Recent biomedical advancements in graphene oxide- and reduced graphene oxide-based nanocomposite nanocarriers.

Recently, nanocarriers, including micelles, polymers, carbon-based materials, liposomes, and other substances, have been developed for efficient delivery of drugs, nucleotides, and biomolecules. This review focuses on graphene oxide (GO) and reduced graphene oxide (rGO) as active components in nanocarriers, because their chemical structures and easy functionalization can be valuable assets for in vitro and in vivo delivery. Herein, we describe the preparation, structure, and functionalization of GO and rGO. Additionally, their important properties to function as nanocarriers are presented, including their molecular interactions with various compounds, near-infrared light adsorption, and biocompatibility. Subsequently, their mechanisms and the most appealing examples of their delivery applications are summarized. Overall, GO- and rGO-based nanocomposites show great promise as multipurpose nanocarriers owing to their various potential applications in drug and gene delivery, phototherapy, bioimaging, biosensing, tissue engineering, and as antibacterial agents.

Highly Optimized Iron Oxide Embedded Poly(Lactic Acid) Nanocomposites for Effective Magnetic Hyperthermia and Biosecurity.

INTRODUCTION: Iron oxide magnetic nanoparticles (IONPs) have attracted considerable attention for various biomedical applications owing to their ease of synthesis, strong magnetic properties, and biocompatibility. In particular, IONPs can generate heat under an alternating magnetic field, the effects of which have been extensively studied for magnetic hyperthermia therapy. However, the development of IONPs with high heating efficiency, biocompatibility, and colloidal stability in physiological environments is still required for their safe and effective application in biomedical fields. METHODS: We synthesized magnetic IONP/polymer nanocomposites (MNCs) by embedding IONPs in a poly(L-lactic acid) (PLA) matrix via nanoemulsion. The IONP contents (Fe: 9-22 [w/w]%) in MNCs were varied to investigate their effects on the magnetic and hyperthermia performances based on their optimal interparticle interactions. Further, we explored the stability, cytocompatibility, biodistribution, and in vivo tissue compatibility of the MNCs. RESULTS: The MNCs showed enhanced heating efficiency with over two-fold increase compared to nonembedded bare IONPs. The relationship between the IONP content and heating performance in MNCs was nonmonotonous. The highest heating performance was obtained from MNC2, which contain 13% Fe (w/w), implying that interparticle interactions in MNCs can be optimized to achieve high heating performance. In addition, the MNCs exhibited good colloidal stability under physiological conditions and maintained their heating efficiency during 48 h of incubation in cell culture medium. Both in vitro and in vivo studies revealed excellent biocompatibility of the MNC. CONCLUSION: Our nanocomposites, comprising biocompatible IONPs and PLA, display improved heating efficiency, good colloidal stability, and cytocompatibility, and thus will be beneficial for diverse biomedical applications, including magnetic hyperthermia for cancer treatment.

Impacts of Drug Interactions on Pharmacokinetics and the Brain Transporters: A Recent Review of Natural Compound-Drug Interactions in Brain Disorders.

Natural compounds such as herbal medicines and/or phyto-compounds from foods, have frequently been used to exert synergistic therapeutic effects with anti-brain disorder drugs, supplement the effects of nutrients, and boost the immune system. However, co-administration of natural compounds with the drugs can cause synergistic toxicity or impeditive drug interactions due to changes in pharmacokinetic properties (e.g., absorption, metabolism, and excretion) and various drug transporters, particularly brain transporters. In this review, natural compound-drug interactions (NDIs), which can occur during the treatment of brain disorders, are emphasized from the perspective of pharmacokinetics and cellular transport. In addition, the challenges emanating from NDIs and recent approaches are discussed.

