First Detection of Atractylodes Mild Mottle Virus in Atractylodes lancea (Thunb.) DC. in Hubei Province of China.

The cultivated aromatic medicinal herb Atractylodes lancea (Thunb.) DC. is widely used in the pharmaceuticals, nutraceuticals, and cosmetics industries (Na-Bangchang et al. 2014; Zhan et al. 2023). Huanggang in Hubei Province is a major production area for A. lancea (Huang et al. 2022; Wang et al. 2023). In April 2023, more than two-thirds of the surveyed plant leaves in this region exhibited virus-like symptoms, such as curling and mosaic patterns. To identify the underlying cause, 80 symptomatic plant leaf samples were collected from four fields (20 leaves per field) in this region and pooled for virome analysis. Total RNA, including ribosomal RNA, was extracted from the pooled samples using the Plant RNA Extraction Mini Kit (Onrew Biotech, Guangdong, China), for sequencing library construction. The Illumina NovaSeq 6000 platform was used to sequence the library and generate 150 bp paired-end reads. After processing the raw data with Trimmomatic software, a total of 44,354,650 high-quality clean reads were obtained. The clean reads were aligned against ribosomal RNA using BWA software (v0.7.17) to avoid interference and eliminate corresponding sequences. After removing potential contamination, contig assembly of the clean reads was performed using Megahit software (v1.2.9). The resulting contigs were compared with the virus NT database using the BLASTn program. Sequence pairwise comparison revealed 8 contigs (574 nt to 2243 nt) with identities ranging from 81.88% to 90.77% with Atractylodes mild mottle virus (AMMV, NC_027924.1, Lim et al., 2015). Additionally, contigs mapped to Carlavirus, Pelarspovirus, and other plant viruses in our virome dataset had low coverage and pairwise identity (less than 70%), which need to be further investigated. The presence of AMMV was confirmed by aligning the clean reads to the reference sequence (NC_027924.1) using BWA and SAMtools software, resulting in a consensus sequence (8024 nt) with gaps. DNA extraction from the pooled samples was performed using the Rapid Universal Genomic DNA Extraction Kit (Simgen, Zhejiang, China). Two pairs of specific primers, 3399F (5'-AAAGAAGAACCTCCTGATACGG-3')/5924R (5'-TGAACCTGATTCTCTTGGC-3') and 1830F (5'- CTCAGGAAATCCCAATGC -3')/3640R(5'-TTTCCCAATGTTCTTCGGG-3'), were designed to amplify the complete gene sequences of polymerase and coat protein (CP), based on the consensus sequence. The PCR products with the lengths of 2521 bp and 1814 bp were cloned into the pMD18-T vector (Takara Biotech, Dalian, China) for sequencing. The BLASTn analysis showed that the polymerase and CP gene sequences shared an identity of 94.51% (1929/2041 nt) and 88.41% (1419/1605 nt) with the AMMV isolate (NC_027924.1), respectively. The sequences have been deposited in GenBank under the accession numbers OR544810 and OR544811. We collected leaves from 32 A. lancea plants (16 symptomatic and 16 asymptomatic) in the fields. RT-PCR was conducted using CPF (5'-CTGCGAATATGAAAGTGC-3') and CPR (5'-GGTGAGCTTGTCTGTTAGG-3') primers, which were designed targeting a 527bp fragment of the CP gene (OR544811). Amplicons of the expected size (527bp) were detected in 24 plants (11 symptomatic and 13 asymptomatic), three of which were sequenced by Sanger sequencing, showing a 100% match to OR544811. These findings indicate that AMMV is prevalent in the major production area of A. lancea. Further research is needed to better characterize the potential risks of AMMV to A. lancea cultivation in China as well as other countries.

Effect of ABT-639 on Cav3.2 channel activity and its analgesic actions in mouse models of inflammatory and neuropathic pain.

