RESUMO
This study investigates the anti-inflammatory effects of pectins with different degrees of methyl esterification (DM) on intestinal epithelial cells (IECs) expressing low and high levels of TLR2. It also studies the influence of soluble TLR2 (sTLR2) which may be enhanced in patients with inflammatory bowel syndrome on the inflammation-attenuating effects of pectins. Also, it examines the impact of pectins on tight junction gene expression in IECs. Lemon pectins with DM18 and DM88 were characterized, and their effects on TLR2-1-induced IL8 gene expression and secretion were investigated in low-TLR2 expressing Caco-2 and high-TLR2 expressing DLD-1 cells. The results demonstrate that both DM18 and DM88 pectins can counteract TLR2-1-induced IL-8 expression and secretion, with more pronounced effects observed in DLD-1 cells expressing high levels of TLR2. Furthermore, the presence of sTLR2 does not interfere with the attenuating effects of low DM18 pectin and may even support its anti-inflammatory effects in Caco-2 cells. The impact of pectins and sTLR2 on tight junction gene expression also demonstrates cell-type-dependent effects. Overall, these findings suggest that low DM pectins possess potent anti-inflammatory properties and may influence tight junction gene expression in IECs, thereby contributing to the maintenance of gut homeostasis.
Assuntos
Interleucina-8 , Receptor 2 Toll-Like , Humanos , Receptor 2 Toll-Like/genética , Receptor 2 Toll-Like/metabolismo , Interleucina-8/genética , Interleucina-8/metabolismo , Células CACO-2 , Junções Íntimas/metabolismo , Esterificação , Expressão Gênica , Pectinas/farmacologia , Pectinas/metabolismo , Anti-Inflamatórios/metabolismoRESUMO
The application of plant essential oil liposomes to prevent and control food safety risks caused by Campylobacter jejuni (C. jejuni) still faces challenges such as lack of targeting and low release rate. Here, a bacteria-targeted and protease-activated antibacterial liposome (ACCLPs) was successfully synthesized through encapsulation of clove essential oil (CEO) by film dispersion method, embedding of casein by freeze-thaw method, and conjugation of C. jejuni antibody on the liposome membrane by post-insertion method. The average particle size, the essential oil encapsulation rate, the casein mosaic rate, and the antibody coupling efficiency of ACCLPs were determined as185.87 nm,16.9%,70.1% and 87.5%, respectively. The modification with C. jejuni antibody could significantly improve the targeting of ACCLPs to C. jejuni. Controlled release experiments showed that the exocrine protease from C. jejuni could hydrolyze the embedded casein and perforation on the ACCLPs, thus leading to a bacteria-dependent CEO release and significant prolonging the antibacterial effects of ACCLPs. Application results of ACCLPs on C. jejuni-contaminated foods showed that ACCLPs could effectively inhibit C. jejuni in a variety of meat products, fruits and vegetables and extend their shelf life without significantly affecting food quality. The results above in this work would provide a new view for the development of high efficient liposome-based antibacterial system of plant essential oil.
Assuntos
Campylobacter jejuni , Óleos Voláteis , Syzygium , Óleos Voláteis/farmacologia , Óleo de Cravo/farmacologia , Lipossomos , Caseínas , Antibacterianos/farmacologia , Óleos de Plantas/farmacologia , Bactérias , Peptídeo Hidrolases/farmacologiaRESUMO
Effects of vitamin C supplementation on the oral bioaccessibility of lead (Pb) present in contaminated soils were examined using a number of in vitro assays (PBET, SBRC, UBM and IVG). In the presence of vitamin C, an increase in Pb bioaccessibility was observed in the gastric phase by 1.3-fold (30.5%-85.5%) and in the intestinal phase by 3.1-fold (0.9%-58.9%). Lead mobilization was regulated by reductive dissolution of Fe(III) and sequestration of Pb on secondary Fe minerals. Sequential extraction by the Bureau Community of Reference (BCR) provided more evidence that reducible fraction and residual fraction were major contributor of gastric Pb bioaccessibility, as well as reduced fractions in intestinal Pb bioaccessibility. In addition, higher non-carcinogenic risks may occur based on target hazard quotient (THQ ≥ 1). For people exposed to Pb present in soil, the management of vitamin C supplements is of serious concern.
