Effect of resveratrol on herpesvirus encephalitis: Evidences for its mechanisms of action.

BACKGROUND: Herpes simplex virus type 1 (HSV-1)-induced herpes simplex encephalitis (HSE) has a high mortality rate in clinically immunocompromised patients, while recovered patients often experience neurological sequelae due to neuroinflammation. Nucleoside drugs and nucleoside analogues such as acyclovir and ganciclovir are mainly used in clinical treatment, and the emergence of resistant viral strains makes the development of new anti-herpesvirus encephalitis drugs urgent. Resveratrol is a multifunctional, plant-derived bioactive compound and its antiviral potential is attracting much attention. PURPOSE: This study aimed to investigate the anti-HSV-1 mechanism of resveratrol in microglial cells and in the HSE mouse model. METHODS: The antiviral effect of resveratrol on HSV-1 infection was investigated by plaque assay, virus titer, immunofluorescence, Western blot and time-of-addition assay. The influence of resveratrol on stimulator of interferon gene (STING)/Nuclear Factor kappa B (NF-κB) signaling pathway-mediated neuroinflammation was examined by Western blot, RT-qPCR and ELISA. The interaction between resveratrol and STING/heat shock protein 90 beta (HSP90ß) was evaluated by molecular modeling, co-immunoprecipitation, and drug affinity responsive target stability assay. The therapeutic effect of resveratrol on HSE was evaluated in the HSE mouse model by analyzing weight loss, neurodegenerative symptoms and histopathological scores. RESULTS: Resveratrol inhibited the early process of HSV-1 infection, and interfered with the STING/NF-κB signaling pathway to attenuate HSV-1-induced neuroinflammation and microglial M1 polarization, independent of its classical target Sirtuin1. Mechanistically, resveratrol completely bound to Glu515 and Lys491 of HSP90ß, thus disrupting the HSP90ß-STING interaction and promoting STING degradation. Resveratrol also significantly alleviated viral encephalitis and neuroinflammation caused by HSV-1 in the HSE mouse model. CONCLUSION: Resveratrol acted as a non-classical HSP90ß inhibitor, binding to the STING-HSP90ß interaction site to promote STING degradation and attenuate HSV-1-induced encephalitis and neuroinflammation. These findings suggest the alternative strategy of targeting HSP90ß and resveratrol-mediated inhibition of HSP90ß as a potential antiviral approach.

Effect of Zusanli Acupoint Injection with Anisodamine on Postoperative Recovery Quality of Patients Undergoing Bariatric Surgery.

PURPOSE: To evaluate the influence of anisodamine injection at the Zusanli (ST36) on early postoperative recovery quality in patients who have undergone laparoscopic sleeve gastrectomy. MATERIALS AND METHODS: 141 patients undergoing laparoscopic sleeve gastrectomy were randomly divided into the control group (group C), the normal saline group (group S) and the anisodamine group (group A). Acupuncture point injections were administered after induction of general anesthesia. The quality of recovery-40 questionnaire (QoR-40) scores were documented preoperatively (D0) and on the 1st (D1), 3rd (D3) and 7th (D7) days postoperatively. Additional metrics included: the numerical rating scale (NRS) for pain, postoperative nausea and vomiting (PONV), assessment and analgesic consumption 24-h post-extubation and the initial postoperative times for ambulation and anal exhaust. Substance P (SP), ß-endorphin (ß-EP), motilin (MTL) and gastrin (GAS) were quantified at 24-h post-surgery. RESULTS: Compared with group C, group A demonstrated an elevation in QoR-40 scores and physical comfort dimensions during D1-3, and an increased pain scores during D1-7; group S exhibited an augmentation in QoR-40 scores and pain scores on D1 (p < 0.05). Compared with group S, group A improved QoR-40 scores on D1 and pain scores during D1-3 (p < 0.05). SP, ß-EP, MTL and GAS presented significant variances among the groups 24-h post-surgery (p < 0.05). There were significant differences between the groups in NRS pain scores and PONV scores at 24-h postoperatively, dosage of dizocin on the first postoperative day, and time to first anal defecation (p < 0.05). CONCLUSION: The administration of anisodamine via ST36 acupoint injections has been demonstrated to facilitate the recuperation of gastrointestinal functionality, to alleviate postoperative pain and nausea, and substantially to enhance the quality of early postoperative recovery.

Risedronate-functionalized manganese-hydroxyapatite amorphous particles: A potent adjuvant for subunit vaccines and cancer immunotherapy.