Cav3.2 T-type calcium channels are important targets for pain relief in rodent models of inflammatory and neuropathic pain. Even though many T-type channel blockers have been tested in mice, only one molecule, ABT-639, has been tested in phase II clinical studies and did not produce analgesic effects over placebo. Here we examined the effects of ABT-639 on Cav3.2 channel activity in tsA-201 cells and dorsal root ganglion (DRG) neurons, in comparison with another established Cav3.2 inhibitor Z944. These experiments revealed that Z944 mediated ∼100-fold more potent inhibition of Cav3.2 currents than ABT-639, with the latter blocking channel activity by less than 15 percent when applied at a concentration of 30 µM. A slight increase in ABT-639 potency was observed at more depolarized holding potentials, suggesting that this compound may act preferentially on inactivated channels. We tested the effects of both compounds in the Complete Freund's Adjuvant (CFA) model of chronic inflammatory pain, and in partial sciatic nerve injury model of neuropathic pain in mice. In the neuropathic pain model, both Z944 and ABT-639 reversed mechanical hypersensitivity to similar degrees when delivered systemically, but remarkably, when delivered intrathecally, only Z944 was effective. In the CFA model, both compounds reversed thermal hyperalgesia upon systemic delivery, but only Z944 mediated pain relief upon intrathecal delivery, indicating that ABT-639 acts primarily at peripheral sites. ABT-639 lost its analgesic effects in CFA treated Cav3.2 null mice, indicating that these channels are essential for ABT-639-mediated pain relief despite its poor inhibition of Cav3.2 currents.

Identification and Characterization of Chemical Constituents from Ammopiptanthus nanus Stem and Their Metabolites in Rats by UHPLC-Q-TOF-MS/MS.

Ammopiptanthus nanus as a Kirgiz medicine is widely used for the treatment of frostbite and chronic rheumatoid arthritis. However, due to a lack of systematic research on the chemical components of A. nanus and their metabolites, the bioactive components in it remain unclear. Herein, a reliable strategy based on UHPLC-Q-TOF-MS/MS was established to comprehensively analyze the chemical components and their metabolites in vivo. In total, 59 compounds were identified from A. nanus stem extract, among which 14 isoflavones, 10 isoprenylated isoflavones, 4 polyhydroxy flavonoids, 9 alkaloids and 1 polyol were characterized for the first time. After oral administration of A. nanus stem extract, 30 prototype constituents and 28 metabolites (12 phase I and 16 phase II metabolites) were speculated on and identified in rat serum, urine and feces. Furthermore, the metabolic pathways of the chemical components were systematically analyzed and proposed. In conclusion, the chemical components from A. nanus stem and their metabolites in vivo were first studied, which may provide useful chemical information for further study on the effective material basis and pharmacological mechanism of A. nanus.

Atopic dermatitis (eczema) guidelines: 2023 American Academy of Allergy, Asthma and Immunology/American College of Allergy, Asthma and Immunology Joint Task Force on Practice Parameters GRADE- and Institute of Medicine-based recommendations.

BACKGROUND: Guidance addressing atopic dermatitis (AD) management, last issued in 2012 by the American Academy of Allergy, Asthma and Immunology/American College of Allergy, Asthma and Immunology Joint Task Force, requires updating as a result of new treatments and improved guideline and evidence synthesis methodology. OBJECTIVE: To produce evidence-based guidelines that support patients, clinicians, and other decision-makers in the optimal treatment of AD. METHODS: A multidisciplinary guideline panel consisting of patients and caregivers, AD experts (dermatology and allergy/immunology), primary care practitioners (family medicine, pediatrics, internal medicine), and allied health professionals (psychology, pharmacy, nursing) convened, prioritized equity, diversity, and inclusiveness, and implemented management strategies to minimize influence of conflicts of interest. The Evidence in Allergy Group supported guideline development by performing systematic evidence reviews, facilitating guideline processes, and holding focus groups with patient and family partners. The Grading of Recommendations Assessment, Development and Evaluation (GRADE) approach informed rating the certainty of evidence and strength of recommendations. Evidence-to-decision frameworks, subjected to public comment, translated evidence to recommendations using trustworthy guideline principles. RESULTS: The panel agreed on 25 recommendations to gain and maintain control of AD for patients with mild, moderate, and severe AD. The eAppendix provides practical information and implementation considerations in 1-2 page patient-friendly handouts. CONCLUSION: These evidence-based recommendations address optimal use of (1) topical treatments (barrier moisturization devices, corticosteroids, calcineurin inhibitors, PDE4 inhibitors [crisaborole], topical JAK inhibitors, occlusive [wet wrap] therapy, adjunctive antimicrobials, application frequency, maintenance therapy), (2) dilute bleach baths, (3) dietary avoidance/elimination, (4) allergen immunotherapy, and (5) systemic treatments (biologics/monoclonal antibodies, small molecule immunosuppressants [cyclosporine, methotrexate, azathioprine, mycophenolate, JAK inhibitors], and systemic corticosteroids) and UV phototherapy (light therapy).