Assuntos
Poluentes do Solo , Ácido Ascórbico , Disponibilidade Biológica , Suplementos Nutricionais , Compostos Férricos , Humanos , Chumbo/toxicidade , Solo , Poluentes do Solo/análiseRESUMO
Members of Polygonatum are perennial herbs that have been widely used in traditional Chinese medicine to invigorate Qi, moisten the lung, and benefit the kidney and spleen among patients. However, the phylogenetic relationships and intrageneric taxonomy within Polygonatum have long been controversial because of the complexity of their morphological variations and lack of high-resolution molecular markers. The chloroplast (cp) genome is an optimal model for deciphering phylogenetic relationships in related families. In the present study, the complete cp genome of 26 species of Trib. Polygonateae were de novo assembled and characterized; all species exhibited a conserved quadripartite structure, that is, two inverted repeats (IR) containing most of the ribosomal RNA genes, and two unique regions, large single sequence (LSC) and small single sequence (SSC). A total of 8 highly variable regions (rps16-trnQ-UUG, trnS-GCU-trnG-UCC, rpl32-trnL-UAG, matK-rps16, petA-psbJ, trnT-UGU-trnL-UAA, accD-psaI, and trnC-GCA-petN) that might be useful as potential molecular markers for identifying Polygonatum species were identified. The molecular clock analysis results showed that the divergence time of Polygonatum might occur at â¼14.71 Ma, and the verticillate leaf might be the ancestral state of this genus. Moreover, phylogenetic analysis based on 88 cp genomes strongly supported the monophyly of Polygonatum. The phylogenetic analysis also suggested that Heteropolygonatum may be the sister group of the Polygonatum, but the Disporopsis, Maianthemum, and Disporum may have diverged earlier. This study provides valuable information for further species identification, evolution, and phylogenetic research of Polygonatum.
RESUMO
Alzheimer´s disease is a global neurodegenerative health concern. To prevent the disease, the simultaneous inhibition of acetylcholinesterase and oxidative stress is an efficient approach. In this study, the inhibition effect of all-trans astaxanthin mainly from marine organisms on acetylcholinesterase and oxidative stress was evaluated by a chemical-based method in vitro and cell assay model. The results show that all-trans astaxanthin was a reversible competitive inhibitor and exhibited a strong inhibition effect with half inhibitory concentration (IC50 value) of 8.64 µmol/L. Furthermore, all-trans astaxanthin inhibited oxidative stress through reducing malondialdehyde content and increasing the activity of superoxide dismutase as well as catalase. All-trans astaxanthin could induce the changes of the secondary structure to reduce acetylcholinesterase activity. Molecular-docking analysis reveals that all-trans astaxanthin prevented substrate from binding to acetylcholinesterase by occupying the space of the active pocket to cause the inhibition. Our finding suggests that all-trans astaxanthin might be a nutraceutical supplement for Alzheimer´s disease prevention.
Assuntos
Acetilcolinesterase , Doença de Alzheimer , Doença de Alzheimer/tratamento farmacológico , Antioxidantes/química , Antioxidantes/farmacologia , Humanos , Estresse Oxidativo , Xantofilas/farmacologiaRESUMO
Chinese patent medicines (CPMs) are of great value for the prevention and treatment of diseases. However, adulterants and pesticide residues in CPMs have become the "bottleneck" impeding the globalization of traditional Chinese medicine. In this study, 12 batches of commercially available Qipi pill (a famous CPM recorded in Chinese Pharmacopeia) from different manufacturers were investigated to evaluate their authenticity and quality safety. Considering the severely degraded DNA in CPMs, kompetitive allele specific PCR (KASP) technology combined with DNA mini-barcodes was proposed for the quality regulation of a large number of products in CPM market. The residues of four kinds of pesticides including pentachloronitrobenzene (PCNB), hexachlorocyclohexane (HCH), aldrin, and dichlorodiphenyltrichloroethane (DDT) were quantified using gas chromatography and tandem mass spectrometry (GC-MS/MS). The results indicated that in two of the 12 batches of Qipi pill, the main herbal ingredient Panax ginseng was completely substituted by P. quinquefolius, and one sample was partially adulterated with P. quinquefolius. The PCNB residue was detected in 11 batches of Qipi pill, ranging from 0.11 to 0.46 mg/kg, and the prohibited pesticide HCH was present in four samples. Both adulteration and banned pesticides were found in two CPMs. This study suggests that KASP technology combined with DNA mini-barcodes can be used for the quality supervision of large sample size CPMs with higher efficiency but lower cost. Our findings also provide the insight that pesticide residues in CPMs should be paid more attention in the future.
