First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 µm (578.75 - 902.65 µm), maximum body width (W) = 471.97 ± 70.95 µm (318.7 - 586.3 µm), stylet length = 15.18 ± 0.96 µm (13.52 - 17.04 µm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 µm (2.60 - 3.80µm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 µm (375.3 - 552.5 µm), stylet length =12.59 ± 1.39 µm (10.5 - 16.8 µm), tail length= 53.35 ± 1.55 µm (51.8 - 54.9 µm), hyaline tail terminus =11.45 ± 0.65 µm (10.2 - 12.1 µm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

GPR30 mediated effects of boron on rat spleen lymphocyte proliferation, apoptosis, and immune function.

Supplementing different quantities of boron can significantly affect immune function in rat spleen, but the mechanism of action behind this effect remains unclear. Our purpose was to study the involvement of the estrogen membrane receptor GPR30 in the effect of boron on the proliferation, apoptosis, and immune function of rat spleen lymphocytes. Results showed that the addition of 0.4 mmol/L boron had a beneficial effect on the immune function and proliferation of spleen lymphocytes, but the addition of 40 mmol/L boron had opposite effect. After using G-15 to selectively inhibit GPR30, the proportions of CD4+ and CD8+ T cells, the content of IL-2 and IFN-γ, and the expression of PCNA protein were significantly decreased, while lymphocyte apoptosis rate increased significantly (p < 0.05 or p < 0.01). After G-15 treatment, the addition of 0.4 mmol/L boron had no effects on T cell subsets, lymphocyte proliferation, PCNA protein expression, and IgG and cytokine content (P > 0.05), while the addition of 40 mmol/L boron did not change the effects on lymphocyte subsets, proliferation and apoptosis. The results suggested that GPR30 mediates the effects of 0.4 mmol/L boron boron on the proliferation, apoptosis and immune function of spleen lymphocytes.

Endocannabinoid hydrolase and cannabinoid receptor 1 are involved in the regulation of hypothalamus-pituitary-adrenal axis in type 2 diabetes.

Hypothalamus-pituitary-adrenal (HPA) axis, as the key moderator in energy metabolism, plays an important role in diabetes. The endogenous cannabinoid system (eCBs) involves in neuronal functions, and simultaneously cannabinoid receptors are almost expressed in all regions of the hypothalamus according to a spate of reports. However, few data investigate the changes of eCBs and HPA axis in type 2 diabetes. In this study, five diabetes mellitus rhesus monkeys, five prediabetes rhesus monkeys and five healthy rhesus monkeys were observed. In the present study, we detected cell swelling and necrosis extensively in the paraventricular nucleus (PVN) and neurohypophysis in prediabetes and overt diabetes monkeys. The adrenocorticotropic hormone in the pituitary gland, adrenocorticotropic hormone receptor, and 11ß-hydroxysteroid dehydrogenase in the adrenal gland were all hyper-secreted and expressed from healthy to overt diabetes. Meanwhile, the cortisol concentration in the adrenal gland was increased along with the progress of diabetes. It could be concluded that hyperfunction of the HPA axis exists in the type 2 Diabetes pathogenesis. However, we also found a weakened expression and secretion of corticotrophin releasing hormone and glucocorticoids receptor in PVN. The expression of corticotropin releasing hormone receptor 1 in pituitary gland decreased in prediabetes monkeys, but increased in overt diabetes monkeys. The downregulation of cannabinoid receptor 1 and upregulation of monoglycerol lipase and fatty acid amide hydrolase in PVN was involved in the pathogenesis of type 2 diabetes. Collectively, we can conclude that changes in endocannabinoid hydrolase and cannabinoid receptor might indicate the effect of downregulation of eCBs. It can be assumed that hyper-function of the HPA axis from healthy to overt diabetes is due to the undermining inhibition of eCBs. However, the regulatory mechanism of eCBs targets on the HPA axis need to be further explored.

[Determination and principal component analysis of mineral elements based on ICP-OES in Nitraria roborowskii fruits from different regions].