[Cardiovascular complications in malaria: a review].

Malaria, one of the major global public health events, is a leading cause of mortality and morbidity among children and adults in tropical and subtropical regions(mainly in sub-Saharan Africa), threatening human health. It is well known that malaria can cause various complications including anemia, blackwater fever, cerebral malaria, and kidney damage. Conventionally, cardiac involvement has not been listed as a common reason affecting morbidity and mortality of malaria, which may be related to ignored cases or insufficient diagnosis. However, the serious clinical consequences such as acute coronary syndrome, heart failure, and malignant arrhythmia caused by malaria have aroused great concern. At present, antimalarials are commonly used for treating malaria in clinical practice. However, inappropriate medication can increase the risk of cardiovascular diseases and cause severe consequences. This review summarized the research advances in the cardiovascular complications including acute myocardial infarction, arrhythmia, hypertension, heart failure, and myocarditis in malaria. The possible mechanisms of cardiovascular diseases caused by malaria were systematically expounded from the hypotheses of cell adhesion, inflammation and cytokines, myocardial apoptosis induced by plasmodium toxin, cardiac injury secondary to acute renal failure, and thrombosis. Furthermore, the effects of quinolines, nucleoprotein synthesis inhibitors, and artemisinin and its derivatives on cardiac structure and function were summarized. Compared with the cardiac toxicity of quinolines in antimalarial therapy, the adverse effects of artemisinin-derived drugs on heart have not been reported in clinical studies. More importantly, the artemisinin-derived drugs demonstrate favorable application prospects in the prevention and treatment of cardiovascular diseases, and are expected to play a role in the treatment of malaria patients with cardiovascular diseases. This review provides reference for the prevention and treatment of malaria-related cardiovascular complications as well as the safe application of antimalarials.

Systemic treatments for atopic dermatitis (eczema): Systematic review and network meta-analysis of randomized trials.

BACKGROUND: Atopic dermatitis (AD) is an inflammatory skin condition with multiple systemic treatments and uncertainty regarding their comparative impact on AD outcomes. OBJECTIVE: We sought to systematically synthesize the benefits and harms of AD systemic treatments. METHODS: For the 2023 American Academy of Allergy, Asthma & Immunology and American College of Allergy, Asthma, and Immunology Joint Task Force on Practice Parameters AD guidelines, we searched MEDLINE, EMBASE, CENTRAL, Web of Science, and GREAT databases from inception to November 29, 2022, for randomized trials addressing systemic treatments and phototherapy for AD. Paired reviewers independently screened records, extracted data, and assessed risk of bias. Random-effects network meta-analyses addressed AD severity, itch, sleep, AD-related quality of life, flares, and harms. The Grading of Recommendations Assessment, Development and Evaluation approach informed certainty of evidence ratings. This review is registered in the Open Science Framework (https://osf.io/e5sna). RESULTS: The 149 included trials (28,686 patients with moderate-to-severe AD) evaluated 75 interventions. With high-certainty evidence, high-dose upadacitinib was among the most effective for 5 of 6 patient-important outcomes; high-dose abrocitinib and low-dose upadacitinib were among the most effective for 2 outcomes. These Janus kinase inhibitors were among the most harmful in increasing adverse events. With high-certainty evidence, dupilumab, lebrikizumab, and tralokinumab were of intermediate effectiveness and among the safest, modestly increasing conjunctivitis. Low-dose baricitinib was among the least effective. Efficacy and safety of azathioprine, oral corticosteroids, cyclosporine, methotrexate, mycophenolate, phototherapy, and many novel agents are less certain. CONCLUSIONS: Among individuals with moderate-to-severe AD, high-certainty evidence demonstrates that high-dose upadacitinib is among the most effective in addressing multiple patient-important outcomes, but also is among the most harmful. High-dose abrocitinib and low-dose upadacitinib are effective, but also among the most harmful. Dupilumab, lebrikizumab, and tralokinumab are of intermediate effectiveness and have favorable safety.

Mollugin activates GLP-1R to improve cognitive dysfunction in type 2 diabetic mice.