RESUMO
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.
Assuntos
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleotídeos , Extratos VegetaisRESUMO
This study investigated the effects of diet supplementation with alkaline protease (AKP) on the production performance, egg quality, and cecal microbiota of laying hens. A total of 720 Hy-Line Brown laying hens (60 weeks old) were divided into four groups with six replicates of 30 birds each. No AKP was added to the control diet, and the hens in the other three groups (Groups 1, 2, and 3) were fed the basal diet supplemented with AKP preparations at 3, 6, and 9 u/g of diet, respectively. Results showed that AKP supplementation significantly decreased the feed/egg ratio (p < 0.05). Compared with that of the control group, the eggshell strength of Group 1 was significantly increased (p < 0.05), and the egg yolk weight of Groups 1 and 3 was significantly increased (p < 0.05). Distinctive difference in cecal microbiota was observed between AKP and control groups, and the average values of microbial diversity was lower in the AKP group than in the control group. The relative abundance of Bacteroidetes and Firmicutes at the phylum level, Rikenellaceae, Lachnospiraceae, Lactobacillaceae, Erysipelotrichaceae, and Christensenellaceae at the family level, and Rikenellaceae_RC9_gut_Group, Lactobacillus, Romboutsia, Lachnoclostridium, and Blautia at the genus level in the AKP group changed significantly compared with that in the control group (p<0.05).
Assuntos
Microbioma Gastrointestinal , Ração Animal/análise , Fenômenos Fisiológicos da Nutrição Animal , Animais , Proteínas de Bactérias , Galinhas , Dieta/veterinária , Suplementos Nutricionais/análise , Endopeptidases , Feminino , Microbiota , ÓvuloRESUMO
To determine the effect of vitamin supplements on the oral bioaccessibility of Pb in soils, Pb bioaccessibility was measured in the presence of 9 vitamins by a physiologically based extraction test. Gastric Pb bioaccessibility (G-BA, 2.6-83.3%) was found to be mostly reduced (1.1-3.1 fold) in the presence of B vitamins, specifically vitamins B1, B6, and B9. In contrast, a significant increase in Pb G-BA was observed with vitamin C and E involved. In the small intestinal phases, Pb bioaccessibility (I-BA) ranged from 0.1% to 16.0%, being 5-50 fold lower than the corresponding G-BA values. Vitamin C supplementation showed a 7-fold increase in Pb I-BA, with a similar increase presented in approximately 30% of samples treated to vitamin B involvement. Lead liberation in gastrointestinal digests was associated with the dissolution of Fe and Mn regulated by vitamins. In conclusion, the addition of B vitamins resulted in the reduction of gastric Pb bioaccessibility, but the bioaccessibility value increased in participation of vitamin C and E. Elevated intestinal bioaccessibility was found especially for vitamin C. This should contribute to more accurate assessment of health risks from contaminated soils. Nutritional management aimed at preventing Pb-induced toxicity can benefit from knowledge of vitamin influence on soil Pb bioaccessibility.
Assuntos
Poluentes do Solo , Disponibilidade Biológica , Chumbo , Solo , Poluentes do Solo/análise , VitaminasRESUMO
This study was conducted to determine the effects of diet supplementation of laying hens with antimicrobial peptides (AMP) on egg production, egg quality and caecal microbiota. A total of 360 Hy-Line Brown laying hens (72 weeks old) were divided into three groups with four replicates of 30 birds each. The laying hens were fed with the basal diet (Control), the basal diet + 50 mg/kg AMP (group 1) and the basal diet + 100 mg/kg AMP (group 2). The experiment lasted for 45 d. Eggs were collected daily and caecal samples were collected at the end of the experiment. The results showed that AMP supplementation caused a significantly increased laying rate and decreased feed/egg ratio (p ï¼ .05). Meanwhile, a distinctive difference in cecal microbiota was observed between AMP and control groups and the average values of microbial diversity and richness were lower in the AMP group than in the control group. At the phylum level, the relative abundance of Verrucomicrobia and Cyanobacteria were lower in the AMP group than in the control group. In conclusion, the results indicated that dietary supplementation with AMP can improve egg production and affect the cecal microbial community membership and structure of hens during late laying period.
