Associations between predicted vitamin D status, vitamin D intake, and risk of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection and coronavirus disease 2019 (COVID-19) severity.

BACKGROUND: Vitamin D may have a role in immune responses to viral infections. However, data on the association between vitamin D and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection and coronavirus disease 2019 (COVID-19) severity have been limited and inconsistent. OBJECTIVE: We examined the associations of predicted vitamin D status and intake with risk of SARS-CoV-2 infection and COVID-19 severity. METHODS: We used data from periodic surveys (May 2020 to March 2021) within the Nurses' Health Study II. Among 39,315 participants, 1768 reported a positive test for SARS-CoV-2 infection. Usual vitamin D intake from foods and supplements were measured using a semiquantitative, pre-pandemic food-frequency questionnaire in 2015. Predicted 25-hydroxyvitamin D [25(OH)D] concentration were calculated based on a previously validated model including dietary and supplementary vitamin D intake, UV-B, and other behavioral predictors of vitamin D status. RESULTS: Higher predicted 25(OH)D concentrations, but not vitamin D intake, were associated with a lower risk of SARS-CoV-2 infection. Comparing participants in the highest quintile of predicted 25(OH)D concentrations with the lowest, the multivariable-adjusted OR was 0.76 (95% CI: 0.58, 0.99; P-trend = 0.04). Participants in the highest quartile of UV-B (OR: 0.76; 95% CI: 0.66, 0.87; P-trend = 0.002) and UV-A (OR: 0.76; 95% CI: 0.66, 0.88; P-trend < 0.001) also had a lower risk of SARS-CoV-2 infection compared with the lowest. High intake of vitamin D from supplements (≥400 IU/d) was associated with a lower risk of hospitalization (OR: 0.51; 95% CI: 0.29, 0.91; P-trend = 0.04). CONCLUSIONS: Our study provides suggestive evidence on the association between higher predicted circulating 25(OH)D concentrations and a lower risk of SARS-CoV-2 infection. Greater intake of vitamin D supplements was associated with a lower risk of hospitalization. Our data also support an association between exposure to UV-B or UV-A, independently of vitamin D and SARS-CoV-2 infection, so results for predicted 25(OH)D need to be interpreted cautiously.

Inhibition of cotranslational translocation by apratoxin S4: Effects on oncogenic receptor tyrosine kinases and the fate of transmembrane proteins produced in the cytoplasm.

Receptor tyrosine kinases (RTKs) have become major targets for anticancer therapy. However, resistance and signaling pathway redundancy has been problematic. The marine-derived apratoxins act complementary to direct kinase inhibitors by downregulating the levels of multiple of these receptors and additionally prevent the secretion of growth factors that act on these receptors by targeting Sec61α, therefore interfering with cotranslational translocation. We have profiled the synthetic, natural product-inspired apratoxin S4 against panels of cancer cells characterized by differential sensitivity to RTK inhibitors due to receptor mutations, oncogenic KRAS mutations, or activation of compensatory pathways. Apratoxin S4 was active at low-nanomolar to sub-nanomolar concentrations against panels of lung, head and neck, bladder, and pancreatic cancer cells, concomitant with the downregulation of levels of several RTKs, including EGFR, MET and others. However, the requisite concentration to inhibit certain receptors varied, suggesting some differential substrate selectivity in cellular settings. This selectivity was most pronounced in breast cancer cells, where apratoxin S4 selectively targeted HER3 over HER2 and showed greater activity against ER+ and triple negative breast cancer cells than HER2+ cancer cells. Depending on the breast cancer subtype, apratoxin S4 differentially downregulated transmembrane protein CDCP1, which is linked to metastasis and invasion in breast cancer and modulates EGFR activity. We followed the fate of CDCP1 through proteomics and found that nonglycosylated CDCP1 associates with chaperone HSP70 and HUWE1 that functions as an E3 ubiquitin ligase and presumably targets CDCP1, as well as potentially other substrates inhibited by apratoxins, for proteasomal degradation. By preventing cotranslational translocation of VEGF and other proangiogenic factors as well as VEGFR2 and other receptors, apratoxins also possess antiangiogenic activity, which was validated in endothelial cells where downregulation of VEGFR2 was observed, extending the therapeutic scope to angiogenic diseases.