AIMS: The incidence of diabetic cognitive dysfunction is increasing year by year, and it has gradually become a research hot spot. Studies have shown that glucagon-like peptide-1 receptor (GLP-1R) agonists can improve cognitive dysfunction in diabetic patients. This study focuses on whether small molecule GLP-1R agonists from traditional Chinese medicine (TCM) can improve the diabetic cognitive dysfunction. MATERIALS AND METHODS: The small molecules from TCM were screened by cell membrane chromatography (CMC) with GLP-1R-HEK293 cell membrane column. MTT assay, flow cytometry, immunofluorescence cytochemistry and other methods were used to determine the effects of mollugin on the apoptosis rate and reactive oxygen species (ROS) level of high glucose (HG)/hydrogen peroxide (H2O2) induced PC12 cells. Real-Time PCR was used to detect mRNA expression in mouse cerebral cortex. Water maze test was further used to confirm the effect of mollugin on cognitive dysfunction in T2DM mice. KEY FINDINGS: Mollugin bound to GLP-1R, promoted Ca2+ influx, increased insulin secretion and cAMP content in ß-TC-6 cells. Mollugin enhanced the cell viability, ameliorated apoptosis, reduced intracellular ROS levels in HG/H2O2-injured PC12 cells. Mollugin reduced the T2DM mice's escape latency, improved neuronal cell damage, decreased the expression of Pik3ca, Akt1 and Mapk1 mRNA in the cerebral cortex tissue. SIGNIFICANCE: The results suggest that mollugin could improve cognitive dysfunction in T2DM mice through activating GLP-1R/cAMP/PKA signal pathway.

Schisandrin B, a potential GLP-1R agonist, exerts anti-diabetic effects by stimulating insulin secretion.

Diabetes mellitus is a metabolic disease that is characterized by elevated blood sugar. Although glucagon-like peptide-1 receptor agonists (GLP-1RA) lower blood glucose in a glucose-dependent manner, most of them are macromolecule polypeptides. Macromolecular peptides are relatively expensive and inconvenient compared with small molecules. Therefore, this study sought to identify the small molecules binding to GLP-1R via cell membrane chromatography (CMC), confirm their agonistic activity, and further study its beneficial effects in a mouse model of type 2 diabetes mellitus (T2DM) induced by a combination of high-fat diet and streptozotocin. We used CMC, calcium imaging and molecular docking techniques to screen and identify the potential small molecule Schisandrin B (Sch B), which exhibits a strong binding effect to GLP-1R, from the small molecule library of traditional Chinese medicine. Through in-vitro experiments, we found that Sch B stimulated insulin secretion in ß-TC-6 cells, while GLP-1R antagonist Exendin9-39, adenylate cyclase inhibitor SQ22536, and protein kinase A (PKA) inhibitor H89 could significantly inhibit the insulin secretion induced by Sch B. In vivo, Sch B significantly improved fasting blood glucose levels, intraperitoneal glucose tolerance test damage, and the status of pancreatic tissue damage, and reduced serum insulin levels, total cholesterol, triglyceride and low density lipoprotein in T2DM mice. These results indicate that Sch B alleviates T2DM by promoting insulin release through the GLP-1R/cAMP/PKA signaling pathway, suggesting that Sch B may be a potential GLP-1RA, which is expected to provide a new therapeutic strategy for the prevention and treatment of T2DM.

In vivo anti-hyperuricemia and anti-gouty arthritis effects of the ethanol extract from Amomumvillosum Lour.

The incidence of hyperuricemia and gout has been increasing year by year, and it is showing a younger trend. However, the first-line drugs currently used for hyperuricemia and gouty arthritis have serious side effects that limit their clinical application. Amomum villosum Lour. has been widely used in China for thousands of years as a traditional medical and edible plant, and previous screening showed that the ethanol extract of Amomum villosum Lour. could effectively inhibit the activity of xanthine oxidase. Based on this discovery, this paper had achieved in-depth mechanism research. The results showed that the ethanol extract of Amomum villosum Lour. could treat hyperuricemia by reducing the production of uric acid via inhibition of xanthine oxidase and increasing the excretion of uric acid via regulation of urate transporters. Meanwhile, the extract also showed a certain protective effect on hepatic and renal damage caused by hyperuricemia. With the formation of extensive uric acid, gouty arthritis will be induced by the deposition of monosodium urate in the joint. The extract could also relieve the inflammation by reducing the expression of inflammatory cytokines. In conclusion, the extract deserves focused research and development as a potential medicine, health care product or supplemented food for the prevention and treatment of hyperuricemia and gouty arthritis.

eg Occupancy as a Predictive Descriptor for Spinel Oxide Nanozymes.