Assuntos
Fenômenos Fisiológicos da Nutrição Animal , Peptídeos Catiônicos Antimicrobianos/administração & dosagem , Peptídeos Catiônicos Antimicrobianos/farmacologia , Ceco/microbiologia , Galinhas/microbiologia , Galinhas/fisiologia , Dieta/veterinária , Ovos , Qualidade dos Alimentos , Oviposição/efeitos dos fármacos , Animais , Suplementos Nutricionais , Feminino , Microbioma Gastrointestinal/efeitos dos fármacosRESUMO
PURPOSE: Positive results have appeared among nonmetastatic breast cancer patients with the use of cognitive behavioral therapy (CBT). However, earlier stage patient results have been mixed. This novelty of this study was the focus on stage I and II breast cancer patients. The objective of the current study was to conduct a meta-analysis of psychosocial functions in early-stage breast cancer survivors to determine its efficacy. METHODS: A search of Cochrane Library, EMBASE, MEDLINE, PsycInfo, and PubMed yielded 3237 abstracts, which were independently evaluated by research pairs. Meta-analysis was conducted on 8 studies that included a total of 1053 patients. Psychosocial functions were categorized according to 3 domains: (1) anxiety, (2) depression, and (3) quality of life. RESULTS: Improvement in anxiety was observed in patients treated with CBT relative to controls without CBT ( P = .04). Depression and quality of life improvement was not observed in the CBT group within or after 4 months of treatment ( P > .05). CONCLUSIONS: The results indicated that observed improvements in anxiety in patients with early-stage breast cancer were moderate. The effectiveness of CBT for the improvement of patient outcomes could not be determined, given the methodological and clinical shortcomings of the included trials.
Assuntos
Ansiedade/psicologia , Ansiedade/terapia , Neoplasias da Mama/psicologia , Sobreviventes de Câncer/psicologia , Depressão/psicologia , Depressão/terapia , Neoplasias da Mama/complicações , Terapia Cognitivo-Comportamental/métodos , Depressão/etiologia , Humanos , Qualidade de VidaRESUMO
Curcumin is a hydrophobic polyphenol derived from turmeric: the rhizome of the herb Curcumalonga. Autophagy is an evolutionarily conserved process, in which cellular proteins and organelles are engulfed in autophagosome and then fuses with lysosome for degradation. Our previous study showed that Curcumin activates lysosome and induce autophagy through inhibition of AKT (protein kinase K, PKB)-mammalian target of rapamycin (mTOR) pathway. But whether Curucmin affects the fusion of autophagosome-lysosome is still not clear. Here, we used Curcumin-probe conjugation with an alkyne moiety to label mouse embryonic fibroblasts (MEFs) and found that Curcumin targets autophagy-related proteins, enhances autophagic flux and activates lysosome in cells. Moreover, Curcumin treatment promotes the fusion of autophasosome-lysosome in MEFs. Second, the enhanced fusion of autophagosome-lysosome is attributed to mTOR suppression. Third, blockage of the autophagosome-lysosome fusion leads to cell growth inhibition by Curcumin. Taken together, data from our study indicates the importance of the fusion of autophagosome-lysosome in Curcumin-induced autophagy, which may facilitate the development of Curcumin as a potential therapeutic agent for oxidative stress-related diseases.
