RESUMO
Objectives: With the increasing number of people worldwide infected with SARS-CoV-2, the likelihood of co-infection and/or comorbidities is rising. The impact of these co-infections on the patient's immune system remains unclear. This study aims to investigate the immunological characteristics of secondary infections in hospitalized COVID-19 patients, and preliminarily predict potential therapeutic effects of traditional Chinese medicine and their derivatives for the treatment of co-infections. Methods: In this retrospective cohort study, we included 131 hospitalized patients with laboratory-confirmed COVID-19, of whom there were 64 mild and 67 severe cases. We analyzed clinical characteristics and immunologic data, including circulating immune cell numbers, levels of inflammatory factors and viral load, comparing COVID-19 patients with and without co-infection. Results: Among 131 hospitalized COVID-19 patients, 41 (31.3%) were co-infection positive, with 33 (80.5%) having severe disease and 14 (34.1%) of them resulting in fatalities. Co-infected patients exhibited significantly higher severity and mortality rates compared to non-co-infected counterparts. Co-infected patients had significantly lower absolute counts of lymphocytes, total T lymphocytes, CD4+ T cells, CD8+ T cells and B lymphocytes, while levels of hs-CRP, PCT and IL-6 were significantly elevated compared to non-co-infected patients. Additionally, the viral load of co-infected patients was significantly higher than non-co-infected patients. Conclusion: Co-infection emerges as a dangerous factor for COVID-19 patients, elevating the risk of severe pneumonia and mortality. Co-infection suppresses the host's immune response by reducing the number of lymphocytes and increasing inflammation, thereby diminishing the antiviral and anti-infective effects of the immune system, which promotes the severity of the disease. Therefore, it is crucial to implement infection prevention measures to minimize the spread of co-infections among COVID-19 hospitalized patients. Additionally, changes in these biomarkers provide a theoretical basis for the effective treatment of co-infections with traditional Chinese medicine.
Assuntos
COVID-19 , Coinfecção , Humanos , Coinfecção/epidemiologia , SARS-CoV-2 , Linfócitos T CD8-Positivos , Estudos Retrospectivos , Medicina Tradicional ChinesaRESUMO
Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (â¼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (â¼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with â¼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.
RESUMO
Cholera is a global health problem with no targeted therapies. The Ca2+-sensing receptor (CaSR) is a regulator of intestinal ion transport and a therapeutic target for diarrhea, and Ca2+ is considered its main agonist. We found that increasing extracellular Ca2+ had a minimal effect on forskolin-induced Cl- secretion in human intestinal epithelial T84 cells. However, extracellular Mg2+, an often-neglected CaSR agonist, suppressed forskolin-induced Cl- secretion in T84 cells by 65% at physiological levels seen in stool (10 mM). The effect of Mg2+ occurred via the CaSR/Gq signaling that led to cAMP hydrolysis. Mg2+ (10 mM) also suppressed Cl- secretion induced by cholera toxin, heat-stable E. coli enterotoxin, and vasoactive intestinal peptide by 50%. In mouse intestinal closed loops, luminal Mg2+ treatment (20 mM) inhibited cholera toxin-induced fluid accumulation by 40%. In a mouse intestinal perfusion model of cholera, addition of 10 mM Mg2+ to the perfusate reversed net fluid transport from secretion to absorption. These results suggest that Mg2+ is the key CaSR activator in mouse and human intestinal epithelia at physiological levels in stool. Since stool Mg2+ concentrations in patients with cholera are essentially zero, oral Mg2+ supplementation, alone or in an oral rehydration solution, could be a potential therapy for cholera and other cyclic nucleotide-mediated secretory diarrheas.
Assuntos
Cólera , Receptores de Detecção de Cálcio , Camundongos , Humanos , Animais , Receptores de Detecção de Cálcio/genética , Magnésio/farmacologia , Toxina da Cólera/farmacologia , Cálcio , Escherichia coli , Colforsina/farmacologia , Mucosa Intestinal , Diarreia/tratamento farmacológico , Células Epiteliais , Suplementos NutricionaisRESUMO
To enhance the clinical applicability of guidelines and provide more effective guidance for clinical practice, a clinical value assessment was conducted during the development of the World Federation of Acupuncture-Moxibustion Societies (WFAS) Clinical Practice Guideline of Acupuncture and Moxibustion for Migraine, which involved the evaluation of 59 acupuncture and moxibustion treatment protocols from randomized controlled trials (RCTs). This article introduced the methodology, content and results of the clinical value assessment of RCT-based acupuncture and moxibustion treatment protocols, which involved the integration of historical and contemporary medical evidence and expert consensus. It served as a methodological reference for the future development of acupuncture and moxibustion clinical practice guidelines.