Functional nanomaterials offer an attractive strategy to mimic the catalysis of natural enzymes, which are collectively called nanozymes. Although the development of nanozymes shows a trend of diversification of materials with enzyme-like activity, most nanozymes have been discovered via trial-and-error methods, largely due to the lack of predictive descriptors. To fill this gap, this work identified eg occupancy as an effective descriptor for spinel oxides with peroxidase-like activity and successfully predicted that the eg value of spinel oxide nanozymes with the highest activity is close to 0.6. The LiCo2O4 with the highest activity, which is finally predicted, has achieved more than an order of magnitude improvement in activity. Density functional theory provides a rationale for the reaction path. This work contributes to the rational design of high performance nanozymes by using activity descriptors and provides a methodology to identify other descriptors for nanozymes.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 µm (578.75 - 902.65 µm), maximum body width (W) = 471.97 ± 70.95 µm (318.7 - 586.3 µm), stylet length = 15.18 ± 0.96 µm (13.52 - 17.04 µm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 µm (2.60 - 3.80µm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 µm (375.3 - 552.5 µm), stylet length =12.59 ± 1.39 µm (10.5 - 16.8 µm), tail length= 53.35 ± 1.55 µm (51.8 - 54.9 µm), hyaline tail terminus =11.45 ± 0.65 µm (10.2 - 12.1 µm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

Dnah9 mutant mice and organoid models recapitulate the clinical features of patients with PCD and provide an excellent platform for drug screening.

Primary cilia dyskinesia (PCD) is a rare genetic disease caused by ciliary structural or functional defects. It causes severe outcomes in patients, including recurrent upper and lower airway infections, progressive lung failure, and randomization of heterotaxy. To date, although 50 genes have been shown to be responsible for PCD, the etiology remains elusive. Meanwhile, owing to the lack of a model mimicking the pathogenesis that can be used as a drug screening platform, thereby slowing the development of related therapies. In the current study, we identified compound mutation of DNAH9 in a patient with PCD with the following clinical features: recurrent respiratory tract infections, low lung function, and ultrastructural defects of the outer dynein arms (ODAs). Bioinformatic analysis, structure simulation assay, and western blot analysis showed that the mutations affected the structure and expression of DNAH9 protein. Dnah9 knock-down (KD) mice recapitulated the patient phenotypes, including low lung function, mucin accumulation, and increased immune cell infiltration. Immunostaining, western blot, and co-immunoprecipitation analyses were performed to clarify that DNAH9 interacted with CCDC114/GAS8 and diminished their protein levels. Furthermore, we constructed an airway organoid of Dnah9 KD mice and discovered that it could mimic the key features of the PCD phenotypes. We then used organoid as a drug screening model to identify mitochondrial-targeting drugs that can partially elevate cilia beating in Dnah9 KD organoid. Collectively, our results demonstrated that Dnah9 KD mice and an organoid model can recapture the clinical features of patients with PCD and provide an excellent drug screening platform for human ciliopathies.

Effectiveness and safety of Danmu extract syrup for acute upper respiratory tract infection in children: A real-world, prospective cohort study.

AIM: To evaluate the effectiveness and safety of Danmu Extract Syrup for the treatment of acute upper respiratory tract infection (AURI) in children. METHODS: In this prospective cohort study, we enrolled children with AURI in the pediatric outpatient department and emergency department of West China Second Hospital. According to the treatment, they were divided into two groups: Danmu Extract Syrup Group (Danmu Group) and Xiaoer Chiqiao Granule Group (Chiqiao Group). The primary outcome was time to symptom remission, and the secondary outcomes were defervescence time, relief time, admission rate, and adherence. We used restricted mean survival time (RMST) to quantify the treatment effects and test noninferiority for primary outcome. Propensity score matching (PSM) was used to adjust confounding. Subgroup analysis and sensitivity analysis were used to verify the robustness of results. RESULTS: We enrolled 1036 children with AURI, including 516 in Danmu Group and 520 in Chiqiao Group. After PSM, no significant difference was observed in the baseline characteristics of the two groups. The primary results showed that the RMST difference was -3 h (95% CI: -15.1 to 9.1) and the upper limit of the 95% CI was less than the noninferiority margin of 11 h. There was no statistical difference in the secondary outcomes except for defervescence between the two groups. The results of safety analysis showed that the incidence of adverse events occurred is 4.1% in Danmu Group, which was lower than the incidence of Chiqiao Group (6.9%). CONCLUSION: This study indicated that Danmu extract syrup is noninferiority to Chiqiao Granule for AURI in children.