Long-acting nanoparticulate DNase-1 for effective suppression of SARS-CoV-2-mediated neutrophil activities and cytokine storm.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a new strain of coronavirus not previously identified in humans. Globally, the number of confirmed cases and mortality rates of coronavirus disease 2019 (COVID-19) have risen dramatically. Currently, there are no FDA-approved antiviral drugs and there is an urgency to develop treatment strategies that can effectively suppress SARS-CoV-2-mediated cytokine storms, acute respiratory distress syndrome (ARDS), and sepsis. As symptoms progress in patients with SARS-CoV-2 sepsis, elevated amounts of cell-free DNA (cfDNA) are produced, which in turn induce multiple organ failure in these patients. Furthermore, plasma levels of DNase-1 are markedly reduced in SARS-CoV-2 sepsis patients. In this study, we generated recombinant DNase-1-coated polydopamine-poly(ethylene glycol) nanoparticulates (named long-acting DNase-1), and hypothesized that exogenous administration of long-acting DNase-1 may suppress SARS-CoV-2-mediated neutrophil activities and the cytokine storm. Our findings suggest that exogenously administered long-acting nanoparticulate DNase-1 can effectively reduce cfDNA levels and neutrophil activities and may be used as a potential therapeutic intervention for life-threatening SARS-CoV-2-mediated illnesses.

Improvement of glymphatic-lymphatic drainage of beta-amyloid by focused ultrasound in Alzheimer's disease model.

Drainage of parenchymal waste through the lymphatic system maintains brain homeostasis. Age-related changes of glymphatic-lymphatic clearance lead to the accumulation beta-amyloid (Aß) in dementia models. In this study, focused ultrasound treatment in combination with microbubbles (FUS-MB) improved Aß drainage in early dementia model mice, 5XFAD. FUS-MB enhanced solute Aß clearance from brain, but not plaques, to cerebrospinal fluid (CSF) space and then deep cervical lymph node (dCLN). dCLN ligation exaggerated memory impairment and progress of plaque formation and also the beneficial effects of FUS-MB upon Aß removal through CSF-lymphatic routes. In this ligation model, FUS-MB improved memory despite accumulation of Aß in CSF. In conclusion, FUS-MB enhances glymphatic-lymphatic clearance of Aß mainly by increasing brain-to-CSF Aß drainage. We suggest that FUS-MB can delay dementia progress in early period and benefits of FUS-MB depend on the effect of Aß disposal through CSF-lymphatics.

Development and Validation of Liquid Chromatography-Tandem Mass Spectrometry Method for Pharmacokinetic Evaluation of 7ß-(3-Ethyl-cis-crotonoyloxy)-1α-(2-methylbutyryloxy)-3,14-dehydro-Z-notonipetranon in Rats.

Recently, potent neuroprotective and anti-diabetic effects of 7ß-(3-Ethyl-cis-crotonoyloxy)-1α-(2-methylbutyryloxy)-3,14-dehydro-Z-notonipetranone (ECN), a sesquiterpenoid isolated from Tussilago farfara Linnaeus, have been elucidated. To facilitate further pre-clinical evaluation in rats, an analytical method for the determination of ECN in rat plasma was developed and optimized by using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Plasma samples were pretreated by the protein precipitation method with an acetonitrile solution of losartan (LST) as the internal standard. Chromatographic separation was performed using a an Octadecyl-silica (ODS) column (2.6 µm, 100 x 4.6 mm) in the isocratic mode. The mobile phase, comprising 10 mM ammonium formate in water pH 5.75) and acetonitrile (11:89, v/v), was eluted at a flow rate of 0.4 mL/min. Mass spectrometric detection was performed in the multiple reaction monitoring mode with positive electrospray ionization, and the mass transitions of ECN and LST were m/z 431.3 to 97.3 and m/z 423.1 to 207.2, respectively. The calibration curves of spiked plasma samples were linear in the 10.0-10,000 ng/mL range (r2 > 0.996). The lower limit of quantification (LLOQ) was determined as 10.0 ng/mL. Validation was conducted in the LLOQ, and three quality control (QC) sample levels (10.0, 25.0, 3750, and 7500 ng/mL) were studied. Among them, the relative standard deviation for the within- and between-run precisions was under 9.90%, and the relative error of the accuracies was within the -8.13% to 0.42% range. The validated method was successfully employed to investigate the pharmacokinetic properties of ECN in rats, which revealed the linear pharmacokinetic behavior of ECN for the first time.