The content of elements in fifteen different regions of Nitraria roborowskii samples were determined by inductively coupled plasma-atomic emission spectrometry(ICP-OES), and its elemental characteristics were analyzed by principal component analysis. The results indicated that 18 mineral elements were detected in N. roborowskii of which V cannot be detected. In addition, contents of Na, K and Ca showed high concentration. Ti showed maximum content variance, while K is minimum. Four principal components were gained from the original data. The cumulative variance contribution rate is 81.542% and the variance contribution of the first principal component was 44.997%, indicating that Cr, Fe, P and Ca were the characteristic elements of N. roborowskii.Thus, the established method was simple, precise and can be used for determination of mineral elements in N.roborowskii Kom. fruits. The elemental distribution characteristics among N.roborowskii fruits are related to geographical origins which were clearly revealed by PCA. All the results will provide good basis for comprehensive utilization of N.roborowskii.

Organization of Functional Long-Range Circuits Controlling the Activity of Serotonergic Neurons in the Dorsal Raphe Nucleus.

Serotonergic neurons play key roles in various biological processes. However, circuit mechanisms underlying tight control of serotonergic neurons remain largely unknown. Here, we systematically investigated the organization of long-range synaptic inputs to serotonergic neurons and GABAergic neurons in the dorsal raphe nucleus (DRN) of mice with a combination of viral tracing, slice electrophysiological, and optogenetic techniques. We found that DRN serotonergic neurons and GABAergic neurons receive largely comparable synaptic inputs from six major upstream brain areas. Upon further analysis of the fine functional circuit structures, we found both bilateral and ipsilateral patterns of topographic connectivity in the DRN for the axons from different inputs. Moreover, the upstream brain areas were found to bidirectionally control the activity of DRN serotonergic neurons by recruiting feedforward inhibition or via a push-pull mechanism. Our study provides a framework for further deciphering the functional roles of long-range circuits controlling the activity of serotonergic neurons in the DRN.

Effect of DHA supplements during pregnancy on the concentration of PUFA in breast milk of Chinese lactating mothers.

OBJECTIVE: To determine whether there is an effect of prenatal supplementation with docosahexaenoic acid (DHA) on the concentration of polyunsaturated fatty acids (PUFAs) in the breast milk of Chinese lactating women. METHODS: A total of 409 participants were recruited at the postpartum care center during their 1-month postpartum care. They were assigned to the supplement group or the control group according to whether or not DHA supplements were taken during pregnancy. Dietary intake was assessed with a food frequency questionnaire (FFQ). Breast milk samples were collected on 1 day between the 22nd and 25th day postpartum and levels of eight kinds of fatty acids in the breast milk were measured by gas chromatography. RESULTS: DHA intake was divided into three levels (<57 mg/day, 57-185 mg/day and >185 mg/day). The concentration of DHA postpartum in the breast milk of the group receiving a DHA supplement >185 mg/day was significantly higher (P=0.003) compared to the control group. CONCLUSIONS: DHA intake >185 mg/day resulted in increased DHA concentrations in breast milk. This finding suggests that mothers with inadequate dietary intake of DHA should change their dietary habits to consume a diet rich in DHA or take sufficient DHA supplements to meet the average nutritional needs of infants.

Time outdoors, blood vitamin D status and myopia: a review.

BACKGROUND: Myopia is a major public health concern throughout the world and the prevalence has been increasing rapidly in recent years, especially in urban Asia. The "vitamin D hypothesis" has been raised recently because vitamin D may be a link between less time outdoors and increased risk of myopia. METHODS: We reviewed all studies published in English which examined the association of time outdoors and blood vitamin D status with myopia. RESULTS: The protective effect of time spent outdoors on the risk of myopia onset has been well-established with numerous observational studies and three trials published. Five studies reporting the association between the blood vitamin D status and the risk of myopia and two studies examining the variations in the vitamin D receptor as potential risk factors for myopia development were identified. Most of the current evidence was cross-sectional in nature and had not properly controlled important confounders in its analyses. The evidence supporting that vitamin D played a role in myopia development is weak and the mechanisms are unclear. CONCLUSIONS: At the current stage, it is still unclear whether blood vitamin D status regulates the onset or progression of myopia. Blood vitamin D status may only serve as a biomarker of outdoor exposure, which is the real protective factor for myopia.

Differential Gene Expression between Leaf and Rhizome in Atractylodes lancea: A Comparative Transcriptome Analysis.