Assuntos
Autofagia/efeitos dos fármacos , Autofagia/fisiologia , Curcumina/farmacologia , Animais , Autofagossomos/metabolismo , Autofagia/genética , Curcuma/química , Curcumina/química , Curcumina/uso terapêutico , Expressão Gênica/efeitos dos fármacos , Lisossomos/efeitos dos fármacos , Lisossomos/metabolismo , Fusão de Membrana/efeitos dos fármacos , Fusão de Membrana/genética , Camundongos , Estresse Oxidativo , Fitoterapia , Transdução de Sinais/efeitos dos fármacos , Serina-Treonina Quinases TOR/antagonistas & inibidoresRESUMO
Kampo is the general designation for traditional Japanese herbal medicines, which are recognized as official medicines and listed in the Japanese pharmacopoeia (JP). In most cases, it is difficult to identify the crude drug materials to species level using only traditional identification methods. We report the first online DNA barcode identification system, which includes standard barcode sequences from approximately 95% of the species recorded in the JP (16th edition). This tool provides users with basic information on each crude drug recorded in the JP, DNA barcoding identification of herbal material, and the standard operating procedure (SOP) from sampling to data analysis. ITS2 sequences (psbA-trnH was an alternative when ITS2 could not be amplified) were generated from a total of 576 samples to establish the database. An additional 100 samples (from different medicinal parts, from both single origin and multiple origins and from both retailers and the planting base) were identified using the system. A total of 78% of the test samples were identified as the species listed on their label. This system establishes a model platform for other pharmacopeias from countries like China, Korea, the US and the European Union, for the safe and effective utilization of traditional herbal medicines.
Assuntos
Código de Barras de DNA Taxonômico , Preparações Farmacêuticas/análise , Farmacopeias como Assunto , DNA Espaçador Ribossômico/genética , Bases de Dados como Assunto , Plantas Medicinais/genética , Reação em Cadeia da Polimerase , Análise de Sequência de DNA , Especificidade da Espécie , Estatística como AssuntoRESUMO
American ginseng (derived from Panax quinquefolius) is one of the most widely used medicinal herbs in the world. Because of its high price and increasing demand, there are many adulterants on the market. The proposed internal transcribed spacer 2 (ITS2) has been used to identify raw medicinal materials, but it is not suitable for the identification of Chinese patent medicine ingredients. Therefore, a short barcode for the identification of processed American ginseng and its corresponding Chinese patent medicines would be profitable. In this study, 94 samples of American ginseng and Asian ginseng were collected from all over the world. The ITS2 region was sequenced, and a nucleotide signature was developed based on one single nucleotide polymorphism (SNP) site unique to American ginseng. The nucleotide signature (atcactcctt tgcgggagtc gaggcgg) consists of 27 bases over the length of the ITS2 sequence (420 bp). Furthermore, we also designed primer pairs to amplify the nucleotide signature; the specific primer pair 4F/4R has been found to be unique to the ginseng species and capable of amplifying the nucleotide signatures from Chinese patent medicines and decoctions. We used the nucleotide signature method to inspect ginseng products in Chinese patent medicines; 24 batches of Chinese patent medicine from stores in Beijing were amplified and sequenced successfully. Using the double peaks at the SNP sites of the nucleotide signature, 5 batches were found to be counterfeits, and 2 batches were found to contain adulterants. Thus, this nucleotide signature, with only 27 bp, has broadened the application of DNA barcoding in identification of decoctions, Chinese patent medicines and other ginseng products with degraded DNA. This method can rapidly identify ginseng products and could also be developed as an on-site detection method.
RESUMO
To develop a sound post-treatment process for anaerobically-digested strong wastewater, a novel natural treatment system comprising two units is put forward. The first unit, a trickling filter, provides for further reduction of biochemical oxygen demand and adjustable nitrification. The subsequent soil-plant unit aims at removing and recovering the nutrients nitrogen (N), phosphorus (P) and potassium (K). As a lab-scale feasibility study, a soil column test was conducted, in which black soil and valuable Kentucky bluegrass were integrated to treat artificial nutrient-enriched wastewater. After a long-term operation, the nitrification function was well established in the top layers, despite the need for an improved denitrification process prior to discharge. P and K were retained by the soil through distinct mechanisms. Since they either partially or totally remained in plant-available forms in the soil, indirect nutrient reuse could be achieved. As for Kentucky bluegrass, it displayed better growth status when receiving wastewater, with direct recovery of 8%, 6% and 14% of input N, P and K, respectively. Furthermore, the indispensable role of Kentucky bluegrass for better treatment performance was proved, as it enhanced the cell-specific nitrification potential of the soil nitrifying microorganisms inhabiting the rhizosphere. After further upgrade, the proposed system is expected to become a new solution for strong wastewater pollution.
