RESUMO
The cultivated aromatic medicinal herb Atractylodes lancea (Thunb.) DC. is widely used in the pharmaceuticals, nutraceuticals, and cosmetics industries (Na-Bangchang et al. 2014; Zhan et al. 2023). Huanggang in Hubei Province is a major production area for A. lancea (Huang et al. 2022; Wang et al. 2023). In April 2023, more than two-thirds of the surveyed plant leaves in this region exhibited virus-like symptoms, such as curling and mosaic patterns. To identify the underlying cause, 80 symptomatic plant leaf samples were collected from four fields (20 leaves per field) in this region and pooled for virome analysis. Total RNA, including ribosomal RNA, was extracted from the pooled samples using the Plant RNA Extraction Mini Kit (Onrew Biotech, Guangdong, China), for sequencing library construction. The Illumina NovaSeq 6000 platform was used to sequence the library and generate 150 bp paired-end reads. After processing the raw data with Trimmomatic software, a total of 44,354,650 high-quality clean reads were obtained. The clean reads were aligned against ribosomal RNA using BWA software (v0.7.17) to avoid interference and eliminate corresponding sequences. After removing potential contamination, contig assembly of the clean reads was performed using Megahit software (v1.2.9). The resulting contigs were compared with the virus NT database using the BLASTn program. Sequence pairwise comparison revealed 8 contigs (574 nt to 2243 nt) with identities ranging from 81.88% to 90.77% with Atractylodes mild mottle virus (AMMV, NC_027924.1, Lim et al., 2015). Additionally, contigs mapped to Carlavirus, Pelarspovirus, and other plant viruses in our virome dataset had low coverage and pairwise identity (less than 70%), which need to be further investigated. The presence of AMMV was confirmed by aligning the clean reads to the reference sequence (NC_027924.1) using BWA and SAMtools software, resulting in a consensus sequence (8024 nt) with gaps. DNA extraction from the pooled samples was performed using the Rapid Universal Genomic DNA Extraction Kit (Simgen, Zhejiang, China). Two pairs of specific primers, 3399F (5'-AAAGAAGAACCTCCTGATACGG-3')/5924R (5'-TGAACCTGATTCTCTTGGC-3') and 1830F (5'- CTCAGGAAATCCCAATGC -3')/3640R(5'-TTTCCCAATGTTCTTCGGG-3'), were designed to amplify the complete gene sequences of polymerase and coat protein (CP), based on the consensus sequence. The PCR products with the lengths of 2521 bp and 1814 bp were cloned into the pMD18-T vector (Takara Biotech, Dalian, China) for sequencing. The BLASTn analysis showed that the polymerase and CP gene sequences shared an identity of 94.51% (1929/2041 nt) and 88.41% (1419/1605 nt) with the AMMV isolate (NC_027924.1), respectively. The sequences have been deposited in GenBank under the accession numbers OR544810 and OR544811. We collected leaves from 32 A. lancea plants (16 symptomatic and 16 asymptomatic) in the fields. RT-PCR was conducted using CPF (5'-CTGCGAATATGAAAGTGC-3') and CPR (5'-GGTGAGCTTGTCTGTTAGG-3') primers, which were designed targeting a 527bp fragment of the CP gene (OR544811). Amplicons of the expected size (527bp) were detected in 24 plants (11 symptomatic and 13 asymptomatic), three of which were sequenced by Sanger sequencing, showing a 100% match to OR544811. These findings indicate that AMMV is prevalent in the major production area of A. lancea. Further research is needed to better characterize the potential risks of AMMV to A. lancea cultivation in China as well as other countries.
RESUMO
Currently, little is known about the characteristics of polyphenol oxidase from wheat bran, which is closely linked to the browning of wheat product. The wheat PPO was purified by ammonium sulfate precipitation, DEAE-Sepharose ion-exchange column, and Superdex G-75 chromatography column. Purified wheat PPO activity was 11.05-fold higher, its specific activity was 1365.12 U/mg, and its yield was 8.46%. SDS-PAGE showed that the molecular weight of wheat PPO was approximately 21 kDa. Its optimal pH and temperature were 6.5 and 35 °C for catechol as substrate, respectively. Twelve phenolic substrates from wheat and green tea were used for analyzing the substrate specificity. Wheat PPO showed the highest affinity to catechol due to its maximum Vmax (517.55 U·mL-1·min-1) and low Km (6.36 mM) values. Docking analysis revealed strong affinities between catechol, gallic acid, EGCG, and EC with binding energies of -5.28 kcal/mol, -4.65 kcal/mol, -4.21 kcal/mol, and -5.62 kcal/mol, respectively, for PPO. Sodium sulfite, ascorbic acid, and sodium bisulfite dramatically inhibited wheat PPO activity. Cu2+ and Ca2+ at 10 mM were considered potent activators and inhibitors for wheat PPO, respectively. This report provides a theoretical basis for controlling the enzymatic browning of wheat products fortified with green tea.