Magnetic field-inducible drug-eluting nanoparticles for image-guided thermo-chemotherapy.

Multifunctional nanoparticles integrating cancer cell imaging and treatment modalities into a single platform are recognized as a promising approach; however, their development currently remains a challenge. In this study, we synthesized magnetic field-inducible drug-eluting nanoparticles (MIDENs) by embedding superparamagnetic iron oxide nanoparticles (Fe3O4; SPIONs) and cancer therapeutic drugs (doxorubicin; DOX) in a temperature-responsive poly (lactic-co-glycolic acid) (PLGA) nanomatrix. Application of an external alternating magnetic field (AMF) generated heat above 42 °C and subsequent transition of the PLGA polymer matrix (Tg = 42-45 °C) from the glassy to the rubbery state, facilitating the controlled release of the loaded DOX, ultimately allowing for simultaneous hyperthermia and local heat-triggered chemotherapy for efficient dual cancer treatment. The average size of the synthesized MIDENs was 172.1 ±â€¯3.20 nm in diameter. In vitro studies showed that the MIDENs were cytocompatible and especially effective in destroying CT26 colon cancer cells with AMF application. In vivo studies revealed that the MIDENs enabled enhanced T2 contrast magnetic resonance imaging and a significant suppression of malignant tumor growth under an AMF. Our multifunctional MIDENs, composed of biocompatible substances and therapeutic/imaging modalities, will be greatly beneficial for cancer image-guided thermo-chemotherapy applications.

Antiobesity Effect of Astilbe chinensis Franch. et Savet. Extract through Regulation of Adipogenesis and AMP-Activated Protein Kinase Pathways in 3T3-L1 Adipocyte and High-Fat Diet-Induced C57BL/6N Obese Mice.

Astilbe chinensis Franch. et Savat. (AC) has been used in traditional medicine for the treatment of chronic bronchitis, arthralgia, and gastralgia. In this study, we investigated the antiobesity effect of AC extract on 3T3-L1 preadipocytes and high-fat-diet-fed C57BL/6N obese mice. We found that AC extracts dramatically decreased the lipid content of 3T3-L1 cells in a concentration-dependent manner without cytotoxicity. The action mechanism of AC extract was demonstrated to be the inhibition of lipid accumulation and dose-dependent decrease in the expression of CCAAT/enhancer-binding protein α (C/EBPα), peroxisome proliferator-activated receptor-γ (PPAR-γ), and sterol regulatory element-binding protein 1 (SREBP1). Furthermore, AC extract increased the mitochondrial phosphorylation of AMP-activated protein kinase (AMPK) and acetyl-CoA carboxylase (ACC), mitochondrial biogenesis, and lipolysis-related factors. In amice model of high-fat-diet-induced obesity, the mice administered AC extract experienced significant decrease of 64% in weight gain, 55% in insulin resistance index, 22% in plasma triglycerides (TG), 56% in total cholesterol (TC), and 21% in nonesterified fatty acid (NEFA) levels compared with those in the high-fat diet-fed control mice. Collectively, these results indicated that AC extract exerted antiobesogenic activity through the modulation of the AMPK signaling pathway, inhibition of adipogenesis, decreased lipid content, and reduced adipocyte size.

Development of Houttuynia cordata Extract-Loaded Solid Lipid Nanoparticles for Oral Delivery: High Drug Loading Efficiency and Controlled Release.