Assuntos
Poa/química , Solo/química , Eliminação de Resíduos Líquidos/métodos , Águas Residuárias/análise , Poluentes Químicos da Água/química , Nitrificação , Projetos PilotoRESUMO
Acanthopanacis cortex has been used in clinical applications for a long time. Considering some historical and geographical factors, Acanthopanacis cortex is easily confused with other herbs in medicine markets, thereby causing potential safety issues. In this study, we used the internal transcribed spacer 2 (ITS2) barcode to identify 69 samples belonging to six species, including Acanthopanacis cortex and its adulterants. The nearest distance, single-nucleotide polymorphisms (SNPs), and neighbor-joining (NJ) tree methods were used to evaluate the identification ability of the ITS2 barcode. According to the kimura-2-parameter model, the intraspecific distance of Eleutherococcus nodiflorus ITS2 sequences ranged from 0 to 0.0132. The minimum interspecific distance between E. nodiflorus and E. giraldii was 0.0221, which was larger than the maximum intraspecific distance of E. nodiflorus. Three stable SNPs in ITS2 can be used to distinguish Acanthopanacis cortex and its closely related species. The NJ tree indicated that the Acanthopanacis cortex samples clustered into one clade, which can be distinguished clearly from the adulterants of this herb. A secondary structure of ITS2 provided another dimensionality to identify species. In conclusion, the ITS2 barcode effectively identifies Acanthopanacis cortex, and DNA barcoding is a convenient tool for medicine market supervision.
RESUMO
In order to identify Aucklandiae Radix, Vladimiriae Radix, Inulae Radix, Aristolochiae Radix and Kadsurae Radix using ITS2 barcodes, genomic DNA from sixty samples was extracted and the ITS2 (internal transcribed spacer) regions were amplified and sequenced. The genetic distances were computed using MEGA 5.0 in accordance with the kimura 2-parameter (K2P) model and the neighbor-joining (NJ) phylogenetic tree was constructed. The results indicated that for Aucklandiae Radix (Aucklandia lappa), Vladimiriae Radix (Vladimiria souliei and V. souliei var. cinerea), Inulae Radix (Inula helenium), Aristolochiae Radix (Aristolochia debilis) and Kadsurae Radix (Kadsura longipedunculata), the intra-specific variation was smaller than inter-specific one. There are 162 variable sites among 272 bp after alignment of all ITS2 sequence haplotypes. For each species, the intra-specific genetic distances were also smaller than inter-specific one. Furthermore, the NJ tree strongly supported that Aucklandiae Radix, Vladimiriae Radix, Inulae Radix, Aristolochiae Radix and Kadsurae Radix can be differentiated. At the same time, V. souliei (Dolomiaea souliei) and V. souliei var. cinerea( D. souliei var. cinerea) belonging to Vladimiriae Radix were clearly identified. In conclusion, ITS2 barcode could be used to identify Aucklandiae Radix, Vladimiriae Radix, Inulae Radix, Aristolochiae Radix and Kadsurae Radix. Our study may provide a scientific foundation for clinical safe use of the traditional Chinese medicines.
Assuntos
Código de Barras de DNA Taxonômico/métodos , DNA de Plantas/genética , DNA Espaçador Ribossômico/genética , Medicamentos de Ervas Chinesas/classificação , Plantas Medicinais/classificação , Aristolochia/classificação , Aristolochia/genética , Sequência de Bases , Medicamentos de Ervas Chinesas/química , Dados de Sequência Molecular , Filogenia , Plantas Medicinais/genética , Controle de QualidadeRESUMO
With the objective of developing a post-treatment process for anaerobically digested livestock wastewater, an innovative natural treatment system composed of two units is proposed. The first trickling filter unit further reduced biochemical oxygen demand and achieved a certain degree of nitrification. The second soil-plant unit was targeted at the removal and recovery of nutrients N, P and K. For the feasibility study, a bench-scale soil column test was carried out, in which red ball earth and alfalfa were utilized for treating synthetic nutrient-enriched wastewater. Through long-term operation, the nitrification function was well established in the top layers, especially the top 20 cm, although a supplementary denitrification process was still required before discharge. P and K were retained by the soil through different mechanisms, and their plant-available forms that remained in the soil were considered suitable for indirect nutrient reuse. As for alfalfa, with wastewater application it fixed more N from the atmosphere, and directly recovered 6% of P and 4% of K input from wastewater. More importantly, alfalfa was verified to have an indispensable role in stimulating the soil nitrifying microorganisms by sustaining their abundance during substrate (NH3) and oxygen scarcity, and enhancing cell-specific nitrification potential during substrate (NH3) and oxygen sufficiency. The proposed system is expected to be further improved, and adopted as a sound countermeasure for livestock wastewater pollution.