The cGAS-STING pathway and the Mevalonate Pathway are druggable targets for vaccine adjuvant discovery. Manganese (Mn) and bisphosphonates are known to exert adjuvant effects by targeting these two pathways, respectively. This study found the synergistic potential of the two pathways in enhancing immune response. Risedronate (Ris) significantly amplified the Mn adjuvant early antibody response by 166-fold and fortified its cellular immunity. However, direct combination of Mn2+ and Ris resulted in increased adjuvant toxicity (40% mouse mortality). By the combination of doping property of hydroxyapatite (HA) and its high affinity for Ris, we designed Ris-functionalized Mn-HA micro-nanoparticles as an organic-inorganic hybrid adjuvant, named MnHARis. MnHARis alleviated adjuvant toxicity (100% vs. 60% survival rate) and exhibited good long-term stability. When formulated with the varicella-zoster virus glycoprotein E (gE) antigen, MnHARis triggered a 274.3-fold increase in IgG titers and a 61.3-fold surge in neutralization titers while maintaining a better long-term humoral immunity compared to the aluminum adjuvant. Its efficacy spanned other antigens, including ovalbumin, HPV18 VLP, and SARS-CoV-2 spike protein. Notably, the cellular immunity elicited by the group of gE + MnHARis was comparable to the renowned Shingrix®. Moreover, intratumoral co-administration with an anti-trophoblast cell surface antigen 2 nanobody revealed synergistic antitumor capabilities. These findings underscore the potential of MnHARis as a potent adjuvant for augmenting vaccine immune responses and improving cancer immunotherapy outcomes.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Activity-guided isolation and identification of antiherpesvirus and antineuroinflammatory active terpenoids from Artemisia vulgaris L. based on the LC-MS/MS molecular network.

Seven undescribed terpenoids, comprising two guaiane-type sesquiterpene lactones (1-2), one eucalyptol-type sesquiterpene (3), one monolactone (4), and three triterpenoids (5-7), along with 35 known analogues, were isolated from the leaves of Artemisia vulgaris L. Their structures and configurations were analysed by extensive spectroscopy. Compounds 1, 2, 8-10, 13, 17, 19, and 28 showed antineuroinflammatory activity, and compounds 1 and 2 revealed remarkable antineuroinflammatory effects, with an IC50 value of 2.2 ± 0.1 and 1.6 ± 0.1 µM, more potent than the positive control drug dexamethasone. Furthermore, compounds 1 and 2 could inhibit the expression of BV-2 inflammatory genes (IL-6, TNF-α, IL-1ß) induced by LPS, downregulate the critical inflammatory protein production of iNOS and COX-2. The anti-HSV-1 activity screening revealed that compounds 28, 29 and 38 exhibited inhibitory activity against HSV-1 proliferation. Particularly, compound 28 exhibited a significant anti-HSV-1 effect, inhibiting the proliferation of HSV-1 and acyclovir-resistant strains of HSV-1/153 and HSV-1/Blue. Our research identified compounds 1, 2, and 28 from A. vulgaris., which could potentially serve as lead compounds for antineuroinflammatory and anti-HSV-1 activities.

Prognostic value of pre-therapeutic nutritional risk factors in elderly patients with locally advanced esophageal squamous cell carcinoma receiving definitive chemoradiotherapy or radiotherapy.

BACKGROUND: The nutritional status of cancer patients is a crucial factor in determining their prognosis. The objective of this study was to investigate and compare the prognostic value of pretreatment nutrition-related indicators in elderly esophageal squamous cell carcinoma (ESCC). Risk stratification was performed according to independent risk factors and a new nutritional prognostic index was constructed. METHODS: We retrospectively reviewed 460 older locally advanced ESCC patients receiving definitive chemoradiotherapy (dCRT) or radiotherapy (dRT). This study included five pre- therapeutic nutrition-related indicators. The optimal cut-off values for these indices were calculated from the Receiver Operating Curve (ROC). Univariate and multivariate COX analyses were employed to determine the association between each indicator and clinical outcomes. The predictive ability of each independently nutrition-related prognostic indicator was assessed using the time-dependent ROC (time-ROC) and C-index. RESULTS: Multivariate analyses indicated that the geriatric nutrition risk index (GNRI), body mass index (BMI), the controlling nutritional status (CONUT) score, and platelet-albumin ratio (PAR) could independently predict overall survival (OS) and progression-free survival (PFS) in elderly patients with ESCC (all p < 0.05), except for prognostic nutritional index (PNI). Based on four independently nutrition-related prognostic indicators, we developed pre-therapeutic nutritional prognostic score (PTNPS) and new nutritional prognostic index (NNPI). No-risk (PTNPS = 0-1 point), moderate-risk (PTNPS = 2 points), and high-risk (PTNPS = 3-4 points) groups had 5-year OS rates of 42.3%, 22.9%, and 8.8%, respectively (p < 0.001), and 5-year PFS rates of 44.4%, 26.5%, and 11.3%, respectively (p < 0.001). The Kaplan-Meier curves showed that the mortality of elderly ESCC patients in the high-risk group was higher than that in the low-risk group according to the NNPI. Analysis of time-AUC and C-index revealed that the NNPI (C-index: 0.663) had the greatest predictive power on the prognosis in older ESCC patients. CONCLUSIONS: In elderly ESCC patients, the GNRI, BMI, CONUT score, and PAR can be used as objective assessment measures for the risk of nutrition-related death. Compared to the other four indexes, the NNPI has the greatest prognostic value for prognosis, and elderly patients with a higher nutritional risk have a poor prognosis, which is helpful in guiding early clinical nutrition intervention.