Psychophysiologic symptom relief therapy for chronic back pain: a pilot randomized controlled trial.

INTRODUCTION: Chronic back pain is the leading cause of disability in the United States. Based on the hypothesis that nonspecific back pain may be rooted in a psychophysiologic etiology, we propose a new approach to chronic back pain. OBJECTIVES: A pilot study was conducted to assess whether psychophysiologic symptom relief therapy (PSRT) can reduce disability and back pain bothersomeness for patients with chronic back pain. METHODS: This was a three-armed, randomized trial for adults with nonspecific chronic back pain that compared PSRT with usual care and an active comparator (mindfulness-based stress reduction [MBSR]). Psychophysiologic symptom relief therapy-randomized participants received a 12-week (36 hours) course based on the psychophysiological model of pain. All groups were administered validated questionnaires at baseline and at 4, 8, 13, and 26 weeks. The primary outcome was the reduction in pain disability measured by the Roland-Morris Disability Questionnaire. RESULTS: The mean Roland-Morris Disability Questionnaire score for the PSRT group (n = 11) decreased from 9.5 (±4.3 SDs) to 3.3 (±5.1) after 26 weeks which was statistically significant compared with both MBSR (n = 12) (P = 0.04) and usual care (n = 12) (P = 0.03). Pain bothersomeness scores and pain-related anxiety decreased significantly over 26 weeks in PSRT compared with MBSR and usual care (data in manuscript). At 26 weeks, 63.6% of the PSRT arm reported being pain free (0/10 pain) compared with 25.0% and 16.7% in MBSR and usual care arms, respectively. Psychophysiologic symptom relief therapy attendance was 76%, and there was 100% follow-up of all groups. CONCLUSION: Psychophysiologic symptom relief therapy is a feasible and potentially highly beneficial treatment for patients with nonspecific back pain.

Modest effects of dietary supplements during the COVID-19 pandemic: insights from 445 850 users of the COVID-19 Symptom Study app.

OBJECTIVES: Dietary supplements may ameliorate SARS-CoV-2 infection, although scientific evidence to support such a role is lacking. We investigated whether users of the COVID-19 Symptom Study app who regularly took dietary supplements were less likely to test positive for SARS-CoV-2 infection. DESIGN: App-based community survey. SETTING: 445 850 subscribers of an app that was launched to enable self-reported information related to SARS-CoV-2 infection for use in the general population in the UK (n=372 720), the USA (n=45 757) and Sweden (n=27 373). MAIN EXPOSURE: Self-reported regular dietary supplement usage (constant use during previous 3 months) in the first waves of the pandemic up to 31 July 2020. MAIN OUTCOME MEASURES: SARS-CoV-2 infection confirmed by viral RNA reverse transcriptase PCR test or serology test before 31 July 2020. RESULTS: In 372 720 UK participants (175 652 supplement users and 197 068 non-users), those taking probiotics, omega-3 fatty acids, multivitamins or vitamin D had a lower risk of SARS-CoV-2 infection by 14% (95% CI (8% to 19%)), 12% (95% CI (8% to 16%)), 13% (95% CI (10% to 16%)) and 9% (95% CI (6% to 12%)), respectively, after adjusting for potential confounders. No effect was observed for those taking vitamin C, zinc or garlic supplements. On stratification by sex, age and body mass index (BMI), the protective associations in individuals taking probiotics, omega-3 fatty acids, multivitamins and vitamin D were observed in females across all ages and BMI groups, but were not seen in men. The same overall pattern of association was observed in both the US and Swedish cohorts. CONCLUSION: In women, we observed a modest but significant association between use of probiotics, omega-3 fatty acid, multivitamin or vitamin D supplements and lower risk of testing positive for SARS-CoV-2. We found no clear benefits for men nor any effect of vitamin C, garlic or zinc. Randomised controlled trials are required to confirm these observational findings before any therapeutic recommendations can be made.

