresh water. The copy number of genes related to anticoagulation, analgesia, and anti-inflammation increased in the bloodsucking leeches, and their gene expressions responded dynamically to the bloodsucking process. Furthermore, the expanded FBN1 gene family may help in rapid body swelling of leeches after bloodsucking, and the expanded GLB3 gene family may be associated with long-term storage of prey blood in a leech's body. CONCLUSIONS: The high-quality reference genomes and comprehensive datasets obtained in this study may facilitate innovations in the artificial culture and strain optimization of leeches.

[Cloning and expression analysis of protein kinase C gene from Whitmania pigra].

Protein kinase C(PKC) is a type of protein kinase widely involved in cell proliferation and development, but the developmental mechanism in the gonads of androgynous animals is still unclear. In order to explore the role of protein kinase C in the development of Whitmania pigra germ cells, the Wh. pigra PKC(Wp-PKC) gene was cloned, bioinformatics analysis was conducted, and fluorescent quantitative PCR was used to analyze the expression of female and male gonads. The results showed that:(1)The cloned Wp-PKC had a full length of 2 580 bp, a relative molecular weight of 76 555.19, and contains an open reading frame encoding 670 amino acids, Wp-PKC was closely related to Danio rerio PKC-α and rat PKC-γ. The similarity of amino acid sequence was 55% and 58%.(2)The protein encoded by Wp-PKC had no signal peptide and was a hydrophilic protein. The secondary structure is mainly composed of random coils, α-helices, extended chains, folds and folds, with the largest proportion of random coils and α-helices. Wp-PKC protein does not contain a transmembrane domain. Multiple sequence alignment and domain prediction analysis show that Wp-PKC contains 4 conserved domains of classical protein kinase C.(3)Fluorescence quantitative results showed that the expression of Wp-PKC in Wh. pigra gonads was positively correlated with the development of germ cells, and the expression in male gonads was significantly higher than that in female gonads. In summary, Wp-PKC is a classic PKC, and Wp-PKC may promote the development of Wh. pigra, especially the development of male gonads, and provide references for further research on the developmental mechanisms of Wh. pigra.

Draft genome sequences of Hirudo medicinalis and salivary transcriptome of three closely related medicinal leeches.

BACKGROUND: Salivary cell secretion (SCS) plays a critical role in blood feeding by medicinal leeches, making them of use for certain medical purposes even today. RESULTS: We annotated the Hirudo medicinalis genome and performed RNA-seq on salivary cells isolated from three closely related leech species, H. medicinalis, Hirudo orientalis, and Hirudo verbana. Differential expression analysis verified by proteomics identified salivary cell-specific gene expression, many of which encode previously unknown salivary components. However, the genes encoding known anticoagulants have been found to be expressed not only in salivary cells. The function-related analysis of the unique salivary cell genes enabled an update of the concept of interactions between salivary proteins and components of haemostasis. CONCLUSIONS: Here we report a genome draft of Hirudo medicinalis and describe identification of novel salivary proteins and new homologs of genes encoding known anticoagulants in transcriptomes of three medicinal leech species. Our data provide new insights in genetics of blood-feeding lifestyle in leeches.

The hirudin-like factors HLF3 and HLF4-hidden hirudins of European medicinal leeches.

The hirudin-like factors 3 (HLF3) and 4 (HLF4) belong to a new class of leech-derived factors and are present in specimens of the three European medicinal leeches, Hirudo medicinalis, Hirudo verbana, and Hirudo orientalis, respectively. Here we describe the functional analysis of natural and synthetic variants of HLF3 and HLF4. Whereas the natural variants display only very low or no detectable anti-coagulatory activities, modifications within the N-termini in combination with an exchange of the central globular domain have the potency to greatly enhance the inhibitory effects of respective HLF3 and HLF4 variants on blood coagulation. Our results support previous observations on the crucial importance of all parts (both the N- and C-termini as well as the central globular domains) of hirudin and HLF molecules for thrombin inhibition.

Characterization of a monoacylglycerol lipase in the medicinal leech, Hirudo verbana.