Assuntos
Terapia por Acupuntura , Acupuntura , Transtornos de Enxaqueca , Moxibustão , Humanos , Terapia por Acupuntura/métodos , Protocolos Clínicos , Transtornos de Enxaqueca/terapiaRESUMO
It is aimed to evaluate the effectiveness and provide evidence-based medical support for acupuncture as a prophylactic treatment for migraines. Randomized controlled trials (RCTs) from inception to April 2022 are included in 14 databases. Pairwise meta-analysis is conducted using STATA software V14.0, while Windows Bayesian Inference Using Gibbs Sampling (WinBUGS V.1.4.3) is applied to generate Bayesian Network Meta-analysis (NMA) using Markov chain Monte Carlo algorithm. Forty RCTs are included, with 4405 participants. The effectiveness of six acupuncture techniques, three types of prophylactic drugs, and psychotherapy are compared and ranked. Acupuncture outperformed prophylactic drugs in terms of diminishing visual analog scale (VAS) score, migraine attack frequency, and days during the treatment and at the 12-week follow-up. At the 12-week follow-up, the effectiveness of various interventions is ranked as follows: manual acupuncture (MA) > electroacupuncture (EA) > calcium antagonists (CA) in reducing VAS score; MA > EA > CA in reducing migraine attack frequency; MA > EA > ß-receptor blocker and CA in reducing headache attack days. Acupuncture is a promising treatment for migraine prevention. The best option of acupuncture for improving various migraine outcomes has changed over time. However, the quality of included trials and NMA inconsistency limited the credibility of the conclusion.
RESUMO
Cordyceps militaris is a medicinal and edible mushroom. Researchers often add exogenous substances to the culture medium to increase the active substance content in C. militaris. However, the effect of earth elements on the active substance content in C. militaris and its antioxidant effects have not been reported. In this study, the active substance content in C. militaris treated with lanthanum nitrate was determined using high-performance liquid chromatography and ultraviolet spectrophotometry, and the effect on the antioxidant capacity of C. militaris after lanthanum nitrate spraying was further explored. The results showed that, in the experimental concentration range, the two concentrations of 10 mg/L and 50 mg/L had a significant influence on the active substance content of C. militaris. When the concentration of lanthanum nitrate was 10 mg/L, the synthesis of pentostatin and cordycepin was promoted. When the concentration of lanthanum nitrate was 50 mg/L, it significantly promoted the synthesis of cordycepin, and the ferric-reducing power and DPPH· scavenging rate of C. militaris treated at this concentration were significantly higher than those of the control group. However, lanthanum nitrate had no significant effect on ergosterol synthesis (P > 0.05). Finally, considering that the residual amount of lanthanum in C. militaris and the residual amount of lanthanum in 50 mg/L lanthanum nitrate-treated C. militaris is within the allowable daily intake of 4.2 mg for humans, the optimal concentration of lanthanum nitrate-treated C. militaris is 50 mg/L.