Efficacy of cognitive behavioral therapy for insomnia in breast cancer: A meta-analysis.

Insomnia is highly prevalent among patients with breast cancer (BC). Although cognitive behavioral therapy for insomnia (CBT-I) is available in integrative oncology settings, it poses unique challenges for BC survivors. Our review aimed to assess the evidence for the therapeutic effects of CBT-I on insomnia in BC. Randomized controlled trials (RCTs) that included patients/survivors with BC and insomnia, and at least one validated self-report measure of sleep quality were included in the review. Of the 14 included RCTs (total N = 1363), the most common components incorporated in CBT-I interventions were sleep hygiene, stimulus control and sleep restriction. Pooled effect sizes favored CBT-I at post-intervention (Hedges' g = -0.779, 95% CI = -0.949, -0.609), short-term follow-up (within six months, Hedges' g = -0.653, 95% CI = -0.808, -0.498), and long-term follow-up (12 mo, Hedges' g = -0.335, 95% CI = -0.532, -0.139). In sub-analyses, CBT-I had similar effect sizes regardless of potential modifiers (comparison design, delivery formats, etc.). As an integrative oncology intervention, CBT-I is efficacious for reducing insomnia and improving sleep quality in women treated for BC, with medium-to-large effect sizes that persist after intervention delivery ends. Given the variability in the CBT-I components tested in RCTs, future studies should investigate the optimal integration of CBT-I components for managing insomnia during BC survivorship.

A systematic review and meta-analysis of mindfulness- and acceptance-based interventions for affect intolerance/sensitivity.

Affect intolerance/sensitivity, defined as one's sensitivity to, or inability to tolerate, affective states, is a transdiagnostic process implicated in the development and maintenance of numerous forms of psychopathology. Mindfulness and acceptance interventions are posited to improve affect intolerance/sensitivity; however, there has been no quantitative synthesis of this research to date. Seven electronic databases were searched up until November 2018. Hedges' g values, 95% confidence intervals, p-values, and Q-values were calculated for a series of random-effects models. Twenty-five studies (pooled N = 1778) met eligibility criteria and were included in the qualitative synthesis (n = 22 included in the meta-analysis). There was a small, significant effect of mindfulness and acceptance interventions on improving affect intolerance/sensitivity from pre-to post-intervention (Hedges' g = -0.37, 95% CI = -0.52 to -0.23, p < .001), with effects maintained up to 6-months (Hedges' g = -0.35, 95% CI = -0.61 to -0.09, p < .01). There was a significantly larger effect for studies with inactive compared to active controls. No significant effect size differences were found for intervention length (<8 vs. ≥ 8 sessions), intervention type (mindfulness vs. acceptance) or sample type (clinical vs. non-clinical). Mindfulness and acceptance interventions modestly improve affect intolerance/sensitivity.

Indices of Change, Expectations, and Popularity of Biological Treatments for Major Depressive Disorder between 1988 and 2017: A Scientometric Analysis.