Endocannabinoids are a class of lipid neuromodulators found throughout the animal kingdom. Among the endocannabinoids, 2-arachydonoyl glycerol (2-AG) is the most prevalent endocannabinoid and monoacylglycerol lipase (MAGL) is a serine hydrolase primarily responsible for metabolizing 2-AG in mammals. In the medicinal leech, Hirudo verbana, 2-AG has been found to be an important and multi-functional modulator of synaptic transmission and behavior. However, very little is known about the molecular components of its synthesis and degradation. In this study we have identified cDNA in Hirudo that encodes a putative MAGL (HirMAGL). The encoded protein exhibits considerable sequence and structural conservation with mammalian forms of MAGL, especially in the catalytic triad that mediates 2-AG metabolism. Additionally, HirMAGL transcripts are detected in the Hirudo central nervous system. When expressed in HEK 293 cells HirMAGL segregates to the plasma membrane as expected. It also exhibits serine hydrolase activity that is blocked when a critical active site residue is mutated. HirMAGL also demonstrates the capacity to metabolize 2-AG and this capacity is also prevented when the active site is mutated. Finally, HirMAGL activity is inhibited by JZL184 and MJN110, specific inhibitors of mammalian MAGL. To our knowledge these findings represent the first characterization of an invertebrate form of MAGL and show that HirMAGL exhibits many of the same properties as mammalian MAGL's that are responsible for 2-AG metabolism.

A novel protease-activated receptor 1 inhibitor from the leech Whitmania pigra.

Whitmania pigra has been used as a traditional Chinese medicine (TCM) for promoting blood circulation, alleviating blood coagulation, activating meridians and relieving stasis for several hundred years. However, the therapeutic components of this species, especially proteins and peptides were poorly exploited. Until now only a few of them were obtained by using chromatographic isolation and purification. In recent decade, transcriptome techniques were rapidly developed, and have been used to fully reveal the functional components of many animal venoms. In the present study, the cDNA of the salivary gland of Whitmania pigra was sequenced by illumina and the transcriptome was assembled by using Trinity. The proteome were analysed by LC-MS/MS. Based on the data of the transcriptome and the proteome, a potential antiplatelet protein named pigrin was found. Pigrin was cloned and expressed using P. pastoris GS115. The antiplatelet andantithrombotic bioactivities of pigrin were tested by using aggregometer and the rat arterio-venous shunt thrombosis model, respectively. Thebleeding time of pigrin was measured by a mice tail cutting method. The docking of pigrin and protease-activated receptor 1 (PAR1) or collagen were conducted using the ZDOCK Server. Pigrin was able to selectively inhibit platelet aggregation stimulated by PAR1 agonist and collagen. Pigrin attenuated thrombotic formation in vivo in rat, while did not prolong bleeding time at its effective dosage. There are significant differences in the key residues participating in binding of Pigrin-Collagen complex from Pigrin-PAR1 complex. In conclusion,a novel PAR1 inhibitor pigrin was found from the leech Whitmania pigra. This study helped to elucidate the mechanism of the leech for the treatment of cardiovascular disorder.

Phylogenetic Position and Description of a New Species of Medicinal Leech from the Eastern United States.

A new species of medicinal leech, Macrobdella mimicus n. sp., is described from specimens collected in Maryland; this is the first description of a North American macrobdellid since 1975. Superficially, the new species resembles the well-known Macrobdella decora, as both species possess 4 accessory pores arranged symmetrically on the ventral surface, yet the new species is distinguished from M. decora in possessing 4-4½ annuli (rather than 3½) between the gonopores and 4 annuli (rather than 5 annuli) between the female gonopore and the first pair of accessory pores. Phylogenetic analyses, based on 2 mitochondrial and 2 nuclear loci for a set of closely related taxa, confirms the placement of the new species within the family Macrobdellidae and places it as the sister taxon to M. decora and M. diplotertia.

Hirudin and Decorsins of the North American Medicinal Leech Macrobdella decora: Gene Structure Reveals Homology to Hirudins and Hirudin-like Factors of Eurasian Medicinal Leeches.

Blood-sucking leeches, some of which are referred to as medicinal leeches, have caught attention not only because of their medical purposes, but also as study organisms to conduct research within fields as diverse as neurobiology, osmoregulation, ecology, and phylogeny. Of particular interest is the question whether hemophagy in leeches is of single origin or evolved independently several times. A key component in the saliva of hematophagous leeches is hirudin, a strong natural inhibitor of thrombin and hence the blood coagulation cascade. Multiple isoforms of hirudin have been described within and among several leech species and genera, often based on sequence data only. The identification of hirudin-like factors (HLFs) illustrated the necessity to underpin such predictions by functional tests. We overexpressed and purified the hirudin of the North American medicinal leech, Macrobdella decora, and proved its thrombin-inhibiting activity. In addition, analysis of the gene structure of both hirudin and some of the decorsins of M. decora clearly indicated conserved exon and intron positions when compared to genes of hirudins and HLFs of Eurasian medicinal leeches. Our data provide evidence for the incorporation of decorsins into the hirudin superfamily and support the concept of a single origin of blood feeding in jawed leeches.