Assuntos
Agaricales , Cordyceps , Humanos , Antioxidantes/farmacologia , Lantânio/farmacologia , Cordyceps/química , Desoxiadenosinas/análiseRESUMO
Background and Aim: Hepatocellular carcinoma (HCC) is one of the ten most common malignant tumors in the world, and it is a major problem in the world. Traditional Chinese medicine (TCM) has many advantages in the prevention and treatment of HCC, but its complicated mechanism of action is difficult to clarify, which limits its research and development. The continuous development of bioinformation technology provides new methods and opportunities for the research of TCM. This study used modern network pharmacology and bioinformatic methods to explore the possible molecular mechanism of the Chinese herbal compound Fuzheng Xiaoliu Granule (FZXLG) to treat HCC, to provide a theoretical basis for their clinical application and basic research, to promote the modernization of TCM, and to promote its worldwide application. Methods: The active ingredients of FZXLG were collected and screened through TCMSP, BATMAN-TCM, and other databases. The targets of FZXLG were predicted by PubChem and SwissTargetPrediction; HCC disease-related targets were obtained by GeneCards, OMIM, and other disease databases, and the potential gene targets of FZXLG for HCC treatment were screened. The "Prescription-TCMs-Ingredients-Targets" network of FZXLG for the treatment of HCC was constructed, along with the screening of core effective components. The differentially expressed genes (DEGs) of HCC tumor and non-tumor adjacent tissues combined with clinical data in the TCGA database were analyzed to obtain the prognostic genes of HCC. Then, FZXLG genes affecting HCC prognosis were screened and further screening the core target genes. The correlation between core gene expression with prognosis, immune cell infiltration, and immunohistochemical changes in HCC patients was studied. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and Gene Ontology enrichment analysis of the FZXLG genes affecting HCC prognosis were performed using DAVID database. AutoDockTools software was then used for molecular docking verification. Results: The ten core effective ingredients of FZXLG for HCC treatment included multiple flavonoids ingredients such as quercetin, luteolin, and formononetin. 11 core targets of FZXLG affecting the prognosis of HCC were screened, among which estrogen receptor 1 (ESR1) and catalase (CAT) were favorable prognostic factors, while EGF, MMP9, CCNA2, CCNB1, CDK1, CHEK1, and E2F1 were adverse prognostic factors. MMP9 and EGF were positively correlated with six TIIC subsets. The different expression levels of CAT, PLG, AR, MMP9, CCNA2, CCNB1, CDK1, and E2F1 were correlated with the immunohistochemical staining changes in normal liver and liver cancer. KEGG pathway enrichment analysis yielded 33 pathways including cell cycle, p53, hepatitis B, and other signaling pathways. Molecular docking verified that the main core components had good binding to the protective prognostic core targets ESR1 and CAT. Conclusions: FZXLG may treat HCC through multiple ingredients, multiple targets, and multiple pathways, affecting the prognosis, immune microenvironment, and immunohistochemical changes of HCC. Relevance for Patients: FZXLG is a Chinese herbal compound for the treatment of HCC, with significant clinical efficacy. However, the mechanism of action is unclear and lacks theoretical support, which limits its popularization application. This study preliminarily revealed its molecular mechanism, providing a theoretical basis for its clinical application, which can better guide its clinical popularization application, and also provide a new strategy for the treatment of HCC.
RESUMO
Obesity, a chronic metabolic disease with a complex pathophysiology, is caused by several variables. High-fat diets lead to the disruption of the gut microbiota and impaired gut barrier function in obese people. The dysbiosis and its metabolites through the intestinal barrier lead to an imbalance in energy metabolism and inflammatory response, which eventually contributes to the development of chronic diseases such as diabetes, hypertension, and cardiovascular disease. Current medicines are therapeutic to obesity in the short term; however, they may bring significant physical and emotional problems to patients as major side effects. Therefore, it is urgent to explore new therapeutic methods that have definite efficacy, can be taken for a long time, and have mild adverse effects. Numerous studies have demonstrated that traditional Chinese medicine (TCM) can control the gut microbiota in a multi-targeted and comprehensive manner, thereby restoring flora homeostasis, repairing damaged intestinal mucosal barriers, and eventually curbing the development of obesity. The active ingredients and compounds of TCM can restore the normal physiological function of the intestinal mucosal barrier by regulating gut microbiota to regulate energy metabolism, inhibit fat accumulation, affect food appetite, and reduce intestinal mucosal inflammatory response, thereby effectively promoting weight loss and providing new strategies for obesity prevention and treatment. Although there are some studies on the regulation of gut microbiota by TCM to prevent and treat obesity, all of them have the disadvantage of being systematic and comprehensive. Therefore, this work comprehensively describes the molecular mechanism of obesity mediated by gut microbiota based on the research state of obesity, gut microbiota, and TCM. A comprehensive and systematic summary of TCM targeting the regulation of gut microbiota for the treatment of obesity should be conducted in order to provide new strategies and ideas for the treatment of obesity.