BACKGROUND: Major Depressive Disorder (MDD) is the most common psychiatric disorder with high prevalence and disease burden. Biological treatments of MDD over the last several decades include a wide range of antidepressants and neurostimulation therapies. While recent meta-analyses have explored the efficacy and tolerability of antidepressants, the changing trends of biological treatments have not been evaluated. Our study measured the indices of change, expectations, and popularity of biological treatments of MDD between 1988 and 2017. METHODS: We performed a scientometric analysis to identify all relevant publications related to biological treatments of MDD from 1988 to 2017. We searched the Web of Science websites for publications from 1 January 1988 to 31 December 2017. We included publications of fluoxetine, paroxetine, citalopram, sertraline, amitriptyline, fluvoxamine, escitalopram, venlafaxine, duloxetine, milnacipran, desvenlafaxine, levomilnacipran, clomipramine, nortriptyline, bupropion, trazodone, nefazodone, mirtazapine, agomelatine, vortioxetine, vilazodone, electroconvulsive therapy (ECT), repetitive transcranial magnetic stimulation (rTMS), vagus nerve stimulation (VNS), deep brain stimulation (DBS), and transcranial direct current stimulation (tDCS). We excluded grey literature, conference proceedings, books/book chapters, and publications with low quality as well as publications not related to medicine or human health. The primary outcomes assessed were indices of change, expectations, and popularity. RESULTS: Of 489,496 publications identified, we included 355,116 publications in this scientometric analysis. For the index of change, fluoxetine, sertraline and ECT demonstrated a positive index of change in 6 consecutive periods. Other neurostimulation therapies including rTMS, VNS, DBS and tDCS had shown a positive index of change since 1998. We calculated the index of change of popularity index (PI), which indicates that from 2013 to 2017, the number of publications on tricyclic antidepressants (TCAs) and monoamine oxidase inhibitors (MAOIs) were reduced by 85.0% and 81.3% respectively, as compared with the period 2008-2012. For the index of expectation, fluoxetine and ECT showed the highest index of expectations in six consecutive periods and remained the highest in 2013-2017. For popularity, the three antidepressants with highest PI were fluoxetine (4.01), paroxetine (2.09), and sertraline (1.66); the three antidepressants with lowest PI were desvenlafaxine (0.08), vilazodone (0.04) and levomilnacipran (0.03). Among neurostimulation therapies, ECT has the highest PI (2.55), and tDCS the lowest PI (0.14). The PI of SSRI remained the highest among all biological treatments of MDD in 2013-2017. In contrast, the PI of ECT was reduced by approximately 50% during the period 2008 to2012 than that in the period 2013 to 2017. CONCLUSIONS: This scientometric analysis represents comprehensive evidence on the popularity and change in prospects of biological treatments for MDD from 1988 to 2017. The popularity of SSRI peaked between 1998 and 2002, when their efficacy, tolerability and safety profile allowed them to replace the TCAs and MAOIs. While the newer neurostimulation therapies are gaining momentum, the popularity of ECT has sustained.

Reporting preclinical anesthesia study (REPEAT): Evaluating the quality of reporting in the preclinical anesthesiology literature.

Poor reporting quality may contribute to irreproducibility of results and failed 'bench-to-bedside' translation. Consequently, guidelines have been developed to improve the complete and transparent reporting of in vivo preclinical studies. To examine the impact of such guidelines on core methodological and analytical reporting items in the preclinical anesthesiology literature, we sampled a cohort of studies. Preclinical in vivo studies published in Anesthesiology, Anesthesia & Analgesia, Anaesthesia, and the British Journal of Anaesthesia (2008-2009, 2014-2016) were identified. Data was extracted independently and in duplicate. Reporting completeness was assessed using the National Institutes of Health Principles and Guidelines for Reporting Preclinical Research. Risk ratios were used for comparative analyses. Of 7615 screened articles, 604 met our inclusion criteria and included experiments reporting on 52 490 animals. The most common topic of investigation was pain and analgesia (30%), rodents were most frequently used (77%), and studies were most commonly conducted in the United States (36%). Use of preclinical reporting guidelines was listed in 10% of applicable articles. A minority of studies fully reported on replicates (0.3%), randomization (10%), blinding (12%), sample-size estimation (3%), and inclusion/exclusion criteria (5%). Statistics were well reported (81%). Comparative analysis demonstrated few differences in reporting rigor between journals, including those that endorsed reporting guidelines. Principal items of study design were infrequently reported, with few differences between journals. Methods to improve implementation and adherence to community-based reporting guidelines may be necessary to increase transparent and consistent reporting in the preclinical anesthesiology literature.