Assuntos
Catecol Oxidase , Fibras na Dieta , Catecol Oxidase/química , Fibras na Dieta/análise , Concentração de Íons de Hidrogênio , Cinética , Proteínas de Plantas/metabolismo , Catecóis/análise , Especificidade por Substrato , CháRESUMO
BACKGROUND AND AIMS: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. METHODS: ApoE-/- mice were fed a high-cholesterol diet and treated with GA for 16 weeks to induce AS and identify the effect of GA. Network pharmacological analysis was performed to predict the anti-atherosclerotic mechanisms. An invitro cell model was used to explore the effect of GA on macrophage polarization and the possible mechanism involved in bone marrow dereived macrophages (BMDMs) and RAW264.7 cells stimulated with lipopolysaccharide or oxidized low-density lipoprotein. RESULTS: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 µg/mL) significantly decreased the proportion of CD86+ macrophages and the mRNA levels of IL-6, IL-1ß, and MCP-1 in macrophages. Experimental results showed that GA inhibited M1 macrophage polarization by regulating TLR4/MyD88/NF-κB signaling pathway. CONCLUSIONS: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.
Assuntos
Aterosclerose , Placa Aterosclerótica , Camundongos , Animais , NF-kappa B/metabolismo , Fator 88 de Diferenciação Mieloide/metabolismo , Fator 88 de Diferenciação Mieloide/farmacologia , Receptor 4 Toll-Like/metabolismo , Aterosclerose/tratamento farmacológico , Aterosclerose/prevenção & controle , Aterosclerose/genética , Placa Aterosclerótica/metabolismo , Transdução de Sinais , Macrófagos/metabolismo , LipídeosRESUMO
Objective: Traditional Chinese medicine Polygonum cuspidatum (PC) has significant effects on reducing pain. In this study, we investigated the analgesic effects of the alcohol extract of PC on three types of inflammatory pain and explored its mechanism. Methods: Potential targets for the analgesic effects of the main active components of PC alcohol extract were screened by network pharmacology and molecular docking. Three different inflammatory pain mouse models (acetic acid twisting, formalin foot swelling, and xylene ear swelling) were used to study the analgesic effects of PC. The expression of latent signaling pathways in L4-6 spinal cord tissues in formalin foot swelling mice was evaluated using real-time qPCR (RT-qPCR), Western blot (WB), and immunohistochemistry (IHC) analyses. Results: Network pharmacology analysis shows that PC analgesic mechanism is related to the MAPK/ERK signaling pathway. The five main active components of PC have good docking ability with JNK and p38. PC alcohol extract significantly reduced the pain behavior and alleviated inflammatory reactions in three mouse models, inhibited the mRNA and protein phosphorylation levels of JNK, ERK, p38, and CREB in spinal cord tissues. Conclusion: PC alcohol extract can inhibit inflammation and alleviate pain, which is related to its inhibition of the MAPK/ERK signaling pathway in spinal cord. Thus, PC alcohol extract is a promising candidate for pain treatment.
Assuntos
Fallopia japonica , Ratos , Camundongos , Animais , Fallopia japonica/química , Ratos Sprague-Dawley , Simulação de Acoplamento Molecular , Dor/tratamento farmacológico , Transdução de Sinais , Analgésicos/farmacologia , Analgésicos/uso terapêutico , Etanol , Inflamação/tratamento farmacológico , Extratos Vegetais/farmacologia , Extratos Vegetais/uso terapêutico , Modelos Animais de Doenças , Formaldeído/farmacologiaRESUMO
Jujube (Zizyphus jujuba Mill.), a native small deciduous tree of China, is widely cultivated in China, Korea, India, Japan, Europe, and the United States (Chen et al. 2020). The fruit have been commonly consumed as healthy food supplements and traditional Chinese medicine for over 2000 years (Li et al. 2007). In August 2019, anthracnose-like leaf spot symptoms were observed on jujube plants in Xiaomenya Village, Jinan City, Shandong Province, China (36°27'39â³N, 117°3'13â³E), with over 30% leaf disease incidence. The spots were circular, sunken, brown in the center and with dark brown edges. As the spots enlarged and coalesced, it resulted in leaf perforation and early defoliation. Sometimes acervuli were observed on the lesions (Fig. S1a, b). To identify the causal agent, 20 diseased leaves were sampled, the margins of the lesions were cut into pieces (5 × 5 mm), sterilized and cultured following the protocol described previously (Wan et al. 2020) at 25 â for 5 days. Twelve monospore isolates showing identical colony morphology were obtained. Three representative isolates, JNZG11, JNZG311, JNZG313, were used for further study. When grown on PDA the colony color was initially white and then turned pale-gray to gray in 5-day-old cultures. On the reverse, colonies were brown-black with an orange pigmentation near the center. Aerial mycelium was cottony, dense, white to pale-gray. Conidia were hyaline, 1-celled, smooth-walled, subcylindrical, oblong, attenuated