Assuntos
Medicamentos de Ervas Chinesas , Microbioma Gastrointestinal , Humanos , Medicina Tradicional Chinesa , Medicamentos de Ervas Chinesas/uso terapêutico , Medicamentos de Ervas Chinesas/farmacologia , Obesidade/tratamento farmacológico , Redução de PesoRESUMO
Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00â³N, 108°44'00â³E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.
RESUMO
OBJECTIVE: To identify the key outcome indexes in treatment of migraine with acupuncture and moxibustion. METHODS: Using literature research, questionnaire survey and consensus conference, the key outcome indexes in treatment of migraine with acupuncture and moxibustion were screened and prioritized. RESULTS: The critical outcome indexes for the treatment in attack stage of migraine included 6 effectiveness outcome indexes (headache intensity, headache duration, headache relieve time, effectiveness and level of headache relief within 2 h, headache-related quality of life, level of headache relief within 24 h) and 1 safety outcome index (incidence of serious adverse reactions). The critical outcome indexes for prophylactic treatment included 6 effectiveness outcome indexes (headache day, headache frequency, headache intensity, effective rate, headache-related quality of life, health-related quality of life) and 1 safety outcome index (incidence of serious adverse reactions). CONCLUSION: In terms of the attack stage treatment and prophylactic treatment with acupuncture and moxibustion, the outcome indexes are different, among which, those can directly reflect the conditions of migraine should be optioned in priority. To assess the effectiveness of attack stage, the headache intensity is preferred, using the visual analogue scale (VAS) score, and the preferred time is 2 hours after treatment. Regarding the effectiveness of prophylactic treatment, the headache day, headache frequency and headache intensity should be firstly considered in the assessment, in which, the preferred time for assessment is 12 weeks into treatment, while, the best time for follow-up should be 12 weeks after treatment completion. When the quality of life is considered, the migraine-specific quality of life questionnaire (MSQ) is the top option. For either the attack stage treatment or the prophylactic treatment, the high attention should be laid on the outcome indexes for safety and medical economics evaluation.
Assuntos
Cefaleia , Qualidade de Vida , Humanos , Cefaleia/terapiaRESUMO
OBJECTIVE: To compare the diversities in the literature characteristics of animal experiments with acupuncture and moxibustion (acu-moxibustion) published in both Chinese and English, so as to summarize the similarities and differences in the reporting content for the animal experiment research with acu-moxibustion in the journals at home and abroad. METHODS: The articles of animal experiments with acu-moxibustion published from 2016 to 2018 were searched from CNKI, Wanfang, SinoMed, PubMed and Web of Science databases. The articles were screened according to the inclusion and exclusion criteria, and the database was established by importing the essential information, e.g. title, author, journal, impact factor, country, year of publication, citation frequency, funding, disease type, as well as the number of observation indicators and charts. The diversity was initially summarized among this type of articles between China and foreign countries. RESULTS: A total of 7 515 articles of animal experiments with acu-moxibustion were retrieved and 2 458 articles were eligible in compliance with the inclusion and exclusion criteria. Of them, there were 1 827 articles in Chinese and 631 in English. (1) Among those of Chinese-version, 169 articles (9.25%) were published in Acupuncture Research, listed the first of the article publications. Regarding the impact factor of published journal, Acupuncture Research was ranked the highest (3.187). For those published in English, 78 articles (12.36%) were published in Evidence-based Complementary and Alternative Medicine, listed the top of the article publications. Gastroenterology occupied the highest in terms of the impact factor (17.373) of published journal. (2) The first authors of Chinese-version articles were all from China, distributing in 461 institutions; of which, Beijing University of Chinese Medicine occupied the top for article publications (142 articles, 7.77%). For the English articles, 16 countries were involved regarding the first authors, and the most of them were from China (523 articles, 82.88%), followed by South Korea, Brazil, the United States and Japan. (3) The frequency of citations of Chinese articles was 7.50, which was significantly higher than that of English ones (4.61). (4) The funding supported Chinese and English articles were 1 680 (91.95%) and 569 (90.17%) respectively. (5) In the aspects of disease name and animal model, 135 and 220 diseases were included in Chinese and English articles respectively. The common top 10 diseases referred to 8 categories, i.e. stroke-related diseases, arthritis, Alzheimer's disease, depression, diabetes, spinal cord injury, hypertension and obesity. (6) In terms of the number of indicators, the maximum number was 6 for Chinese-version articles, averagely 2.46, while, it was 12 for English-version ones, 4.02 in average. (7) Among the articles of Chinese-version, the maximum number of charts was 17, and 1 028 articles had 2 to 4 charts, accounting the largest proportion (56.27%). Among those of English-version, the top number of charts was 27, and 347 articles had 4 to 6 charts, occupying the largest proportion (54.99%). CONCLUSION: The number of Chinese-version articles for acu-moxibustion experiment research is much higher than that of the English ones, the authorship is led by Chinese and most of the researches are supported by funds. There is less difference in the disease types between Chinese and English articles, but the frequency citation of Chinese articles is obviously higher than that of English ones; while, the numbers of observation indicators and charts in English articles are much more than those of Chinese ones. It is suggested that the great attention has been drawn on the acu-moxibustion experiment researches published in Chinese journals, and the reports of the researches are more complete in English journals.