Local Conduction Velocity in the Presence of Late Gadolinium Enhancement and Myocardial Wall Thinning: A Cardiac Magnetic Resonance Study in a Swine Model of Healed Left Ventricular Infarction.

BACKGROUND: Conduction velocity (CV) is an important property that contributes to the arrhythmogenicity of the tissue substrate. The aim of this study was to investigate the association between local CV versus late gadolinium enhancement (LGE) and myocardial wall thickness in a swine model of healed left ventricular infarction. METHODS: Six swine with healed myocardial infarction underwent cardiovascular magnetic resonance imaging and electroanatomic mapping. Two healthy controls (one treated with amiodarone and one unmedicated) underwent electroanatomic mapping with identical protocols to establish the baseline CV. CV was estimated using a triangulation technique. LGE+ regions were defined as signal intensity >2 SD than the mean of remote regions, wall thinning+ as those with wall thickness <2 SD than the mean of remote regions. LGE heterogeneity was defined as SD of LGE in the local neighborhood of 5 mm and wall thickness gradient as SD within 5 mm. Cardiovascular magnetic resonance and electroanatomic mapping data were registered, and hierarchical modeling was performed to estimate the mean difference of CV (LGE+/-, wall thinning+/-), or the change of the mean of CV per unit change (LGE heterogeneity, wall thickness gradient). RESULTS: Significantly slower CV was observed in LGE+ (0.33±0.25 versus 0.54±0.36 m/s; P<0.001) and wall thinning+ regions (0.38±0.28 versus 0.55±0.37 m/s; P<0.001). Areas with greater LGE heterogeneity ( P<0.001) and wall thickness gradient ( P<0.001) exhibited slower CV. CONCLUSIONS: Slower CV is observed in the presence of LGE, myocardial wall thinning, high LGE heterogeneity, and a high wall thickness gradient. Cardiovascular magnetic resonance may offer a valuable imaging surrogate for estimating CV, which may support noninvasive identification of the arrhythmogenic substrate.

The earliest human occupation of the high-altitude Tibetan Plateau 40 thousand to 30 thousand years ago.

The Tibetan Plateau is the highest and one of the most demanding environments ever inhabited by humans. We investigated the timing and mechanisms of its initial colonization at the Nwya Devu site, located nearly 4600 meters above sea level. This site, dating from 40,000 to 30,000 years ago, is the highest Paleolithic archaeological site yet identified globally. Nwya Devu has yielded an abundant blade tool assemblage, indicating hitherto-unknown capacities for the survival of modern humans who camped in this environment. This site deepens the history of the peopling of the "roof of the world" and the antiquity of human high-altitude occupations more generally.

The adaptive regulation of thiamine pyrophosphokinase-1 facilitates malignant growth during supplemental thiamine conditions.

Supplemental levels of vitamin B1 (thiamine) have been implicated in tumor progression. Tumor cells adaptively up-regulate thiamine transport during hypoxic stress. Upon uptake, thiamine pyrophosphokinase-1 (TPK1) facilitates the rapid phosphorylation of thiamine into thiamine pyrophosphate (TPP). However, the regulation of TPK1 during hypoxic stress is undefined. Understanding how thiamine homeostasis changes during hypoxia will provide critical insight into the malignant advantage supplemental thiamine may provide cancer cells. Using Western blot analysis and RT-PCR, we have demonstrated the post-transcriptional up-regulation of TPK1 in cancer cells following hypoxic exposure. TPK1 expression was also adaptively up-regulated following alterations of redox status by chemotherapeutic and antioxidant treatments. Although TPK1 was functionally up-regulated by hypoxia, HPLC analysis revealed a reduction in intracellular TPP levels. This loss was reversed by treatment with cell-permeable antioxidants and corresponded with reduced ROS production and enhanced cellular proliferation during supplemental thiamine conditions. siRNA-mediated knockdown of TPK1 directly enhanced basal ROS levels and reduced tumor cell proliferation. These findings suggest that the adaptive regulation of TPK1 may be an essential component in the cellular response to oxidative stress, and that during supplemental thiamine conditions its expression may be exploited by tumor cells for a redox advantage contributing to tumor progression.