The rhizome of Atractylodes lancea is extensively used in the practice of Traditional Chinese Medicine because of its broad pharmacological activities. This study was designed to characterize the transcriptome profiling of the rhizome and leaf of Atractylodes lancea in an attempt to uncover the molecular mechanisms regulating rhizome formation and growth. Over 270 million clean reads were assembled into 92,366 unigenes, 58% of which are homologous with sequences in public protein databases (NR, Swiss-Prot, GO, and KEGG). Analysis of expression levels showed that genes involved in photosynthesis, stress response, and translation were the most abundant transcripts in the leaf, while transcripts involved in stress response, transcription regulation, translation, and metabolism were dominant in the rhizome. Tissue-specific gene analysis identified distinct gene families active in the leaf and rhizome. Differential gene expression analysis revealed a clear difference in gene expression pattern, identifying 1518 up-regulated genes and 3464 down-regulated genes in the rhizome compared with the leaf, including a series of genes related to signal transduction, primary and secondary metabolism. Transcription factor (TF) analysis identified 42 TF families, with 67 and 60 TFs up-regulated in the rhizome and leaf, respectively. A total of 104 unigenes were identified as candidates for regulating rhizome formation and development. These data offer an overview of the gene expression pattern of the rhizome and leaf and provide essential information for future studies on the molecular mechanisms of controlling rhizome formation and growth. The extensive transcriptome data generated in this study will be a valuable resource for further functional genomics studies of A. lancea.

Baicalein reduces ß-amyloid and promotes nonamyloidogenic amyloid precursor protein processing in an Alzheimer's disease transgenic mouse model.

Baicalein, a flavonoid isolated from the roots of Scutellaria baicalensis, is known to modulate γ-aminobutyric acid (GABA) type A receptors. Given prior reports demonstrating benefits of GABAA modulation for Alzheimer's disease (AD) treatment, we wished to determine whether this agent might be beneficial for AD. CHO cells engineered to overexpress wild-type amyloid precursor protein (APP), primary culture neuronal cells from AD mice (Tg2576) and AD mice were treated with baicalein. In the cell cultures, baicalein significantly reduced the production of ß-amyloid (Aß) by increasing APP α-processing. These effects were blocked by the GABAA antagonist bicuculline. Likewise, AD mice treated daily with i.p. baicalein for 8 weeks showed enhanced APP α-secretase processing, reduced Aß production, and reduced AD-like pathology together with improved cognitive performance. Our findings suggest that baicalein promotes nonamyloidogenic processing of APP, thereby reducing Aß production and improving cognitive performance, by activating GABAA receptors.

[Meta-analysis of effect of n-3 long-chain polyunsaturated fatty acid supplementation of pregnant women on head circumference of newborn infants].

OBJECTIVE: To evaluate systematically the effect of n-3 long-chain polyunsaturated fatty acid (n-3 LC-PUFA) supplementation of pregnant women on head circumference of newborn infants. METHODS: A thorough literature search was done for full texts which studied the effect of n-3 LC-PUFA supplementation of pregnant women on head circumference of newborn infants among PubMed, Cochrane Library, Chinese periodical full text database and Wanfang database using the mesh terms as n-3, long chain polyunsaturated fatty acids, DHA, EPA, docosahexaenoic acid, eicosapentaenoic acid, fish oil, pregnancy, infant. Only randomized controlled trials were chosen for analysis. A total of 74 relevant articles were selected. RevMan 5.0 software was used to perform the Meta analysis on those valid studies. Weighted mean difference was calculated with inverse variance method. The sensitivity analysis was also performed. RESULTS: Eight articles met the inclusion criteria, among which 6 literatures were from developing countries and the other 2 from developed countries. All of them were written in English. These studies were reported from 2001 to 2011. Intervention group included 871 objects with n-3 LC-PUFA supplementation, whereas control group included 894 objects with placebo or no supplementation. Supplementation was associated with significantly greater head circumference of the infants in the intervention group than that of the control group (weighted mean difference was 0.17 cm, 95%confidence interval (CI) was 0.01 - 0.32 cm, P < 0.05). But the difference was no long significant according to the sensitivity analysis (weighted mean difference was 0.16 cm, 95%CI was -0.01 - 0.34 cm, P = 0.07). The funnel plot was symmetrical, indicating there was no publication bias between the eight studies. CONCLUSION: It can't be confirmed whether supplementation with n-3 LC-PUFA of pregnant women can increase the infants' head circumference at birth from present data acquired.