Shengmai Yin alleviated plaque vulnerability and ischemic myocardial damage in diesel exhaust particle-aggravated atherosclerosis with myocardial ischemia.

Exposure to diesel exhaust particles (DEP) increases the risk of ischemic heart disease, especially heart attacks and ischemic/thrombotic strokes. Shengmai Yin (SMY) is a traditional Chinese medicine used to treat coronary heart disease. The aim of this study was to determine the protective role of SMY and the mechanism by which SMY affects DEP-induced cardiovascular injury. This study is expected to provide the basis for the development of an adaptive signature of SMY in the prevention of atherosclerotic cardiovascular disease and premature death from global air pollution exposure. We developed animal models of myocardial ischemia and atherosclerosis (AS) in response to DEP exposure. After SMY treatment, serum lipids returned to normal. Aortic plaque area and MMP9 expression were significantly reduced and collagen fiber expression increased after SMY treatment compared to DEP exposure alone. Thus, the risk of plaque formation and vulnerability is reduced. In addition, SMY improved left ventricular structure, morphology, function, blood flow, infarct area, myocardial damage, and ROS accumulation to varying degrees in ApoE-/- mice. These results indicate that the use of SMY is effective, to varying degrees, for the treatment of dyslipidemia, atherosclerosis, myocardial ischemia, and oxidative stress in ApoE-/- mice. SMY has a potential protective effect in DEP-aggravated AS in people with myocardial ischemia.

[Pharmacodynamic substances and therapeutic potential of Wuji Pills:based on UPLC-Q-TOF-MS/MS and network pharmacology].

As a classic prescription, Wuji Pills is composed of Coptidis Rhizoma, Euodiae Fructus Preparata, and stir-fried Paeo-niae Radix Alba at the ratio of 6∶1∶6. The practical application of it is limited compared with other famous Chinese medicine prescriptions. Only one company produces Wuji Pills in China. In this study, ultra-performance liquid chromatography quadrupole time of flight mass spectrometry(UPLC-Q-TOF-MS/MS) was used to analyze and identify 26 identical compounds from Wuji Pills and drug-containing plasma of rats. Based on these components, 46 potential targets were screened out with network pharmacology methods, followed by the component-target network construction, Gene Ontology(GO) term enrichment, Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment, and disease prediction. It was concluded that Wuji Pills acted on core targets such as PTGS2, PTSG1, NCOA2, HSP9 OAD1, and RXRA through magnoflorine, hydroxyevodiamine, daucosterol, and berberine and exerted pharmacodynamic effects through various pathways such as calcium ion signaling pathway, phosphatidylinositol-3-kinase-protein kinase B(PI3 K-Akt) signaling pathway, and vascular endothelial growth factor(VEGF) signaling pathway. Thus, Wuji Pills has therapeutic potential for Alzheimer's disease, diabetes mellitus, myocardial ischemia, and other diseases in addition to the conventional disease(irritable bowel syndrome, IBS). The above research results can provide a reference for the comprehensive interpretation of the pharmacodynamic basis of Wuji Pills and the expansion of clinical application. At the same time, a lot of components in serum and the in vivo transformed and metabolized components of Wuji Pills have similar structure and relative molecular weight. In theory, these components may show additive effects and the competitive/antagonistic effects on the same target. According to the hypothesis of "additive effect of multiple components for a single target" in traditional Chinese medicine, multiple similar components may exert the additive effects on local targets. This study can partly prove the scientificity of this hypothesis and provide laboratory evidence.

Artesunate and Tetramethylpyrazine Exert Effects on Experimental Cerebral Malaria in a Mechanism of Protein S-Nitrosylation.