Effect of inulin-type fructans on blood lipid profile and glucose level: a systematic review and meta-analysis of randomized controlled trials.

BACKGROUND/OBJECTIVES: This systematic review and meta-analysis was performed to assess the effects of inulin-type fructans (ITF) on human blood lipids and glucose homeostasis associated with metabolic abnormalities, including dyslipidemia, overweight or obesity, and type-2 diabetes mellitus (T2DM). SUBJECTS/METHODS: The MEDLINE, EMBASE and Cochrane Library databases were systematically searched for randomized controlled trials (RCTs) before January 2016. Human trials that investigated the effects of ITF supplementation on the lipid profile, fasting glucose and insulin were included using Review Manager 5.3. RESULTS: Twenty RCTs with 607 adult participants were included in this systematic review and meta-analysis. In the overall analysis, the supplementation of ITF reduced only the low density lipoprotein-cholesterol (LDL-c) (mean difference (MD): -0.15; 95% confidence interval (CI): -0.29, -0.02; P=0.03) without affecting the other endpoints. Within the T2DM subgroup analysis, ITF supplementation was positively associated with a decreased fasting insulin concentration (MD: -4.01; 95% CI: -5.92, -2.09; P<0.0001) and increased high density lipoprotein-cholesterol (HDL-c) (MD: 0.07; 95% CI: 0, 0.14; P=0.05). Moreover, a reduced fasting glucose tendency was identified only in the T2DM subgroup (MD: -0.42; 95% CI: -0.90, 0.06; P=0.09). There was a potential publication bias, and few trials were available for the T2DM subgroup analysis. CONCLUSIONS: In summary, the use of ITF may have benefits for LDL-c reduction across all study populations, whereas HDL-c improvement and glucose control were demonstrated only in the T2DM subgroup. Thus, additional, well-powered, long-term, randomized clinical trials are required for a definitive conclusion. Overall, ITF supplementation may provide a novel direction for improving the lipid profile and glucose metabolism.

The effects of customised brainwave music on orofacial pain induced by orthodontic tooth movement.

OBJECTIVES: To evaluate the effects of listening to brainwave music (BWM), which is composed by individual electroencephalogram (EEG) signals, in relieving orthodontic pain, compared to cognitive behavioural therapy (CBT), an established psychotherapy in pain management. METHODS: Thirty-six participants matched for age, gender and anxiety/pain levels were randomly assigned to the BWM group (n = 12), the CBT group (n = 12) or the control group (n = 12). Baseline resting EEG data were fabricated into BWM for the BWM group. EEG signals and pain perception [assessed by visual analogue scale (VAS)] of participants were recorded for the first week after orthodontic appliances placement. EEG data were analysed by multiple approaches. RESULTS: Brainwave music and CBT groups presented significantly lower pain perception than the control group on days 1-4. According to EEG analysis outcomes, the BWM group showed improved functional connectivity among different brain regions, lower EEG complexity and enhanced power in theta and alpha bands, compared to CBT and control groups, especially on day 2. Differences were clustered in the prefrontal, frontal, parietal and occipital regions, whilst the EEG parameters had negligible linear association with VAS scores. CONCLUSIONS: Brainwave music is effective in controlling orthodontic pain, possibly via restoring functional connectivity and brain regularity influenced by pain.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Artemisinin for treatment of uncomplicated falciparum malaria: is there a place for monotherapy?

