RESUMO
Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.
RESUMO
Background: Armeniaca sibirica seed kernel oil is rich in oleic acid and linoleic acid, thus holding potential value as a source of high-quality edible oils. However, some regulatory factors involved in fatty acids accumulation in A. sibirica seed kernels remain largely elusive. Thus, the aim of this study was to elucidate the regulatory mechanisms underlying fatty acids biosynthesis in A. sibirica developing seed kernels. Methods: Seed kernels from six plants from a single A. sibirica clone were taken at five different developmental stages (days 30, 41, 52, 63, and 73 after anthesis). Fatty acid composition in seed kernel oil was determined by gas chromatography-mass spectrometry (GC-MS). In addition, transcriptome analysis was conducted using second-generation sequencing (SGS) and single-molecule real-time sequencing (SMRT). Results: Rapid accumulation of fatty acids occurred throughout the different stages of seed kernels development, with oleic acid and linoleic acid as the main fatty acids. A total of 10,024, 9,803, 6,004, 6,719 and 9,688 unigenes were matched in the Nt, Nr, KOG, GO and KEGG databases, respectively. In the category lipid metabolism, 228 differentially expressed genes (DEGs) were annotated into 13 KEGG pathways. Specific unigenes encoding 12 key enzymes related to fatty acids biosynthesis were determined. Co-expression network analysis identified 11 transcription factors (TFs) and 13 long non-coding RNAs (lncRNAs) which putatively participate in the regulation of fatty acid biosynthesis. This study provides insights into the molecular regulatory mechanisms of fatty acids biosynthesis in A. sibirica developing seed kernels, and enabled the identification of novel candidate factors for future improvement of the production and quality of seed kernel oil by breeding.
Assuntos
Melhoramento Vegetal , Transcriptoma , Transcriptoma/genética , Sementes/genética , Ácidos Graxos/análise , Ácido Linoleico/análise , Óleos de Plantas/análise , Ácidos Oleicos/análiseRESUMO
Cucumber green mottle mosaic virus (CGMMV) infection causes "blood flesh" symptoms in watermelon fruits, which severely reduces yield and edibleness. However, the growth of watermelon fruits is strongly associated with boron (B), a trace element for improving fruit quality. In this study, B-gradient hydroponic experiments (B concentration: 0, 2.86, and 5.72 mg·L-1 H3BO3) and foliar-spray experiments (B concentration: 30 and 300 mg·L-1 H3BO3) were performed. We found that the B-supplement could inhibit CGMMV infection and especially relieve "blood flesh" symptoms in watermelon fruits. The nutrient element, soluble sugar, and cell wall polysaccharide contents and their metabolism- and transport-related gene expressions were determined in leaves and fruits of the watermelons in B-gradient hydroponic and foliar-spray experiments. We found that the accumulation and metabolism of nutrients and carbohydrates in cells were disrupted by CGMMV infection; however, the B-supplement could restore and maintain their homeostasis. Additionally, we uncovered that NIP5;1 and SWEET4, induced by B-application with CGMMV infection, could majorly contribute to the resistance to CGMMV infection by regulating nutrient elements and carbohydrate homeostasis. These results provided a novel insight into the molecular mechanism of B-mediated CGMMV suppression and an efficient method of B-application for the improvement of watermelon quality after CGMMV infection.
Assuntos
Citrullus , Oligoelementos , Boro , Carboidratos , Doenças das Plantas , Açúcares , TobamovirusRESUMO
Plant MYB transcription factors control diverse biological processes, such as differentiation, development and abiotic stress responses. In this study, we characterized BplMYB46, an MYB gene from Betula platyphylla (birch) that is involved in both abiotic stress tolerance and secondary wall biosynthesis. BplMYB46 can act as a transcriptional activator in yeast and tobacco. We generated transgenic birch plants with overexpressing or silencing of BplMYB46 and subjected them to gain- or loss-of-function analysis. The results suggest that BplMYB46 improves salt and osmotic tolerance by affecting the expression of genes including SOD, POD and P5CS to increase both reactive oxygen species scavenging and proline levels. In addition, BplMYB46 appears to be involved in controlling stomatal aperture to reduce water loss. Overexpression of BplMYB46 increases lignin deposition, secondary cell wall thickness and the expression of genes in secondary cell wall formation. Further analysis indicated that BplMYB46 binds to MYBCORE and AC-box motifs and may directly activate the expression of genes involved in abiotic stress responses and secondary cell wall biosynthesis whose promoters contain these motifs. The transgenic BplMYB46-overexpressing birch plants, which have improved salt and osmotic stress tolerance, higher lignin and cellulose content and lower hemicellulose content than the control, have potential applications in the forestry industry.