Houttuynia cordata (H. cordata) has been used for diuresis and detoxification in folk medicine as well as a herbal medicine with antiviral and antibacterial activities. H. cordata extract-loaded solid lipid nanoparticles (H-SLNs) were prepared with various concentration of poloxamer 188 or poloxamer 407 by a hot homogenization and ultrasonication method. H-SLNs dispersion was freeze-dried with or without trehalose as a cryoprotectant. The physicochemical characteristics of H-SLNs were evaluated by dynamic laser scattering (DLS), differential scanning calorimetry (DSC), Fourier transform infrared spectroscopy (FT-IR), and scanning electron microscopy (SEM). Additionally, the in vitro release and in vitro cytotoxicity of H-SLNs were measured. Encapsulation efficiencies of H-SLNs (as quercitrin) were 92.9-95.9%. The SEM images of H-SLNs showed that H-SLNs have a spherical morphology. DSC and FT-IR showed that there were no interactions between ingredients. The increased extent of particle size of freeze-dried H-SLNs with trehalose was significantly lower than that of H-SLNs without trehalose. H-SLNs provided sustained release of quercitrin from H. cordata extracts. Cell viability of Caco-2 cells was over 70% according to the concentration of various formulation. Therefore, it was suggested that SLNs could be good carrier for administering H. cordata extracts.

Evaluation of Hepatic Steatosis by Using Acoustic Structure Quantification US in a Rat Model: Comparison with Pathologic Examination and MR Spectroscopy.

Purpose To determine factors that significantly affect the focal disturbance (FD) ratio calculated with an acoustic structure quantification (ASQ) technique in a dietary-induced fatty liver disease rat model and to assess the diagnostic performance of the FD ratio in the assessment of hepatic steatosis by using histopathologic examination as a standard of reference. Materials and Methods Twenty-eight male F344 rats were fed a methionine-choline-deficient diet with a variable duration (3.5 days [half week] or 1, 2, 3, 4, 5, or 6 weeks; four rats in each group). A control group of four rats was maintained on a standard diet. At the end of each diet period, ASQ ultrasonography (US) and magnetic resonance (MR) spectroscopy were performed. Then, the rat was sacrificed and histopathologic examination of the liver was performed. Receiver operating characteristic curve analysis was performed to assess the diagnostic performance of the FD ratio in the evaluation of the degree of hepatic steatosis. The Spearman correlation coefficient was calculated to assess the correlation between the ordinal values, and multivariate linear regression analysis was used to identify significant determinant factors for the FD ratio. Results The diagnostic performance of the FD ratio in the assessment of the degree of hepatic steatosis (area under the receiver operating characteristic curve: 1.000 for 5%-33% steatosis, 0.981 for >33% to 66% steatosis, and 0.965 for >66% steatosis) was excellent and was comparable to that of MR spectroscopy. There was a strong negative linear correlation between the FD ratio and the estimated fat fraction at MR spectroscopy (Spearman ρ, -0.903; P < .001). Multivariate linear regression analysis showed that the degree of hepatic steatosis (P < .001) and fibrosis stage (P = .022) were significant factors affecting the FD ratio. Conclusion The FD ratio may potentially provide good diagnostic performance in the assessment of the degree of hepatic steatosis, with a strong negative linear correlation with the estimated fat fraction at MR spectroscopy. The degree of steatosis and stage of fibrosis at histopathologic examination were significant factors that affected the FD ratio. © RSNA, 2017 Online supplemental material is available for this article.

Nanocomposites based on Soluplus and Angelica gigas Nakai extract fabricated by an electrohydrodynamic method for oral administration.

Nanocomposites (NCs) based on Soluplus (SP) were fabricated by an electrohydrodynamic (EHD) method for the oral delivery of Angelica gigas Nakai (AGN). Nano-sized particles were obtained after dispersing the resultant, produced by the EHD technique, in the aqueous environment. AGN/SP2 (AGN:SP=1:2, w/w) NC dispersion in aqueous media exhibited a 130nm mean diameter, narrow size distribution, and robust stability in the tested concentration range of the ethanol extract of AGN (AGN EtOH ext) and at pH 1.2 and 6.8. Amorphization of the components of AGN and their interactions with SP in the AGN/SP2 NC formulation were demonstrated by X-ray diffractometry (XRD) analysis. The released amounts of decursin (D) and decursinol angelate (DA), major components of AGN, from NCs were improved compared with those from the AGN EtOH ext group at both pH 1.2 and 6.8. As D and DA can be metabolized into decursinol (DOH) in the liver after oral administration, the DOH concentrations in plasma were quantitatively determined to evaluate the oral absorption of AGN. In a pharmacokinetic study in rats, higher oral absorption and the maximum concentration in plasma (Cmax) were presented in the AGN/SP2 NC group compared with the AGN EtOH ext and AGN NC groups. These findings indicate the successful application of developed SP-based NCs for the oral delivery of AGN.