[Cloning of Guamerin gene in Whitmania pigra and its spatio-temporal expression analysis after ingestion].

The present study cloned wpGuamerin gene from a non-bloodsucking leech (Whitmania pigra), and the bioinformatics analysis of the sequence was performed. Additionally, the effects of feeding duration on the expression profile of the wp Guamerin gene were explored. The results showed that its sequence consisted of 295 nucleotides encoding a peptide of 83 amino acids(Genbank: KX768545), and its relative molecular weight is 9 145.95 Da. wp Guamerin does not encode proteins with a signal peptide, belonging to the hydrophilic protein. Its secondary structure is mainly composed of α-helix, extending chain, folding and random curl. Its similarity with other blood-sucking leeches ranges from 29% to 65%. The results revealed that wpGuamerin mRNA was detected higher expression in muscle than in salivary glands of Wh. pigra, and did not expressed in ingluvies and intestine. Its expression in muscle and salivary glands showed a single peak curve after feeding and the peak was observed in the 1st and 3rd after feeding, respectively. In summary, wp Guamerin in Wh. pigra is a small molecule polypeptide protein and is different from the Guamerin in blood-sucking leeches. wpGuamerin does not express in the digestive tract of Wh. pigra, and mainly express in muscle. Feeding behavior would stimulate the expression of wpGuamerin gene in muscle and salivary glands, but not in digestive tract.

[Effects of Cu²âº enrichment and release on growth， internal quality and relative gene expression of Whitmania pigra].

The present study explored the effects of Cu²âºenrichment and release on the growth and internal quality of Whitmania pigra, and the regularity of enrichment and release in different tissues of Wh. pigra. In the range of safe concentration(SC), a certain concentration of Cu²âº was added to the Wh. pigra for 50 days, and stopped adding for another 50 days. The growth index of Wh. pigra, Cu²âº content in different tissues, and the internal quality were determined. The results showed that the average body weight of Wh. pigra in 0.014 mg·L⁻¹ of Cu²âº group was significantly higher than that in control group during the experimental period (P<0.05), and the mortality rate was lower than that in the control group. The specific growth rate, digestive enzyme activity, growth and digestive enzyme related gene expression of Wh. pigra in Cu²âº group were significantly higher than that in the control group (P<0.05) during the early 40 days of enrichment, and there was no significant difference in the release period. In Cu²âº group, the expression of immune enzyme and immune enzyme related gene of Wh. pigra increased first and then decreased compared with control group (P<0.05). The ability of enriched Cu²âº in different tissues of Wh. pigra was digestive tract>muscle>skin. The ability of release Cu²âº was muscle>digestive tract>skin. There was no significant difference in the internal quality and hirudin gene expression between Cu²âº group and control group. In conclusion, Cu²âº can improve the expression of digestive enzymes, immune enzyme and related genes of Wh. pigra, promote the growth of Wh. pigra and enhance their immunity, but it doesn't affect the internal quality of Wh. pigra. The Wh. pigra can completely release Cu²âº within 30 days.

More than just one: multiplicity of Hirudins and Hirudin-like Factors in the Medicinal Leech, Hirudo medicinalis.

Blood-sucking leeches like the medicinal leech, Hirudo medicinalis, have been used for medical purposes since ancient times. During feeding, medicinal leeches transfer a broad range of bioactive substances into the host's wound to prevent premature hemostasis and blood coagulation. Hirudin is probably the best known of these substances. Despite its long history of investigation, recombinant production and clinical use, there still exist conflicting data regarding the primary structure of hirudin. Entirely unclear is the potential biological significance of three different subtypes and many isoforms of hirudins that have been characterized so far. Furthermore, there is only incomplete information on their cDNA sequences and no information at all on gene structures and DNA sequences are available in the databases. Our efforts to fill these gaps revealed the presence of multiple hirudin-encoding genes in the genome of Hirudo medicinalis. We have strong evidence for the expression of all three subtypes of hirudin within individual leeches and for the expression of additional hirudins or hirudin-like factors that may have different biological functions and may be promising candidates for new drugs.

