RESUMO
Nine compounds, including two undescribed withanolides, withasomniferolides A and B (1 and 2), three known withanolides (3-5), a ferulic acid dimeric ester (6), and an inseparable mixture of three long alkyl chain ferulic acid esters (7-9), were isolated from a GABAA receptor positive activator methanol extract of the roots of Withania somnifera. The structures of the isolated compounds were elucidated based on NMR, MS, and ECD data analysis. In order to bioassay the single ferulic acid derivatives, compounds 6-9 were also synthesized. The most active compound, docosanyl ferulate (9), was able to enhance the GABAA receptor inhibitory postsynaptic currents with an IC50 value of 7.9 µM. These results, by showing an ability to modulate the GABAA receptor function, cast fresh light on the biological activities of the secondary metabolites of W. somnifera roots.
Assuntos
Ácidos Cumáricos/farmacologia , Moduladores GABAérgicos/farmacologia , Receptores de GABA-A/efeitos dos fármacos , Withania/química , Vitanolídeos/farmacologia , Animais , Ácidos Cumáricos/síntese química , Ésteres/síntese química , Ésteres/farmacologia , Moduladores GABAérgicos/síntese química , Técnicas In Vitro , Potenciais Pós-Sinápticos Inibidores/efeitos dos fármacos , Espectroscopia de Ressonância Magnética , Masculino , Estrutura Molecular , Extratos Vegetais/química , Raízes de Plantas/química , Ratos , Ratos Sprague-Dawley , Vitanolídeos/síntese química , XenopusRESUMO
In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10â¢C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.
Assuntos
Quadruplex G , Modelos Moleculares , Conformação de Ácido Nucleico , Proteínas Proto-Oncogênicas c-kit/química , Adenina/química , Compostos de Amônio/química , Fenômenos Biofísicos , Humanos , Íons/química , Cinética , Regiões Promotoras Genéticas , Proto-Oncogene Mas , Sódio/química , Termodinâmica , Timina/químicaRESUMO
It is well known that G-quadruplexes are targets of great interest for their roles in crucial biological processes, such as aging and cancer. Hence, a promising strategy for anticancer drug therapy is the stabilization of these structures by small molecules. We report a high-throughput inâ silico screening of commercial libraries from several different vendors by means of a combined structure-based pharmacophore model approach followed by docking simulations. The compounds selected by the virtual screening procedure were then tested for their ability to interact with human telomeric G-quadruplex folding by circular dichroism, fluorescence spectroscopy, and fluorescence intercalator displacement. Our approach resulted in the identification of a 13-[(dimethylamino)methyl]-12-hydroxy-8H-benzo[c]indolo[3,2,1-ij][1,5]naphthyridin-8-one derivative as a novel promising stabilizer of G-quadruplex structures within the human telomeric and the c-myc promoter sequences.
Assuntos
Avaliação Pré-Clínica de Medicamentos , Quadruplex G/efeitos dos fármacos , Genes myc/efeitos dos fármacos , Simulação de Acoplamento Molecular , Regiões Promotoras Genéticas/efeitos dos fármacos , HumanosRESUMO
The telomerase-telomere complex is a prospective anticancer target. To inhibit enzyme activity by induction of G-quadruplex in human telomeres, we have synthesized a small library of 2,6- and 2,7-amino-acyl/ peptidyl anthraquinones with diverse connecting linkers, charge, lipophilicity and bulk. The test compounds modulated G-quadruplex stability to different extents and showed clear preference for quadruplex over duplex DNA. Telomerase inhibition correlated with G-quadruplex stabilization. A SAR analysis showed that type of linkage between the linker and the anthraquinone, together with the position of the side chains and the nature of the amino acid components play a major role both in stabilizing G-quadruplex and producing telomerase inhibition. Short-term cytotoxic activity was poor. However, after prolonged exposure to effective G-quadruplex binders, cells became senescent. These results are of help in the rational design of more efficient G-quadruplex stabilizers, possibly endowed with cancer cell-selective antiproliferative effects.