Moisturizing and Antioxidant Effects of Artemisia argyi Essence Liquid in HaCaT Keratinocytes.

Artemisia argyi essence liquid (AL) is an aqueous solution extracted from A. argyi using CO2 supercritical fluid extraction. There have been few investigations on the aqueous solution of A. argyi extracted via CO2 supercritical fluid extraction. This study aimed to explore the moisturizing and antioxidant effects of AL and to clarify the potential mechanism underlying those effects. Expression levels of skin moisture-related components and the H2O2-induced oxidative stress responses in human keratinocyte cells were measured via quantitative RT-qPCR, Western blot, and immunofluorescence. Our results showed that AL enhanced the expression of AQP3 and HAS2 by activating the EGFR-mediated STAT3 and MAPK signaling pathways. In addition, AL can play an antioxidant role by inhibiting the NF-κB signaling pathway and activating the Nrf2/HO-1 signaling pathway, consequently increasing the expression of antioxidant enzymes (GPX1, SOD2) and decreasing the production of reactive oxygen species (ROS). This study revealed that AL could be used as a potential moisturizing and antioxidant cosmetic ingredient.

Macrophage-Targeted Berberine-Loaded ß-Glucan Nanoparticles Enhance the Treatment of Ulcerative Colitis.

Aim: This study focuses on constructing of an anti-inflammatory drug delivery system by encapsulation of berberine in the ß-glucan nanoparticles and evaluates its effect on treating ulcerative colitis. Methods: ß-Glucan and the anti-inflammatory drug berberine (BER) are self-assembled into nanoparticles to construct a drug delivery system (GLC/BER). The interaction between the drug and the carrier was characterized by circular dichroism, ultraviolet-visible spectroscopy, and dynamic light scattering. The anti-inflammatory effect of the GLC/BER was evaluated through a lipopolysaccharide (LPS)-induced RAW264.7 macrophage inflammation model and a sodium sulfate (DSS)-induced C57BL/6 mouse ulcerative colitis model. Results: The GLC/BER nanoparticles have a particle size of 80-120 nm and a high encapsulation efficiency of 37.8±4.21%. In the LPS-induced RAW264.7 macrophage inflammation model, GLC/BER significantly promoted the uptake of BER by RAW264.7 cells. RT-PCR and ELISA assay showed that it could significantly inhibit the inflammatory factors including IL-1ß, IL-6 and COX-2. Furthermore, GLC/BER shows inhibiting effect on the secretion of pro-inflammatory factors such as IL-1ß and IL-6, down-regulating the production of nitrite oxide; in animal studies, GLC/BER was found to exert a relieving effect on mice colitis. Conclusion: The study found that GLC/BER has an anti-inflammatory effect in vitro and in vivo, and the GLC carrier improves the potency and bioavailability of BER, providing a new type of nanomedicine for the treatment of colitis.

Suppression of Cucumber Green Mottle Mosaic Virus Infection by Boron Application: From the Perspective of Nutrient Elements and Carbohydrates.

Cucumber green mottle mosaic virus (CGMMV) infection causes "blood flesh" symptoms in watermelon fruits, which severely reduces yield and edibleness. However, the growth of watermelon fruits is strongly associated with boron (B), a trace element for improving fruit quality. In this study, B-gradient hydroponic experiments (B concentration: 0, 2.86, and 5.72 mg·L-1 H3BO3) and foliar-spray experiments (B concentration: 30 and 300 mg·L-1 H3BO3) were performed. We found that the B-supplement could inhibit CGMMV infection and especially relieve "blood flesh" symptoms in watermelon fruits. The nutrient element, soluble sugar, and cell wall polysaccharide contents and their metabolism- and transport-related gene expressions were determined in leaves and fruits of the watermelons in B-gradient hydroponic and foliar-spray experiments. We found that the accumulation and metabolism of nutrients and carbohydrates in cells were disrupted by CGMMV infection; however, the B-supplement could restore and maintain their homeostasis. Additionally, we uncovered that NIP5;1 and SWEET4, induced by B-application with CGMMV infection, could majorly contribute to the resistance to CGMMV infection by regulating nutrient elements and carbohydrate homeostasis. These results provided a novel insight into the molecular mechanism of B-mediated CGMMV suppression and an efficient method of B-application for the improvement of watermelon quality after CGMMV infection.

