First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Electroacupuncture for acute gouty arthritis: a systematic review and meta-analysis of randomized controlled trials.

Acute gouty arthritis (AGA) is a metabolic disorder in which recurrent pain episodes can severely affect the quality of life of gout sufferers. Electroacupuncture (EA) is a non-pharmacologic therapy. This systematic review aimed to assess the efficacy and safety of electroacupuncture in treating acute gouty arthritis. We searched eight Chinese and English databases from inception to July 30, 2023, and 242 studies were retrieved. Finally, 15 randomized controlled trials (n=1076) were included in a meta-analysis using Review Manager V.5.4.1. meta-analysis results included efficacy rate, visual rating scale (VAS) for pain, serum uric acid level (SUA), immediate analgesic effect, and incidence of adverse events. Electroacupuncture (or combined non-pharmacologic) treatment of AGA was significantly different from treatment with conventional medications (RR = 1.14, 95% confidence interval CI = 1.10 to 1.19, P < 0.00001). The analgesic effect of the electroacupuncture group was superior to that of conventional Western drug treatment (MD = -2.26, 95% CI = -2.71 to -1.81, P < 0.00001). The electroacupuncture group was better at lowering serum uric acid than the conventional western drug group (MD =-31.60, CI -44.24 to -18.96], P < 0.00001). In addition, electroacupuncture combined with Western drugs had better immediate analgesic effects than conventional Western drug treatment (MD = -1.85, CI -2.65 to -1.05, P < 0.00001). Five studies reported adverse events in the electroacupuncture group versus the drug group, including 19 cases of gastrointestinal symptoms and 6 cases of neurological symptoms (RR = 0.20, 95% CI = 0.04 to 0.88, P = 0.03). Systematic review registration: https://www.crd.york.ac.uk/prospero/display_record.php?RecordID=450037, identifier CRD42023450037.

Suppression of Cucumber Green Mottle Mosaic Virus Infection by Boron Application: From the Perspective of Nutrient Elements and Carbohydrates.

Cucumber green mottle mosaic virus (CGMMV) infection causes "blood flesh" symptoms in watermelon fruits, which severely reduces yield and edibleness. However, the growth of watermelon fruits is strongly associated with boron (B), a trace element for improving fruit quality. In this study, B-gradient hydroponic experiments (B concentration: 0, 2.86, and 5.72 mg·L-1 H3BO3) and foliar-spray experiments (B concentration: 30 and 300 mg·L-1 H3BO3) were performed. We found that the B-supplement could inhibit CGMMV infection and especially relieve "blood flesh" symptoms in watermelon fruits. The nutrient element, soluble sugar, and cell wall polysaccharide contents and their metabolism- and transport-related gene expressions were determined in leaves and fruits of the watermelons in B-gradient hydroponic and foliar-spray experiments. We found that the accumulation and metabolism of nutrients and carbohydrates in cells were disrupted by CGMMV infection; however, the B-supplement could restore and maintain their homeostasis. Additionally, we uncovered that NIP5;1 and SWEET4, induced by B-application with CGMMV infection, could majorly contribute to the resistance to CGMMV infection by regulating nutrient elements and carbohydrate homeostasis. These results provided a novel insight into the molecular mechanism of B-mediated CGMMV suppression and an efficient method of B-application for the improvement of watermelon quality after CGMMV infection.

A network-based method for mechanistic investigation and neuroprotective effect on treatment of tanshinone â against ischemic stroke in mouse.

ETHNOPHARMACOLOGICAL RELEVANCE: Tanshinone-Ⅰ (TSNⅠ), a member of the mainly active components of Salvia miltiorrhiza Bunge (Dan Shen), which is widely used for the treatment for modern clinical diseases including cardiovascular and cerebrovascular diseases, has been reported to show the properties of anti-oxidation, anti-inflammation, neuroprotection and other pharmacological actions. However, whether TSNⅠ can improve neuron survival and neurological function against transient focal cerebral ischemia (tMCAO) in mice is still a blank field. AIM OF THE STUDY: This study aims to investigate the neuroprotective effects of TSNⅠ on ischemic stroke (IS) induced by tMCAO in mice and explore the potential mechanism of TSNⅠ against IS by combining network pharmacology approach and experimental verification. MATERIALS AND METHODS: In this study, the pivotal candidate targets of TSNⅠ against IS were screened by network pharmacology firstly. Enrichment analysis and molecular docking of those targets were performed to identify the possible mechanism of TSNⅠ against IS. Afterwards, experiments were carried out to further verify the mechanism of TSNⅠ against IS. The infarct volume and neurological deficit were evaluated by 2, 3, 5-triphenyl tetrazolium chloride (TTC) staining and Longa respectively. Immunohistochemistry was used to observe neuronal death in the hippocampus and cortical regions by detecting the change of NeuN. The predicting pathways of signaling-related proteins were assessed by Western blot in vitro and in vivo experiments. RESULTS: In vivo, TSNⅠ was found to dose-dependently decrease mice's cerebral infarct volume induced by tMCAO. In vitro, pretreatment with TSNⅠ could increase cell viability of HT-22 cell following oxygen-glucose deprivation (OGD/R). Moreover, the results showed that 125 candidate targets were identified, Protein kinase B (AKT) signaling pathway was significantly enriched by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and mitogen-activated protein kinases 1 (MAPK1) and AKT1 could be bound to TSNⅠ more firmly by molecular docking analysis, which implies that TSNⅠ may play a role in neuroprotection through activating AKT and MAPK signaling pathways. Meanwhile, TSNⅠ was confirmed to significantly protect neurons from injury induced by IS through activating AKT and MAPK signaling pathways. CONCLUSION: In conclusion, our study clarifies that the mechanism of TSNⅠ against IS might be related to AKT and MAPK signaling pathways, which may provide the basic evidence for further development and utilization of TSNⅠ.