Assuntos
Terapia por Acupuntura , Acupuntura , Experimentação Animal , Moxibustão , Animais , Estados Unidos , Bibliometria , ChinaRESUMO
Licorice (Gan-Cao, licorice) is a natural antioxidant and roasted licorice is the most common processing specification used in traditional Chinese medicine prescriptions. Traditional Chinese medicine theory deems that the honey-roasting process can promote the efficacy of licorice, including tonifying the spleen and augmenting "Qi" (energy). The antioxidant activity and mechanisms underlying roasted licorice have not yet been reported. In this study, we found that roasted licorice could relieve the oxidative stress injury induced by metronidazole (MTZ) and could restrain the production of excessive reactive oxygen species (ROS) induced by 2,2'-azobis (2-methylpropionamidine) dihydrochloride (AAPH) in a zebrafish model. It was further found that roasted licorice could exert its oxidative activity by upregulating the expression of key genes such as heme oxygenase 1 (HO-1), NAD(P)H quinone dehydrogenase 1 (NQO1), glutamate-cysteine ligase modifier subunit (GCLM), and glutamate-cysteine ligase catalytic subunit (GCLC) in the nuclear factor erythroid 2-related factor 2 (NRF2) signaling pathway both in vivo and in vitro. Furthermore, consistent results were obtained showing that rat serum containing roasted licorice was estimated to reduce cell apoptosis induced by H2O2. Then, the UHPLC-Q-Exactive Orbitrap MS analysis results elucidated the chemical composition of rat plasma containing roasted licorice extracts, including ten prototype chemical components and five metabolic components. Among them, six compounds were found to have binding activity with Kelch-like ECH-associated protein 1 (KEAP1), which plays a crucial role in the transcriptional activity of NRF2, using a molecular docking simulation. The results also showed that liquiritigenin had the strongest binding ability with KEAP1. Immunofluorescence further confirmed that liquiritigenin could induce the nuclear translocation of NRF2. In summary, this study provides a better understanding of the antioxidant effect and mechanisms of roasted licorice, and lays a theoretical foundation for the development of a potential antioxidant for use in clinical practice.
Assuntos
Glycyrrhiza , Triterpenos , Ratos , Animais , Glycyrrhiza/química , Antioxidantes/farmacologia , Antioxidantes/metabolismo , Fator 2 Relacionado a NF-E2/metabolismo , Proteína 1 Associada a ECH Semelhante a Kelch/metabolismo , Peixe-Zebra/metabolismo , Glutamato-Cisteína Ligase/metabolismo , Peróxido de Hidrogênio/metabolismo , Simulação de Acoplamento Molecular , Extratos VegetaisRESUMO
OBJECTIVE: To evaluate the real-world effectiveness of integrative medicine treatment on quality of life using the Patients Receiving Integrative Medicine Effectiveness Registry (PRIMIER). DESIGN: A prospective, longitudinal, observational evaluation of patient reported outcomes for quality of life. SETTING: Participants were patients from 17 integrative medicine clinics who received personalized, integrative medicine treatments between August 2013 and October 2017. MAIN OUTCOME MEASURES: Participants completed the Patient Reported Outcomes Measurement Information System (PROMIS)- 29, Perceived Stress Scale-4 (PSS-4), and the Patient Activation Measure (PAM) at index (baseline) visit and at 2, 4, 6, and 12 month follow-up assessments. Electronic health record data included diagnostic and billing codes/descriptions. A linear mixed-effects model was used to test whether outcomes changed from index through 12 months RESULTS: During enrollment, 4883 participants began the assessment, 3658 completed the index measures, and 2374 (65 %) completed at least 1 follow-up assessment, had electronic health record data and at least 1 integrative medicine visit. Most participants (mean age=51.4 years) were white (88.4 %), female (79.7 %), and college-educated (78.5 %). Significant improvements (p < 0.001) were observed at 12-months on all PROMIS-29 measures, PSS-4, and PAM. At 12 months, clinically meaningful improvements were found for 38 % and 28 % on PROMIS-29 Mental and Physical Health Summary scores respectively. CONCLUSIONS: PRIMIER is the largest study to assess the real-world effectiveness of integrative medicine. Results indicate a statistical and clinical improvement across all measures at 12 months. Future research could explore whether dosing, timing or combinations of integrative medicine interventions have differential impacts on quality of life.