A Nutrition-Related Factor-Based Risk Stratification for Exploring the Clinical Benefits in the Treatment of Patients With Locally Advanced Esophageal Squamous Cell Carcinoma Receiving Definitive Chemoradiotherapy: A Retrospective Cohort Study.

Objective: No study has reported the risk stratification of BMI and PNI in patients with locally advanced esophageal squamous cell carcinoma (ESCC) undergoing definitive chemoradiotherapy (dCRT). This study aimed to construct a risk stratification to guide the treatment of ESCC following dCRT. Methods: A total of 1,068 patients with locally advanced ESCC who received dCRT were retrospectively analyzed. The impacts of clinicopathological factors on overall survival (OS) and progression-free survival (PFS) were analyzed. Besides, the novel prognostic indices of pre-therapeutic nutritional index (PTNI) and prognostic index (PI) were developed. Results: The median follow-up period of OS and PFS were 22.9 and 17.4 months, respectively. The high body mass index (BMI) group had better 5-year OS and PFS (36.4 and 34.0%) than the low BMI group (18.8 and 17.2%). The high prognostic nutritional index (PNI) group also had better 5-year OS and PFS (33.4 and 30.9%) than the low PNI group (17.5 and 17.2%). Multivariate Cox regression analysis showed that BMI and PNI were independent prognostic factors for OS and PFS. Based on nutritional indices, patients were categorized into the low-risk (PTNI = 1), medium-risk (PTNI = 2), and high-risk (PTNI = 3) groups with 5-year OS rates of 38.5, 18.9, 17.5%, respectively (p < 0.001) and 5-year PFS rates of 35.8, 17.6, 16.8%, respectively (p < 0.001). Besides, we also constructed a prognostic index (PI) for OS and PFS which was calculated based on statistically significant factors for predicting OS and PFS. The results revealed that the high-risk group had worse OS and PFS than the low-risk group (p < 0.001). Finally, RCS analysis demonstrated a non-linear relationship between the PNI, BMI, and survival for patients with ESCC. The death hazard of PNI and BMI sharply decreased to 41.8 and 19.7. Conclusion: The decreased pre-therapeutic BMI and PNI levels were associated with a worse survival outcome. BMI and PNI are readily available and can be used to stratify risk factors for locally advanced ESCC patients undergoing dCRT. The novel risk stratification may help to evaluate patients' pre-therapeutic status and guide dCRT for locally advanced ESCC patients.

Comparison of kinesiology tape and cryotherapy on postoperative reaction following third molar extraction: a randomized clinical trial.

OBJECTIVES: To evaluate the effect of kinesiology tape application after mandibular third molar extraction. METHOD AND MATERIALS: Patients with mandibular third molar extraction indications were divided into three groups. The patients in group 1 had kinesiology tape applied after tooth extraction, the patients in group 2 were given an ice pack and intermittent cryotherapy within 24 h of the operation, and the patients in group 3 were not given any additional intervention. All patients were followed up, and the postoperative swelling, pain, mouth opening limitation, and quality of life were recorded and evaluated. Comments on the intervention methods from patients were also collected. RESULTS: Compared to group 3, groups 1 and 2 showed a significant reduction in postoperative swelling, pain, and limitation of mouth opening, and improvement of quality of life. There was no significant difference between groups 1 and 2 in each index, but the patients in group 1 reported fewer problems than those in group 2. CONCLUSIONS: The application of kinesiology tape was helpful in reducing the postoperative inflammatory symptoms of mandibular third molar extraction and improved the patients' postoperative quality of life. These results suggest that kinesiology tape can be used as an auxiliary treatment to cryotherapy or as an alternative intervention after mandibular third molar extraction.

Transurethral plasmakinetic resection versus enucleation for benign prostatic hyperplasia: comparison of intraoperative safety profiles based on endoscopic surgical monitoring system.