Cerebral malaria (CM) is caused by Plasmodium falciparum, resulting in severe sequelae; one of its pathogenic factors is the low bioavailability of nitric oxide (NO). Our previous study suggested that the combination of artesunate (AS) and tetramethylpyrazine (TMP) exerts an adjuvant therapeutic effect on the symptoms of experimental CM (ECM) and that NO regulation plays an important role. In the present study, we further verified the effects of AS+TMP on cerebral blood flow (CBF) and detected NO-related indicators. We focused on the role of NO through S-nitrosoproteome based on previous proteomics data and explored the mechanism of AS+TMP for improving pathological ECM symptoms. We observed that AS+TMP reduces adhesion, increases CBF, and regulates NO synthase (NOS) activity, thereby regulating the level of S-nitrosothiols, such as metabolism-related or neuro-associated receptors, for improving ECM symptoms. These results demonstrated that AS+TMP could be an effective strategy in adjuvant therapy of CM.

Polymer-Assisted Metallization of Mammalian Cells.

Developing biotemplating techniques to translate microorganisms and cultured mammalian cells into metallic biocomposites is of great interest for biosensors, electronics, and energy. The metallization of viruses and microbial cells is successfully demonstrated via a genetic engineering strategy or electroless deposition. However, it is difficult to transform mammalian cells into metallic biocomposites because of the complicated genes and the delicate morphological features. Herein, "polymer-assisted cell metallization" (PACM) is reported as a general method for the transformation of mammalian cells into metallic biocomposites. PACM includes a first step of in situ polymerization of functional polymer on the surface and in the interior of the mammalian cells, and a subsequent electroless deposition of metal to convert the polymer-functionalized cells into metallic biocomposites, which retain the micro- and nanostructures of the mammalian cells. This new biotemplating method is compatible with different cell types and metals to yield a wide variety of metallic biocomposites with controlled structures and properties.

The Protective Effects of Shengmai Formula Against Myocardial Injury Induced by Ultrafine Particulate Matter Exposure and Myocardial Ischemia are Mediated by the PI3K/AKT/p38 MAPK/Nrf2 Pathway.

Background and Purpose: Ultrafine particulate matter (UFPM) induces oxidative stress (OS) and is considered to be a risk factor of myocardial ischemia (MI). Shengmai formula (SMF) is a traditional Chinese medicine with antioxidant properties and has been used to treat cardiovascular diseases for a long time. The aim of this study was to explore the protective role of SMF and the mechanism by which it prevents myocardial injury in UFPM-exposed rats with MI. Methods: An MI rat model was established. Animals were randomly divided into five groups: sham, UFPM + MI, SMF (1.08 mg/kg⋅d) + UFPM + MI, SMF (2.16 mg/kg⋅d) + UFPM + MI, and SMF (4.32 mg/kg⋅d) + UFPM + MI. SMF or saline was administrated 7 days before UFPM instillation (100 µg/kg), followed by 24 h of ischemia. Physiological and biochemical parameters were measured, and histopathological examinations were conducted to evaluate myocardial damage. We also explored the potential mechanism of the protective role of SMF using a system pharmacology approach and an in vitro myoblast cell model with small molecule inhibitors. Results: UFPM produced myocardial injuries on myocardial infarct size; serum levels of LDH, CK-MB, and cardiac troponin; and OS responses in the rats with MI. Pretreatment with SMF significantly attenuated these damages via reversing the biomarkers. SMF also improved histopathology induced by UFPM and significantly altered the PI3K/AKT/MAPK and OS signaling pathways. The expression patterns of Cat, Gstk1, and Cyba in the UFPM model group were reversed in the SMF-treated group. In in vitro studies, SMF attenuated UFPM-induced reactive oxygen species production, mitochondrial damage, and OS responses. The PI3K/AKT/p38 MAPK/Nrf2 pathway was significantly changed in the SMF group compared with that in the UFPM group, whereas opposite results were obtained for pathway inhibition. Conclusion: These findings indicate that SMF prevents OS responses and exerts beneficial effects against myocardial injury induced by UFPM + MI in rats. Furthermore, the PI3K/AKT/p38 MAPK/Nrf2 signaling pathway might be involved in the protective effects of SMF.