Screening of Korean Natural Products for Anti-Adipogenesis Properties and Isolation of Kaempferol-3-O-rutinoside as a Potent Anti-Adipogenetic Compound from Solidago virgaurea.

In this study, the anti-adipogenetic activity of 300 plant extracts was investigated using an Oil Red O staining assay in a 3T3-L1 cell line. Our results indicate that three plants, including the stem and leaf of Physalis angulata, the whole grass of Solidago virgaurea, and the root of Dioscorea nipponica, produced over 90% inhibition of adipogenesis. Kaempferol-3-O-rutinoside, which demonstrated a 48.2% inhibitory effect on adipogenesis without cytotoxicity, was isolated from the butanol layer of a water extract of S. virgaurea guided by the anti-adipogenesis assay in 3T3-L1. PPAR-γ and C/EBPα expression levels were determined using western blot, and our results indicate that kaempferol-3-O-rutinoside has a strong anti-adipogenic effect in 3T3-L1 cells through the suppression of increases in PPAR-γ and C/EBPα expression.

High body clearance and low oral bioavailability of alantolactone, isolated from Inula helenium, in rats: extensive hepatic metabolism and low stability in gastrointestinal fluids.

Alantolactone (ALA) is a major bioactive sesquiterpene lactone present in the roots of Inula helenium L. (Asteraceae) which has been used widely in traditional medicine against various diseases such as asthma, cancer and tuberculosis. The pharmacologic activities of alantolactone have been well characterized, yet information on the physicochemical and pharmacokinetic properties of alantolactone and their mechanistic elucidation are still limited. Thus, this study aims to investigate the oral absorption and disposition of alantolactone and their relevant mechanisms. Log P values of alantolactone ranged from 1.52 to 1.84, and alantolactone was unstable in biological samples such as plasma, urine, bile, rat liver microsomes (RLM) and simulated gastrointestinal fluids. The metabolic rate of alantolactone was markedly higher in rat liver homogenates than in the other tissue homogenates. A saturable and concentration-dependent metabolic rate profile of alantolactone was observed in RLM, and rat cytochrome P450 (CYP) 1 A, 2C, 2D and 3 A subfamilies were significantly involved in its hepatic metabolism. Based on the well-stirred model, the hepatic extraction ratio (HER) was estimated to be 0.890-0.933, classifying alantolactone as a drug with high HER. Moreover, high total body clearance (111 ± 41 ml/min/kg) and low oral bioavailability (0.323%) of alantolactone were observed in rats. Taken together, the present study demonstrates that the extensive hepatic metabolism, at least partially mediated by CYP, is primarily responsible for the high total body clearance of alantolactone, and that the low oral bioavailability of alantolactone could be attributed to its low stability in gastrointestinal fluids and a hepatic first-pass effect in rats. Copyright © 2016 John Wiley & Sons, Ltd.

Omega-3 fatty acids incorporated colloidal systems for the delivery of Angelica gigas Nakai extract.