OBJECTIVE: To compare the intraoperative safety profiles of transurethral plasmakinetic resection of the prostate (PK-TURP) with transurethral plasmakinetic endoscopic enucleation of the prostate (PK-EEP) in the treatment of benign prostatic hyperplasia (BPH) based on endoscopic surgical monitoring system (ESMS). METHODS: A total of 128 patients who were diagnosed with BPH were stratified based on prostate volume (PV) and accepted PK-EEP or PK-TURP treatment at 1:1 ratio. The ESMS as a novel method was used to monitor blood loss and fluid absorption during the operation. Clinical parameters such as intraoperative blood loss volume, fluid absorption volume, operation time, tissue weight of resection, preoperative and postoperative red blood cell count (RBC), hemoglobin concentration (HB), hematocrit (HCT), electrolyte, postoperative bladder irrigation time, indwelling catheter time, hospital stay time and other associated complications were documented and compared between two groups. RESULTS: No significant differences in majority of baseline characteristics were observed among patients with different prostate volumes between two surgical methods. For patients with prostate volume < 40 ml, the average operation time of patients who received PK-EEP treatment was much more than those who received PK-TURP (P = 0.003). On the other hand, for patients with prostate volume > 40 ml, the PK-TURP surgery was associated with a significant increase in intraoperative blood loss (P = 0.021, in PV 40-80 ml group; P = 0.014, in PV > 80 ml group), fluid absorption (P = 0.011, in PV 40-80 ml group; P = 0.006, in PV > 80 ml group) and postoperative bladder irrigation time as well as indwelling catheter time but decrease in resected tissue weight compared to the PK-EEP treatment. CONCLUSION: The ESMS plays an important role in comparison of intraoperative safety profiles between PK-TURP and PK-EEP. Our data suggest that PK-TURP treatment is associated with a decreased operation time in patients with prostate volume < 40 ml and the PK-EEP treatment is associated with decreased intraoperative blood loss, fluid absorption and increased tissue resection for patients with prostate volume > 40 ml. Our results indicate that the size of prostate should be considered when choosing the right operation method.

Clinical practice guideline for transurethral plasmakinetic resection of prostate for benign prostatic hyperplasia (2021 Edition).

Benign prostatic hyperplasia (BPH) is highly prevalent among older men, impacting on their quality of life, sexual function, and genitourinary health, and has become an important global burden of disease. Transurethral plasmakinetic resection of prostate (TUPKP) is one of the foremost surgical procedures for the treatment of BPH. It has become well established in clinical practice with good efficacy and safety. In 2018, we issued the guideline "2018 Standard Edition". However much new direct evidence has now emerged and this may change some of previous recommendations. The time is ripe to develop new evidence-based guidelines, so we formed a working group of clinical experts and methodologists. The steering group members posed 31 questions relevant to the management of TUPKP for BPH covering the following areas: questions relevant to the perioperative period (preoperative, intraoperative, and postoperative) of TUPKP in the treatment of BPH, postoperative complications and the level of surgeons' surgical skill. We searched the literature for direct evidence on the management of TUPKP for BPH, and assessed its certainty generated recommendations using the grade criteria by the European Association of Urology. Recommendations were either strong or weak, or in the form of an ungraded consensus-based statement. Finally, we issued 36 statements. Among them, 23 carried strong recommendations, and 13 carried weak recommendations for the stated procedure. They covered questions relevant to the aforementioned three areas. The preoperative period for TUPKP in the treatment of BPH included indications and contraindications for TUPKP, precautions for preoperative preparation in patients with renal impairment and urinary tract infection due to urinary retention, and preoperative prophylactic use of antibiotics. Questions relevant to the intraoperative period incorporated surgical operation techniques and prevention and management of bladder explosion. The application to different populations incorporating the efficacy and safety of TUPKP in the treatment of normal volume (< 80 ml) and large-volume (≥ 80 ml) BPH compared with transurethral urethral resection prostate, transurethral plasmakinetic enucleation of prostate and open prostatectomy; the efficacy and safety of TUPKP in high-risk populations and among people taking anticoagulant (antithrombotic) drugs. Questions relevant to the postoperative period incorporated the time and speed of flushing, the time indwelling catheters are needed, principles of postoperative therapeutic use of antibiotics, follow-up time and follow-up content. Questions related to complications incorporated types of complications and their incidence, postoperative leukocyturia, the treatment measures for the perforation and extravasation of the capsule, transurethral resection syndrome, postoperative bleeding, urinary catheter blockage, bladder spasm, overactive bladder, urinary incontinence, urethral stricture, rectal injury during surgery, postoperative erectile dysfunction and retrograde ejaculation. Final questions were related to surgeons' skills when performing TUPKP for the treatment of BPH. We hope these recommendations can help support healthcare workers caring for patients having TUPKP for the treatment of BPH.

[Mechanism and experimental verification of "Polygoni Cuspidati Rhizoma et Radix-Ligustri Lucidi Fructus" combination in treatment of acute gouty arthritis based on network pharmacology].