Shenlian extract protects against ultrafine particulate matter-aggravated myocardial ischemic injury by inhibiting inflammation response via the activation of NLRP3 inflammasomes.

Air pollution is a growing public health burden associated with several negative health effects, especially cardiovascular disease. Shenlian extract (SL), a traditional Chinese medicine, has the effects of clearing heat-toxin and promoting blood circulation for removing blood stasis, and it has long been used to treat cardiovascular diseases and atherosclerosis. This study explored the underlying action mechanism of SL against ultrafine particle-induced myocardial ischemic injury (UFP-MI) through network pharmacology prediction and experimental verification. Male Sprague-Dawley rats with UFP-MI were pre-treated with SL intragastrically for 7 days. All the rats were then euthanized. Inflammatory cytokine detection and histopathological analysis were performed to assess the protective effects of SL. For the mechanism study, differentially expressed genes (DEGs) were identified in UFP-MI rats treated with SL through transcriptomic analysis. Subsequently, in combination with network pharmacology, potential pathways involved in the effects of SL treatment were identified using the Internet-based Computation Platform (www.tcmip.cn) and Cytoscape 3.6.0. Further validation experiments were performed to reveal the mechanism of the therapeutic effects of SL on UFP-MI. The results show that SL significantly suppressed inflammatory cell infiltration into myocardial tissue and exhibited significant anti-inflammatory activity. Transcriptomic analysis revealed that the DEGs after SL treatment had significant anti-inflammatory, immunomodulatory, and anti-viral activities. Network pharmacology analysis illustrated that the targets of SL were mainly involved in regulation of the inflammatory response, apoptotic process, innate immune response, platelet activation, and coagulation process. By combining transcriptomic and network pharmacology data, we found that SL may exert anti-inflammatory effects by acting on the NOD-like signaling pathway to regulate immune response activation and inhibit systemic inflammation. Verification experiments revealed that SL can suppress the secretion of the inflammatory cytokines Interleukin-1 (IL-1), Interleukin-18(IL-18) and Interleukin-33(IL-33) and suppress NLRP3 inflammasome activity. The results suggested that SL can directly inhibit the activation of NLRP3 inflammasomes and reduce the release of cytokines to protect against ultrafine particulate matter-aggravated myocardial ischemic injury.

[Method for rapid synchronization of different growth cycles of Plasmodium falciparum in vitro and application in differential gene expression profile of 3D7 after dihydroartemisinin treatment].

Plasmodium culture in vitro is often used as an antimalarial drug evaluation model, but the lifecycle of P. falciparum culture in vitro tends to be disordered, which affects the research and evaluation of antimalarial drug mechanism in vitro. By combining magnetic bead separation method with sorbitol synchronization method, a synchronization method was constructed to quickly acquire different lifecycles of P. falciparum and obtain large amounts of parasite with a narrow synchronization window in a short period. Furthermore, the dihydroartemisinin(DHA) was used to treat the early trophozoite phase of P. falciparum 3 D7 for 4 h. Then mRNA was extracted and RNA-seq was conducted to analyze the differential expression of mRNA after drug treatment and obtain the differential gene expression profile. Differential expression of up-regulated genes and down-regulated genes was analyzed according to the screening criteria of |log_2FC|>1 and P<0.05. There, 262 genes were up-regulated and 77 genes were down-regulated. GO functional enrichment analysis of all the differentially expressed genes showed that the enrichment items mainly included cell membrane components, transporter activity, serine/threonine kinase activity, Maurer's clefts(MCs), rhoptry, antigen variation and immune evasion. The enrichment of KEGG pathway included malaria, fatty acid metabolism and peroxisome. Protein-protein interaction(PPI) analysis showed that the down-regulated genes in the modules with high degree of association included rhoptry, myosin complex, transporter and other genes related to the important life activities of malaria invasion and immune escape; the up-regulated genes were mainly related to various toxic exportins of malaria, such as PfSBP1 of MCs. qRT-PCR was used to verify the expression level of some genes, and most of the results were the same as the sequencing results. SBP1 was significantly up-regulated, while some antigenic protein expression levels were down-regulated. Above all, key molecules of DHA therapy were mainly involved in the parasites' rhoptry, transporter, antigenic variation, plasmodium exportin. These results offer us many hints to guide the further studies on mechanism of artemisinin and provide a new way for development of new antimalarial drugs.