Assuntos
Medicina Integrativa , Humanos , Feminino , Pessoa de Meia-Idade , Qualidade de Vida , Estudos Prospectivos , Medidas de Resultados Relatados pelo Paciente , PacientesRESUMO
The classical famous prescription Dajianzhong Decoction is recorded in Synopsis of the Golden Chamber written by Zhang Zhongjing in the Eastern Han Dynasty. It has a long history and definite clinical effects, while this prescription has not been manufactured into Chinese patent medicine preparation. We collected many ancient books of traditional Chinese medicine(TCM) by using the method of bibliometrics and got 211 valid data terms which involved 67 ancient books. The history, main treated syndromes, formulation principle, origins and processiong of medicinal materials, and decoction method of Dajianzhong Decoction were analyzed. Despite the different views of various generations of medical experts toward the composition of this prescription, the compatibility ratio of Ginseng Radix et Rhizoma to Zingiberis Rhizoma Recens is constant. Furthermore, we explored the origins of synonyms of Dajianzhong Decoction. On the basis of this study, we hope to gain an insight into the research and development of the compound preparations of Dajianzhong Decoction and provide reference for the heritage and innovation of other classical prescriptions.
Assuntos
Medicamentos de Ervas Chinesas , Medicina Tradicional Chinesa , Prescrições , RizomaRESUMO
Stimuli-responsive DNA hydrogels are promising candidates for cancer treatment, as they not only possess biocompatible and biodegradable 3D network structures as highly efficient carriers for therapeutic agents but also are capable of undergoing programmable gel-to-solution transition upon external stimuli to achieve controlled delivery. Herein, a promising platform for highly efficient photothermal-chemo synergistic cancer therapy is established by integrating DNA hydrogels with Ti3 C2 TX -based MXene as a photothermal agent and doxorubicin (DOX) as a loaded chemotherapeutic agent. Upon the irradiation of near-infrared light (NIR), temperature rise caused by photothermal MXene nanosheets triggers the reversible gel-to-solution transition of the DOX-loaded MXene-DNA hydrogel, during which the DNA duplex crosslinking structures unwind to release therapeutic agents for efficient localized cancer therapy. Removal of the NIR irradiation results in the re-formation of DNA duplex structures and the hydrogel matrix, and the recombination of free DOX and adaptive hydrogel transformations can also be achieved. As demonstrated by both in vitro and in vivo models, the MXene-DNA hydrogel system, with excellent biocompatibility and injectability, dynamically NIR-triggered drug delivery, and enhanced drug uptake under mild hyperthermia conditions, exhibits efficient localized cancer treatment with fewer side effects to the organisms.