Based on network pharmacology, the mechanism of Polygoni Cuspidati Rhizoma et Radix-Ligustri Lucidi Fructus(PL) combination against acute gouty arthritis(AGA) was explored and preliminarily verified by animal experiment. The chemical components and corresponding targets of PL were retrieved from Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform(TCMSP). The active components with oral bioavailability(OB)≥30% and drug-likeness(DL)≥0.18 were screened based on literature, and the related protein targets were collected. Then the protein targets were standardized with the help of UniProt database. The AGA-related targets were searched from GeneCards, NCBI, and DrugBank. The common targets of the disease and the medicinals were yielded by FunRich V3, and the protein-protein interaction(PPI) network was constructed to screen the key targets, followed by Gene Ontology(GO) term enrichment analysis and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis of the key targets. Afterwards, some of the key targets were verified by sodium urate crystal-induced AGA mouse model. A total of 25 active components and 287 targets of PL, 811 targets of AGA, and 88 common targets were screened out. PPI network analysis showed that tumor necrosis factor(TNF), interleukin-6(IL-6), and interleukin-1ß(IL-1ß) may be the core targets of PL in the treatment of AGA. The key targets were mainly involved in 566 GO terms(P<0.05), including multiple biological processes such as inflammatory response and immune response. Moreover, they were related to 116 KEGG pathways and these pathways were involved in inflammation and immunity, mainly including NOD-like receptor signaling pathway and TNF signaling pathway. Animal experiment confirmed that PL can alleviate ankle swelling, improve abnormal gait, and down-regulate the protein expression of TNF-α, IL-6, and IL-1ß in AGA mice, indicating that PL can treat AGA through TNF-α, IL-6, and IL-1ß and the feasibility of network pharmacology to predict drug targets. This study preliminarily discussed the key targets and biological signaling pathways involved in the treatment of AGA with PL combination, which reflected the multi-pathway and multi-target action characteristics of Chinese medicine. Moreover, this study laid a scientific basis for research on the treatment of AGA with PL combination, as well as the mechanism of action.

[Efficacy and safety of black tomato concentrate in the treatment of erectile dysfunction: A prospective randomized controlled open trial].

OBJECTIVE: To evaluate the efficacy and safety of black tomato concentrate (BTC), which is rich in polyphenols, in the treatment of ED. METHODS: We conducted a prospective randomized open clinical study of 150 ED patients from December 2018 to February 2020, and treated the them with placebo (n = 50), BTC (n = 50) and Compound Xuanju Capsules (CXC) (n = 50), respectively, all for 8 weeks. Before and at 4 and 8 weeks after treatment, we obtained the scores of the patients on IIEF-5, Erection Hardness Score (EHS), Sexual Encounter Profile (SEP-2,3) and General Assessment Questionnaire (GAQ-1,2), related biochemical indexes and the T level, followed by comparison among the three groups. RESULTS: Totally, 120 of the patients completed the clinical trial, 37 in the placebo, 43 in the BTC and 40 in the CXC group. There were no statistically significant differences among the placebo, BTC and CXC groups in the baseline scores on IIEF-5 (12.03 �� 3.50 vs 11.70 �� 3.80 vs 11.42 �� 3.82), EHS, and SEP-2,3 (P > 0.05). At 8 weeks after treatment, the patients in the BTC group showed significant improvement in IIEF-5 (15.67 �� 3.63), EHS, SEP-2,3 and GAQ-1 positive response compared with those in the placebo group (P < 0.05) and similar improvement to that in the CXC group in IIEF-5 (15.67 �� 3.63 vs 15.65 �� 3.87), EHS, SEP-2,3 and GAQ-1,2 (P > 0.05). No statistically significant differences were observed in the incidence of adverse reactions among the placebo, BTC and CXC groups (4.7% vs 2.7% vs 5.0%, P > 0.05), and the symptoms were significantly relieved in the BTC group after change of the administration time to after meal. CONCLUSION: Black tomato concentrate is comparable to Compound Xuanju Capsules and better than placebo (P < 0.05) in improving the IIEF-5, EHS and SEP-2,3 scores of ED patients. And, with a high safety, it can be used as an alternative treatment of ED.

Acupuncture versus Lornoxicam in the Treatment of Acute Renal Colic: A Randomized Controlled Trial.