Omega-3 (ω-3) fish oil-enriched colloidal systems were developed for the oral delivery of Angelica gigas Nakai (AGN) extract (ext). By constructing a pseudo-ternary phase diagram, the composition of oil-in-water (o/w) microemulsion (ME) systems based on ω-3 (oil), Labrasol (surfactant), and water was determined. AGN ext was dissolved into the ME system and d-α-tocopherol polyethylene glycol 1000 succinate (TPGS) was added to the ME formulation in order to enhance the mucosal absorption of the pharmacologically active ingredients in the AGN ext. The droplet size of AGN-loaded MEs was 205-277 nm and their morphology was spherical. The release of major components of AGN, decursin (D) and decursinol angelate (DA), from ME formulations in pH 1.2 and 6.8 buffers was significantly greater (P<0.05) than that from the AGN suspension group. The pharmacokinetic properties of AGN-loaded MEs in rats were evaluated by measuring decursinol (DOH) concentrations in plasma after oral administration. TPGS-included ME (F2) resulted in significantly greater (P<0.05) systemic exposure of DOH than that with ME without TPGS (F1), AGN ext+TPGS, and AGN in suspension. Severe toxicity of F1 and F2 on the intestinal epithelium was not observed by histological staining. The colloidal carriers described herein are promising delivery systems for oral administration of AGN ext.

Options for reducing oil content of sludge from a petroleum wastewater treatment plant.

Wastewater treatment plants at petroleum refineries often produce substantial quantities of sludge with relatively high concentrations of oil. Disposal of this waste is costly, in part because the high oil content requires use of secure disposal methods akin to handling of hazardous wastes. This article examines the properties of oily sludge and evaluates optional methods for reducing the oil content of this sludge to enable use of lower cost disposal methods. To reduce the oil content or break the structure of oily sludge, preliminary lab-scale experiments involving mechanical treatment, surfactant extraction, and oxidation are conducted. By applying surfactants, approximately 36% to 45% of oils are extracted from oily sludge. Of this, about 33% of oils are rapidly oxidised via radiation by an electron beam within 10 s of exposure. The Fenton reaction is effective for destruction of oily sludge. It is also found that 56% of oils were removed by reacting oily sludge with water containing ozone of 0.5 mg l(-1) over a period of 24 h. Oxidation using ozone thus can also be effectively used as a pretreatment for oily sludge.

Angelica gigas Nakai and Soluplus-Based Solid Formulations Prepared by Hot-Melting Extrusion: Oral Absorption Enhancing and Memory Ameliorating Effects.

Oral solid formulations based on Angelica gigas Nakai (AGN) and Soluplus were prepared by the hot-melting extrusion (HME) method. AGN was pulverized into coarse and ultrafine particles, and their particle size and morphology were investigated. Ultrafine AGN particles were used in the HME process with high shear to produce AGN-based formulations. In simulated gastrointestinal fluids (pH 1.2 and pH 6.8) and water, significantly higher amounts of the major active components of AGN, decursin (D) and decursinol angelate (DA), were extracted from the HME-processed AGN/Soluplus (F8) group than the AGN EtOH extract (ext) group (p < 0.05). Based on an in vivo pharmacokinetic study in rats, the relative oral bioavailability of decursinol (DOH), a hepatic metabolite of D and DA, in F8-administered mice was 8.75-fold higher than in AGN EtOH ext-treated group. In scopolamine-induced memory-impaired mice, F8 exhibited a more potent cognitive enhancing effect than AGN EtOH ext in both a Morris water maze test and a passive avoidance test. These findings suggest that HME-processed AGN/Soluplus formulation (F8) could be a promising therapeutic candidate for memory impairment.

Effect of honokiol on cytochrome P450 and UDP-glucuronosyltransferase enzyme activities in human liver microsomes.

Honokiol is a bioactive component isolated from the medicinal herbs Magnolia officinalis and Magnolia grandiflora that has antioxidative, anti-inflammatory, antithrombotic, and antitumor activities. The inhibitory potentials of honokiol on eight major human cytochrome P450 (CYP) enzymes 1A2, 2A6, 2B6, 2C8, 2C9, 2C19, 2D6, and 3A4, and four UDP-glucuronosyltransferases (UGTs) 1A1, 1A4, 1A9, and 2B7 in human liver microsomes were investigated using liquid chromatography-tandem mass spectrometry. Honokiol strongly inhibited CYP1A2-mediated phenacetin O-deethylation, CYP2C8-mediated amodiaquine N-deethylation, CYP2C9-mediated diclofenac 4-hydroxylation, CYP2C19-mediated [S]-mephenytoin 4-hydroxylation, and UGT1A9-mediated propofol glucuronidation with K(i) values of 1.2, 4.9, 0.54, 0.57, and 0.3 µM, respectively. Honokiol also moderately inhibited CYP2B6-mediated bupropion hydroxylation and CYP2D6-mediated bufuralol 1'-hydroxylation with K(i) values of 17.5 and 12.0 µM, respectively. These in vitro results indicate that honokiol has the potential to cause pharmacokinetic drug interactions with other co-administered drugs metabolized by CYP1A2, CYP2C8, CYP2C9, CYP2C19, and UGT1A9.