Assuntos
Hidrogéis , Neoplasias , Adutos de DNA , Doxorrubicina/farmacologia , Doxorrubicina/uso terapêutico , Humanos , Neoplasias/tratamento farmacológico , Fototerapia/métodosRESUMO
OBJECTIVE: To systematically evaluate the impact of manual soft tissue therapy (MSTT) on the degree of pain in patients with chronic neck pain (CNP). METHODS: Trials included in the meta-analysis were identified by searching 5 English databases, including the PubMed, Embase, Cochrane Library, Web of Science and U.S. Clinical Trial Registry databases. The search was conducted with the subject terms neck pain, soft tissue treatment, massage, and myofascial release. We assessed the included trials using the Cochrane risk-of-bias tool. STATA statistical software version 16.0 was used for statistical analysis. Additionally, subgroup analysis and sensitivity analysis were performed to analyze the sources of heterogeneity and assess the stability of the research results. Begg's funnel plot and Egger's publication bias plot were used to assess potential publication bias. RESULTS: This systematic review included a total of 12 randomized controlled trials (566 patients in total). The participants were between 18 and 85 years old. Most of the included studies were of medium quality. This meta-analysis validated the effectiveness of MSTT in alleviating pain symptoms in patients with CNP (ES: 0.83; 95% CI: 1.15 to -0.51; P = 0.001). Egger's publication bias plot and Begg's funnel plot indicated that there may be potential publication bias. CONCLUSION: This meta-analysis found that MSTT has a significant effect on alleviating the pain of patients with CNP. In addition, the use of different pain measurement tools may influence effect of the intervention, but more clinical studies are needed in the future to determine the specific effect.
Assuntos
Dor Crônica , Cervicalgia , Humanos , Adolescente , Adulto Jovem , Adulto , Pessoa de Meia-Idade , Idoso , Idoso de 80 Anos ou mais , Cervicalgia/terapia , Dor Crônica/terapia , Massagem , Projetos de PesquisaRESUMO
Hypersensitivity to mechanical stimuli is a cardinal symptom of neuropathic and inflammatory pain. A reduction in spinal inhibition is generally considered a causal factor in the development of mechanical hypersensitivity after injury. However, the extent to which presynaptic inhibition contributes to altered spinal inhibition is less well established. Here, we used conditional deletion of GABAA in NaV1.8-positive sensory neurons (Scn10aCre;Gabrb3fl/fl) to manipulate selectively presynaptic GABAergic inhibition. Behavioral testing showed that the development of inflammatory punctate allodynia was mitigated in mice lacking pre-synaptic GABAA. Dorsal horn cellular circuits were visualized in single slices using stimulus-tractable dual-labelling of c-fos mRNA for punctate and the cognate c-Fos protein for dynamic mechanical stimulation. This revealed a substantial reduction in the number of cells activated by punctate stimulation in mice lacking presynaptic GABAA and an approximate 50% overlap of the punctate with the dynamic circuit, the relative percentage of which did not change following inflammation. The reduction in dorsal horn cells activated by punctate stimuli was equally prevalent in parvalbumin- and calretinin-positive cells and across all laminae I-V, indicating a generalized reduction in spinal input. In peripheral DRG neurons, inflammation following complete Freund's adjuvant (CFA) led to an increase in axonal excitability responses to GABA, suggesting that presynaptic GABA effects in NaV1.8+ afferents switch from inhibition to excitation after CFA. In the days after inflammation, presynaptic GABAA in NaV1.8+ nociceptors constitutes an "open gate" pathway allowing mechanoreceptors responding to punctate mechanical stimulation access to nociceptive dorsal horn circuits.
Assuntos
Hiperalgesia , Nociceptores , Animais , Adjuvante de Freund , Hiperalgesia/metabolismo , Inflamação/metabolismo , Camundongos , Nociceptores/metabolismo , Ácido gama-AminobutíricoRESUMO
BACKGROUND: Liver fibrosis is a common cause of chronic liver disease. If left untreated, it can ultimately develop into liver cirrhosis or hepatocellular carcinoma. However, a direct antifibrotic therapy is currently unavailable. A re-examination of existing chemicals might be a potential strategy for finding more lead compounds against liver fibrosis. Demethylzeylasteral (T-96), a naturally occurring bioactive compound found in Tripterygium wilfordii Hook. f. (TwHf) possesses multiple pharmacological properties. However, its antifibrotic potential has not yet been fully evaluated. PURPOSE: This study aimed to investigate the antifibrotic properties of T-96 and its underlying molecular mechanisms. METHODS: The antifibrotic properties of T-96 were investigated in three types of hepatic stellate cells (HSCs) and in a CCl4-induced liver fibrosis mouse model. The effect of T-96 on the proliferation, migration, and activation of HSCs was detected using CCK-8 and scratch/wound healing assays. Hepatic inflammation and fibrosis were evaluated by H&E, Masson's trichrome stain, and Sirius Red staining. The expression of inflammatory and fibrogenic genes was detected by quantitative real-time PCR (qRT-PCR) and western blotting. RNA sequencing (RNA-seq) was performed to explore the potential molecular mechanisms mediating the antifibrotic effect of T-96, which was verified by dual-luciferase reporter assay, qRT-PCR, western blotting, immunofluorescence, and immunoprecipitation analysis. RESULTS: The T-96 treatment significantly suppressed the proliferation, migration, and activation of HSCs in vitro. The administration of T-96 attenuated hepatic injury, inflammation, and fibrosis progression in mice with CCl4-induced liver fibrosis. In addition, the RNA-seq of fibrotic liver tissues and subsequent functional verification indicated that the key mechanisms of the antifibrotic effect of T-96 were mediated by suppressing the expression of AGAP2 (Arf GAP with GTPase-like domain, ankyrin repeat and PH domain 2), inhibiting the subsequent phosphorylation of focal adhesion kinase (FAK) and protein kinase B (AKT), and finally reducing the expression of fibrosis-related genes. CONCLUSION: Our results provide the first insight that T-96 exerts potent antifibrotic effects both in vitro and in vivo by inhibiting the AGAP2 mediated FAK/AKT signaling axis, and that T-96 may serve as a potential therapeutic candidate for the treatment of liver fibrosis.