OBJECTIVE: To compare the analgesic efficacy and safety of acupuncture and lornoxicam in acute renal colic (ARC). DESIGN SETTING PARTICIPANT: A randomized, double-blind, parallel-controlled, single-centered trial was conducted at Susong County People's Hospital from October 2019 to November 2020. Eighty-four patients with ARC were randomly divided into lornoxicam group (Group L) and acupuncture group (Group A). Group A was treated with acupuncture at Sanyinjiao (SP6), Yinlingquan (SP9) and normal saline, and Group L was treated with sham acupuncture at SP6, SP9 and lornoxicam. MAIN OUTCOME MEASURES: Visual analogue scale (VAS) scores and adverse reactions such as nausea and dizziness were recorded within 5, 10, 15, 20 and 40 minutes after treatment. The main outcome of this study was the short-term effective (STE) rate, the secondary outcome was the onset time, and the safety index was incidence of adverse reactions. RESULTS: A total of 80 patients completed this study, including 41 patients (21 males and 20 females) in Group L and 39 patients (21 males and 18 females) in Group A. Group A exhibited lower scores versus group L after treatment (P < 0.05). The overall STE of group L was 61.00% (25/41), significantly lower than group A [84.62% (33/39)] (P < 0.001). There was no difference in the incidence of adverse reactions between group A [2.6% (1/39)] and group L [7.3% (3/41)] (P = 0.616). The ordered logistic regression analysis showed patients receiving acupuncture therapy are more likely to be cured [OR = 2.887, 95% CI: (1.190, 7.000), P = 0.019]. CONCLUSION: Acupuncture at SP6, SP9 and intramuscular injection of lornoxicam can effectively and safely relieve ARC, but the former has faster and better analgesic effect. Moreover, the incidence of adverse reactions was similar between the two treatments. This acupuncture therapy is recommended as a complementary therapy for ARC.

[Clinical application value of the endoscopic surveillance system in transurethral bipolar plasmakinetic resection of the prostate].

OBJECTIVE: To evaluate the clinical application of the endoscopic surveillance system (ESS) in transurethral bipolar plasmakinetic resection of the prostate (TUPKRP). METHODS: We retrospectively analyzed 136 cases of TUPKRP performed with the assistance of ESS from September 2018 to March 2019. According to the prostate volume (PV), we divided the patients into a PV ≥ 60 ml and a PV < 60 ml group, and compared the surgery-related parameters between the two groups of patients. RESULTS: Operations were successfully completed in all the 136 cases. Statistically significant differences were observed between the PV ≥ 60 ml and a PV < 60 ml groups in the operation time (ï¼»78.93 ± 28.63ï¼½ vs ï¼»51.77 ± 14.85ï¼½ min, P < 0.05), intraoperative blood loss (ï¼»261.61 ± 204.25ï¼½ vs ï¼»69.26 ± 61.13ï¼½ ml, P < 0.05) and absorption of the rinse fluid (ï¼»948.20 ± 656.00ï¼½ vs ï¼»347.39 ± 256.53ï¼½ ml, P < 0.05), but not in the postoperative red cell count, levels of hemoglobin, hematocrit and ions, hospital stay, incidence of prostatic perforation or blood transfusion (P > 0.05). The patients also showed statistically significant differences between the baseline and postoperative parameters in red cell count (ï¼»4.62 ± 0.63ï¼½ vs ï¼»4.31 ± 0.74ï¼½ ×1012/L, P < 0.05) and levels of hemoglobin (ï¼»141.83 ± 18.30ï¼½ vs ï¼»135.20 ± 19.91ï¼½ g/L, P < 0.05), K+ (ï¼»4.01 ± 0.43ï¼½ vs ï¼»3.92 ± 0.54ï¼½ mmol/L, P < 0.05) and Na+ (ï¼»141.90 ± 3.11ï¼½ vs ï¼»139.42 ± 3.81ï¼½ mmol/L, P < 0.05), but not in the levels of Cl－ (ï¼»103.74 ± 9.32ï¼½ vs ï¼»103.70 ± 4.50ï¼½ mmol/L, P > 0.05) and Ca2+ (ï¼»2.21 ± 0.13ï¼½ vs ï¼»2.19 ± 0.21ï¼½ mmol/L, P > 0.05). CONCLUSIONS: Large-volume absorption of rinse fluid may overburden the circulatory system and induce left ventricular failure, pulmonary edema or massive bleeding during PKRP for patients with PV ≥ 60 ml due to long operation time and rich blood supply in the hyperplasia gland. The endoscopic surveillance system can provide real-time data on the absorption of rinse fluid and bleeding, reduce complications, and improve surgical safety.

Chinese Medicine Huzhen Tongfeng Formula Effectively Attenuates Gouty Arthritis by Inhibiting Arachidonic Acid Metabolism and Inflammatory Mediators.