Assuntos
Reatores Biológicos , Medicago sativa , Esgotos/análise , Purificação da Água/métodos , Anaerobiose , Animais , Desnitrificação , Estudos de Viabilidade , Filtração , Gado , Nitrificação , Nitrogênio/análise , Oxigênio , Solo/química , Águas ResiduáriasRESUMO
To identify Salvia shandongensis and its relatives at molecular level, the psbA-trnH intergenic region of three species including Salvia shandongensis, Salvia miltiorrhiza and S. miltiorrhiza f. alba were amplified and sequenced. Sequences were assembled with CodonCode Aligner. The K2P genetic distances between Salvia shandongensis and its relatives were calculated and UPGMA tree was performed by MEGA5.0. The results indicated that the lengths of psbA-trnH regions of Salvia shandongensis were about 391 bp, while the lengths of psbA-trnH regions of Salvia miltiorrhiza and S. miltiorrhiza f. alba were about 386 bp. The psbA-trnH sequences showed considerable variations between species and thus were revealed as a promising candidate for barcoding of Salvia shandongensis and its relatives. The intra-specific genetic distances of Salvia shandongensis were 0, while the intra-specific genetic distances of Salvia miltiorrhiza and S. miltiorrhiza f. alba were 0.002 and 0.001 respectively. Additionally, the genetic distance of Salvia shandongensis and Salvia miltiorrhiza ranged from 0.034 to 0.04, and the genetic distance of Salvia shandongensis and S. miltiorrhiza f. alba ranged from 0.005 to 0.008, the intra-specific genetic distances of Salvia shandongensis were much smaller than that of Salvia miltiorrhiza and S. miltiorrhiza f. alba; clustering results showed that there were obvious differences between Salvia shandongensis, Salvia miltiorrhiza and S. miltiorrhiza f. alba, which was consistent with morphological characteristics. This study not only firstly provides the scientific basis for establishing the taxonomy position in molecular level and revealing their genetic relationships of S. shandongensis, S. miltiorrhiza and S. miltiorrhiza f. alba; but also provides DNA molecular identification scientific basis for the development of new medicinal plant resources of Salvia shandongensis. Our results suggest that the psbA-trnH intergenic spacer region can be used as a barcoding to identify Salvia shandongensis, Salvia miltiorrhiza and S. miltiorrhiza f. alba.
Assuntos
DNA Intergênico/genética , DNA de Plantas/genética , Plantas Medicinais/genética , Plastídeos/genética , Salvia/genética , Sequência de Bases , Código de Barras de DNA Taxonômico , Variação Genética , Filogenia , Plantas Medicinais/classificação , Salvia/classificação , Análise de Sequência de DNA , Especificidade da EspécieRESUMO
Medicinal plants of the Panax genus belonging to Araliaceae family are well-known, rare plants used as tonics in traditional Chinese medicine and have been described in the Chinese Pharmacopoeia. Because of the high price and the huge human demand, these commercial products often contain adulterants. In this study, 377 sequences from four species were analyzed. Single nucleotide polymorphisms (SNPs) were detected and patterns of intragenomic variation in internal transcribed spacer 2 (ITS2) from the four Panax species were studied. Intraspecific variations were analyzed based on three typical DNA barcodings (ITS2, matK and psbA-trnH). Results from this study revealed that intraspecific genetic distances in Panax ginseng and Panax quinquefolius were quite low (0-0.002) and the multi-copy ITS2 could be considered a single locus in the genomes of these two species. Five stable SNPs were detected in ITS2 region to identify the Panax medicinal species. Considering the mixed powder of P. ginseng and P. quinquefolius, double peaks could be clearly examined at SNP positions and the height of the peaks could indicate the mixed ratio roughly. Our findings indicate that SNP-based molecular barcodes could be developed as a routine method for the identification of the Panax genus with closely related species and the mixed powder P. ginseng and P. quinquefolius.