Assuntos
Células Estreladas do Fígado , Proteínas Proto-Oncogênicas c-akt , Animais , Fibrose , Inflamação , Fígado , Cirrose Hepática , Camundongos , TriterpenosRESUMO
Scutellariae Radix(SR), derived from the dried root of Scutellaria baicalensis in the family Lamiaceae, commonly serves as Chinese medicinal material. Affected by producing areas, growing years, and harvesting periods, the quality of SR fluctuates in the market. However, baicalin≥9% in SR required in the Chinese Pharmacopoeia(2020 edition) can only determine the qualified SR but cannot identify high-quality SR. To improve the quality control methods of SR, the present study analyzed the accumulation of metabolites in SR of different growth years by plant metabolomics, and identified 28 metabolites increasing with growth years(1-3 years). Subsequently, 14 main metabolites were quantitatively analyzed by ultra-high performance liquid chromatography-tandem triple quadrupole mass spectrometry(UPLC-QQQ-MS). Among them, baicalin, wogonoside, baicalein, and wogonin with high content and good activity were selected as the index components of SR for quality evaluation. A high-performance liquid chromatography(HPLC) method was established to determine the content of four index components in 32 batches of SR from different producing areas, harvesting perio-ds, and growth years. The results showed that the growth years could greatly affect the content of index components. The total content of four index components in 2-year SR was the highest, followed by the 3-/4-year SR and 1-year SR. Based on HPLC data and verification results by enterprises, baicalin ≥12.0%, wogonoside ≥2.3%, baicalein ≥0.1%, and wogonin ≥0.03% were proposed as the evaluation criteria for the high-quality SR. The findings of this study are expected to provide a basis for improving the quality of SR.
Assuntos
Medicamentos de Ervas Chinesas , Flavanonas , Cromatografia Líquida de Alta Pressão/métodos , Flavonoides , Metabolômica , Extratos Vegetais , Scutellaria baicalensisRESUMO
Objective: To evaluate the application value of combined detection of serum homocysteine (Hcy), Toll-like receptor 4 (TLR4), and C-reactive protein (CRP) in the diagnosis of cerebral small vessel disease (CSVD). Methods: 90 patients with CSVD admitted to our hospital within the past year were identified as the research subjects, and the patients with cognitive dysfunction were assigned to the experimental group, and those with normal cognitive function were assigned to the control group according to the evaluation of cognitive dysfunction by the Montreal Cognitive Assessment (MoCA), with 45 cases in each group. Results: The experimental group obtained remarkably elevated Hcy levels than the control group (P < 0.05). The patient's cognitive dysfunction is mainly attributed to the impact of serum Hcy. TLR4 and Hcy were negatively correlated with MoCA scores (P > 0.05). In comparison with the control group, the experimental group had significantly higher levels of Hcy, serum CRP, and interleukin (IL)-6 (P < 0.05). Conclusion: The combined detection of serum Hcy, TLR4, and CRP features a high clinical value in the diagnosis of CSVD, which contributes to the prevention and treatment of cognitive dysfunction in patients.