The Chinese herbal medicine, Huzhen Tongfeng Formula (HZTF), derived from traditional Chinese medicine (TCM) practice, has recognized therapeutic benefits for gouty arthritis (GA). HZTF is currently in the late stage of approval process as a new anti-GA drug application. However, the underlying mechanism of HZTF as an antigout medication is unclear. In this study, we combined network pharmacology and experimental validation approaches to elucidate the mechanism of action of HZTF. First, the relative drug-disease target networks were constructed and analyzed for pathway enrichment. Potential pathways were then validated by in vitro and in vivo experiments. We found that 34 compounds from HZTF matched 181 potential drug targets. Topology analysis revealed 77 core targets of HZTF, which were highly related to gout, following screening of KEGG pathway enrichment. Further analysis demonstrated that the arachidonic acid metabolic pathway was the most relevant pathway involved in the mechanism of HZTF. Validation experiments showed that HZTF significantly inhibited the inflammatory cell infiltration into gouty joints, improved the swelling of affected joints, and increased the pain threshold. HZTF significantly reduced the transcription and production of various cytokines and inflammatory mediators in vitro. In particular, cyclooxygenase (COX)-1, COX-2, and 5-lipoxygenase were simultaneously downregulated. In conclusion, our study suggests that the antigout mechanism of HZTF is associated with the inhibition of the arachidonic acid pathway, resulting in the suppression of inflammatory cytokines and mediators. These findings extend our understanding of the pharmacological action of HZTF, rationalizing the application HZTF as an effective herbal therapy for GA.

Berberine-Loaded Nanostructured Lipid Carriers Enhance the Treatment of Ulcerative Colitis.

PURPOSE: Berberine (BBR), a major ingredient extracted from Coptis chinensis, is a natural drug with limited oral bioavailability. We developed nanostructured lipid carriers (NLCs) as a delivery system for enhanced anti-inflammatory activity of BBR against ulcerative colitis (UC). METHODS: BBR-loaded nanostructured lipid carriers (BBR-NLCs) prepared via high-pressure homogenization were evaluated for particle size, zeta potential, drug entrapment efficiency, drug loading, drug release, toxicity, and cellular uptake. The anti-UC activities of free and encapsulated BBR were evaluated in a DSS-induced acute model of UC in mice. RESULTS: Spherical BBR-NLCs were prepared with a particle size of 63.96± 0.31 nm, a zeta potential of +3.16 ± 0.05 mV, an entrapment efficiency of 101.97±6.34%, and a drug loading of 6.00±0.09%. BBR-NLCs showed excellent biocompatibility in vivo. Cellular uptake experiments showed that BBR-NLCs improved uptake of BBR by RAW 264.7 cells and Caco-2 cells. Oral administration of BBR-NLCs significantly alleviated colitis symptoms (DAI, colon length, spleen swelling, MPO activity) through inhibition of NF-κB nuclear translocation, decreased expression of pro-inflammatory cytokines (IL-1ß, IL-6, MMP-9, CX3CR1, COX-2, TERT), and increased expression of the tight junction protein ZO-1. CONCLUSION: BBR-loaded NLCs improved colitis symptoms, which suggested that this may be a novel formulation for treatment of UC.

Sanhuang Shu'ai decoction alleviates DSS-induced ulcerative colitis via regulation of gut microbiota, inflammatory mediators and cytokines.

BACKGROUND: Sanhuangshu'ai decoction (SH), a traditional Chinese medicine (TCM) prescription, has been safely used to treat diarrhea, dysentery and other inflammatory diseases with little side effect and low cost for thousands of years. However, its mechanism remains elusive. This study was designed to investigate the anti-ulcerative colitis (UC) activity of SH and mechanism by detecting its anti-inflammatory, anti-oxidative, and intervention effects of intestinal flora with the dextran sodium sulfate (DSS)-induced colitis mice. METHODS: The DSS-induced colitis mice was orally administered SH for 1 week with 0.8 or 1.6 g kg-1 d-1 dosage. A clinical disease activity score was evaluated daily. The colonic tissues of the mice were collected and prepared to detect its anti-inflammatory, anti-oxidative, intervention effects of intestinal flora and hydrogen peroxide(H2O2) in vivo, cytotoxicity and ROS influencing effects in vitro. Histological colitis severity and expression of cytokines were also determined. RESULTS: Oral administration of SH significantly prevented the development of colitis. It reduced the expression of interleukin (IL)-1, IL-6, and tumor necrosis factor (TNF)-α in the colon. Moreover, SH administration alleviated the oxidative stress in the colon of DSS-induced colitis mice, evidenced by the decrease of myeloperoxidase (MPO) activity and malondialdehyde (MDA) level, and increase of ROS level. Furthermore, SH can prevent the decrease ofLactobacillus sp. and population abundance of intestinal flora caused by DSS. CONCLUSION: SH significantly ameliorates the symptoms of DSS-induced colitis mice and the potential mechanism of SH may involve in multiple kinds of metabolic pathway including the regulation of gut microbiota, inflammatory mediators and cytokines.