The efficacy of artemisinin monotherapy was studied in 227 patients with uncomplicated falciparum malaria. They all received artemisinin at t = 0 hr, t = 8 hr, and thereafter once daily; treatment was extended at random until they had taken either 5 days of artemisinin followed by 2 days of placebo (A5), or 7 days (A7) of artemisinin. The adult artemisinin dose was 500 mg; children aged < 15 years received 10 mg/kg per dose. The median (range) parasite clearance time was 39 (8-112) hr for A5 and 43 (38-104) hr for A7 (P = 0.085). The recrudescence rates were similar between the groups. The lowest parasite count achieved during treatment (Pterm) was associated with the occurrence of recrudescence (P = 0.046, Cox regression model); it was lower for patients with a radical cure or late recrudescence than for early recrudescence (P = 0.034, t-test). Artemisinin monotherapy may offer rapid recovery and fast parasite clearance, but recrudescence is frequent. Extending the duration of monotherapy from 5 days to 7 days does not reduce recrudescence.

[Therapeutic effect of Chinese medicinal herbs combined with chemotherapy on advanced non-small cell lung cancer].

OBJECTIVE: To observe the effect of Chinese medicinal herbs (CMH) and chemotherapy on non-small cell lung cancer. METHODS: Comparing the therapeutic effects of three treatment regimens on 58 advanced non-small cell lung cancer (NSCLC) patients who were treated with CMH plus chemotherapy (CT), 28 cases treated with CT only, and 24 cases treated with CMH alone. RESULTS: Effective rates (partial remission + complete remission) were 22.9% in CMH + CT group, 13.6% both in CT and in CMH group. There were no significant differences between these three groups according to the short-term results (P > 0.05). Mean survival time (month) for CMH + CT, CT and CMH groups were 10.2, 5.3 and 8.0 respectively. The survival rate (Kaplan Meicr method) of both CMH + CT and CMH group were significantly higher than that of CT group (P < 0.01, P < 0.05) but no significant difference between CMH and CMH + CT group (P > 0.05). CONCLUSION: Chinese medicinal herbs were helpful to improve median survival time and survival rate of patients with advanced NSCLC.

1H-magnetic resonance spectroscopy of the left temporal and frontal lobes in schizophrenia: clinical, neurodevelopmental, and cognitive correlates.

Twenty eight schizophrenic patients and 20 normal volunteers underwent proton magnetic resonance spectroscopy (MRS) on the left temporal and frontal lobe regions. Male patients showed a significant reduction in frontal but not temporal n-acetylaspartate (an intraneuronally distributed metabolite) in comparison with either male controls or female patients; frontal choline was raised in male patients relative to these groups. Putative neurodevelopmental indices, including obstetric complications, family history of schizophrenia, and minor physical anomalies, proved unrelated to MRS resonances. However, multiple aspects of memory function in patients were related to temporal but not frontal creatine, a pattern that was not apparent among controls. These MRS findings complement some previous structural MRI studies and much clinical and epidemiological evidence of important gender differences in schizophrenia. The findings also suggest that memory dysfunction in patients with schizophrenia may be associated with a particular pattern of temporal lobe metabolism on MRS.

Marker rhythmometry with macrophage-colony stimulating factor (M-CSF).

In a patient with a debulked müllerian adenocarcinoma involving the ovary, an elevated serum concentration of macrophage-colony stimulating factor (M-CSF) (5.3 ng/ml) was lowered into the range of the age- and gender-matched controls by a 24-hour infusion of 135 mg/m2 of taxol, as was a Ca125 of 1480 U/ml by three such taxol courses given at 3-week intervals (to 14 U/ml). A downward trend of M-CSF in serum with an about-14-hour ultradian modulation during the first chemotherapy course resembles that of the concomitantly assessed Ca125. A decreasing trend modulated by an about-half-weekly component is found in M-CSF of fractionated urines collected at spontaneous voidings around the clock for 5 days. M-CSF may serve as a chronobiologic marker for optimizing, on an individualized basis, 1) the infradian scheduling of chemotherapy courses and 2) the ultradian-circadian within-course time patterns. Timing based on markers of the anticancer effect aims at teh as-yet unattained transfer from rodent to human of cancer cures that were not previously feasible without chronobiologic considerations. This goal can be pursued with M-CSF as well as Ca125 and UGP as possibly complementary chronobiologic markers in a chronotherapy trial with taxol in humans.