Effects of add-on therapy with NDC-052, an extract from Magnoliae Flos, in adult asthmatic patients receiving inhaled corticosteroids.

BACKGROUND/AIMS: There is a need for new anti-asthmatic medications with fewer side effects. NDC-052, an extract of the medicinal herb Magnoliae flos, which has a long history of clinical use, was recently found to have anti-inflammatory effects. Herein, we evaluated the effects of NDC-052 as an add-on therapy in patients with mild to moderate asthma using inhaled corticosteroids (ICS). METHODS: In a non-comparative, multi-center trial, 148 patients taking ICS received NDC-052 for eight weeks. We evaluated their forced expiratory volume in one second (FEV1), morning and evening peak expiratory flow rate (AM and PM PEFR), AM/PM asthma symptom scores, visual analogue symptom (VAS) scores, night-time wakening, frequency of short-acting ß2-agonist usage, and adverse events. RESULTS: After eight weeks, both AM and PM PEFRs were significantly improved. Asthma symptom scores, VAS scores, the frequency of nights without awakening, and the frequency of ß2-agonist use were also reduced. Most of the adverse drug reactions were mild and resolved spontaneously. CONCLUSIONS: The addition of NDC-052 to ICS had a beneficial effect on asthma control in patients with mild to moderate asthma, with good tolerability and fewer side effects. Further studies are necessary to evaluate the effects of NDC-052 in patients with severe and/or refractory asthma.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Therapeutic potential of peroxisome proliferators--activated receptor-alpha/gamma dual agonist with alleviation of endoplasmic reticulum stress for the treatment of diabetes.

OBJECTIVE: Peroxisome proliferator-activated receptor (PPAR) alpha/gamma dual agonists have the potential to be used as therapeutic agents for the treatment of type 2 diabetes. This study evaluated the function of macelignan, a natural compound isolated from Myristica fragrans, as a dual agonist for PPARalpha/gamma and investigated its antidiabetes effects in animal models. RESEARCH DESIGN AND METHODS: GAL4/PPAR chimera transactivation was performed and the expression of PPARalpha/gamma target genes was monitored to examine the ability of macelignan to activate PPARalpha/gamma. Additionally, macelignan was administrated to obese diabetic (db/db) mice to investigate antidiabetes effects and elucidate its molecular mechanisms. RESULTS: Macelignan reduced serum glucose, insulin, triglycerides, free fatty acid levels, and triglycerides levels in the skeletal muscle and liver of db/db mice. Furthermore, macelignan significantly improved glucose and insulin tolerance in these mice, and without altering food intake, their body weights were slightly reduced while weights of troglitazone-treated mice increased. Macelignan increased adiponectin expression in adipose tissue and serum, whereas the expression and serum levels of tumor necrosis factor-alpha and interleukin-6 decreased. Macelignan downregulated inflammatory gene expression in the liver and increased AMP-activated protein kinase activation in the skeletal muscle of db/db mice. Strikingly, macelignan reduced endoplasmic reticulum (ER) stress and c-Jun NH(2)-terminal kinase activation in the liver and adipose tissue of db/db mice and subsequently increased insulin signaling. CONCLUSIONS: Macelignan enhanced insulin sensitivity and improved lipid metabolic disorders by activating PPARalpha/gamma and attenuating ER stress, suggesting that it has potential as an antidiabetes agent for the treatment of type 2 diabetes.