[Sequence analysis of rDNA-ITS gene in medicinal leeches and their closely related species (Euhirudinea:Arhynchobdellida)].

OBJECTIVE: To explore the phylogenetic relationships among medicinal leeches and their closely related species by comparing their ITS gene fragments. METHODS: 8 different leech species, including Whitmania pigra, Whitmania acranulata, Whitmania laevis, Hirudo nipponia, Poecilobdella manillensis, Poecilobdella javanica, Poecilobdella hubeiensis and Erpobdella octoculata were collected as the materials for study. After the total DNA of all samples was extracted, amplified by PCR and cloned, their ITS sequence, AT content, variable sites and evolutionary relationships were analyzed. RESULTS: The length of ITS was 948-981 bp with 210 variable sites and 43 inserts on/deletion. The average G + C content was high up to 56.0%-57.8%. The aligned ITS sequence demonstrated that their ITS genes were relatively conserved in species. Data analysis showed that the relationship between E. octoculata and P. javanica was closer than others, their genetic distance was only 0.007. Through the phylogenetic tree analysis, three species of Haemopidae and four species of Hirudinidae were obviously clustered into two branches. CONCLUSION: The results support the taxonomic status of Haemopidae and Hirudinidae, and provide sufficient evidences that Erpobdella octoculata and Poecilobdella javanica should not be assigned to two genera, of which the taxonomic system should be further researched.

The medicinal leech genome encodes 21 innexin genes: different combinations are expressed by identified central neurons.

Gap junctional proteins are important components of signaling pathways required for the development and ongoing functions of all animal tissues, particularly the nervous system, where they function in the intracellular and extracellular exchange of small signaling factors and ions. In animals whose genomes have been sufficiently sequenced, large families of these proteins, connexins, pannexins, and innexins, have been found, with 25 innexins in the nematode Caenorhabditis elegans Starich et al. (Cell Commun Adhes 8: 311-314, 2001) and at least 37 connexins in the zebrafish Danio rerio Cruciani and Mikalsen (Biol Chem 388:253-264, 2009). Having recently sequenced the medicinal leech Hirudo verbana genome, we now report the presence of 21 innexin genes in this species, nine more than we had previously reported from the analysis of an EST-derived transcriptomic database Dykes and Macagno (Dev Genes Evol 216: 185-97, 2006); Macagno et al. (BMC Genomics 25:407, 2010). Gene structure analyses show that, depending on the leech innexin gene, they can contain from 0 to 6 introns, with closely related paralogs showing the same number of introns. Phylogenetic trees comparing Hirudo to another distantly related leech species, Helobdella robusta, shows a high degree of orthology, whereas comparison to other annelids shows a relatively low level. Comparisons with other Lophotrochozoans, Ecdyzozoans and with vertebrate pannexins suggest a low number (one to two) of ancestral innexin/pannexins at the protostome/deuterostome split. Whole-mount in situ hybridization for individual genes in early embryos shows that ∼50% of the expressed innexins are detectable in multiple tissues. Expression analyses using quantitative PCR show that ∼70% of the Hirudo innexins are expressed in the nervous system, with most of these detected in early development. Finally, quantitative PCR analysis of several identified adult neurons detects the presence of different combinations of innexin genes, a property that may underlie the participation of these neurons in different adult coupling circuits.

[Analysis of genetic differentiation and phylogenetic relationship between Whitmania pigra and Hirudo nipponia based on ITS sequence].

OBJECTIVE: To evaluate the genetic differentiation and phylogenetic relationship between Whitmania pigra Whitman and Hirudo nipponia Whitman. METHOD: By the sequences of the rDNA internal transcribed spacer (ITS) the molecular phylogenetic tree was constructed by MP method using software MEGA 4.0. RESULT: The average length of ITS was 857.2-861.2 bp. The A, T, G and C contents in this fragment were 25.12%, 28.28%, 17.34%, 29.29%, respectively. The GC content was higher than the AT content. Little sequence variation was observed in ITS gene fragments with in species, and transition in only 45 loci was revealed in 14 populations. 14 W. pigra and H. nipponia populations were clustered into 2 groups by MP phylogenetic tree. CONCLUSION: The results also showed that the intraspecific variation was dominated in variation types of W. pigra and H. nipponia. The classification result of W. pigra and H. nipponia and its adulterants based on DNA sequences are not totally consistent with those based on classification. It showed that a little of mutation of base in ITS sequences had occurred in the process of evolution, such as transition cites, transvertion cites among base or base gap.