with slightly rounded ends, (11.1-) 12.7-13.3 (-17.8) ×(-4.4) 5.2-5.5 (-6.3) µm (n=50). Appressoria were dark-brown, oval or irregular, (7.3-) 8.6-9.2 (-9.8) ×(-5.1) 5.8-6.9 (-7.0) µm (n=50) (Fig. S1c-g). The morphology resembled those of Colletotrichum gloeosporioides species complex (Cannon et al. 2012). For accurate identification, the sequences of the ribosomal internal transcribed spacer (ITS), actin (ACT), ß-tub2 (TUB2), calmodulin (CAL), chitin synthase (CHS-1), and glyceraldehyde-3phosphate dehydrogenase (GAPDH) of the 3 isolates were sequenced (Weir et al. 2012), and deposited into GenBank (Accession Nos. see Table 1). The six loci (ITS, GAPDH, ACT, CHS-1, CAL, and TUB2) were concatenated and the aligned sequences (1904 bp) were 99.7% homologous to ex-type C. siamense ICMP18578. The sequences of 38 Colletotrichum species (44 isolates) were downloaded from GenBank for phylogenetic analyses. In the maximum likelihood phylogenetic tree generated, the highest log likelihood was -8798.90 and the three isolates were all in the C. siamense clade (bootstrap support 94 %) (Fig. S2). To complete Koch's postulates, 60 healthy, mature jujube leaves on 12 branches (5 leaves per branch) (variety 'Zhongqiuhong') were inoculated with 20 µL of spore suspension (106 conidia/mL) or sterile water as a control. The branches were placed in sterile beakers containing a small amount of sterile water sealed with plastic wrap and maintained at 28 °C, 12 h light/dark. Five days after inoculation, all treated leaves showed the typical anthracnose symptom, similar to that observed in the field (Fig. S1h). The same fungus was re-isolated from the margins of the lesions using the aforementioned methods. Whereas no fungus were isolated from the controls. Previously, C. siamense has been reported to infect Z. mauritiana in China (Shu et al. 2020). To our knowledge, this is the first report of C. siamense causing anthracnose on Z. jujuba in China. This finding provides crucial information for the effective management of this disease.
RESUMO
OBJECTIVES: Acupuncture has been found to be effective at relieving many inflammatory pain conditions, including rheumatoid arthritis (RA). We aimed to assess the anti-inflammatory potential of manual acupuncture (MA) treatment of RA using adjuvant-induced arthritic (AIA) rats and to explore the underlying mechanisms. METHODS: The anti-inflammatory and analgesic actions of MA at ST36 (Zusanli) in AIA rats were assessed using paw withdrawal latency and swelling, histological examination and cytokine detection by enzyme-linked immunoassay (ELISA). The cell-cell communication (CCC) network was analyzed with a multiplex immunoassay of 24 immune factors expressed in the inflamed joints, and the macrophage and Treg populations and associated cytokines regulated by MA were investigated using reverse-transcription quantitative polymerase chain reaction (RT-qPCR), ELISA and flow cytometry. RESULTS: MA markedly decreased heat hyperalgesia and paw swelling in AIA rats. MA-treated rats also exhibited decreased levels of pro-inflammatory cytokines (tumor necrosis factor (TNF)-α, interleukin (IL)-1ß) coupled with increased anti-inflammatory cytokines (IL-10, transforming growth factor (TGF)-ß1) in the ankle joints at protein and mRNA levels. CCC network analysis confirmed that macrophages are of critical importance and are potential therapeutic targets in RA. Repeated treatment with MA triggered a macrophage phenotypic switch in the paws, with fewer M1 macrophages. Prominent increases in the Treg cell population and TGF-ß1 in the popliteal lymph nodes demonstrated the immunomodulatory effects of MA. Furthermore, a selective TGF-ß1-receptor inhibitor, SB431542, attenuated the anti-inflammatory effects of MA and MA-induced suppression of the levels of M1-released cytokines. CONCLUSION: These findings provide novel evidence that the anti-inflammatory and analgesic effects of MA on RA act through phenotypic modulation involving the inhibition of M1 macrophage polarization and an increase in the Treg cell population, highlighting the potential therapeutic advantages of acupuncture in controlling pain and ameliorating inflammatory conditions.
Assuntos
Terapia por Acupuntura , Artrite Experimental , Artrite Reumatoide , Ratos , Animais , Linfócitos T Reguladores/metabolismo , Linfócitos T Reguladores/patologia , Fator de Crescimento Transformador beta1 , Citocinas , Artrite Reumatoide/tratamento farmacológico , Fator de Necrose Tumoral alfa , Macrófagos/metabolismo , Macrófagos/patologia , Dor/tratamento farmacológico , Anti-Inflamatórios/efeitos adversos , Artrite Experimental/tratamento farmacológicoRESUMO
OBJECTIVE: To explore the potential mechanism of Yishen Qutong Granules (YSQTG) for the treatment of esophageal cancer using network pharmacology and experimental research. METHODS: The effective components and molecular mechanism of YSQTG in treating esophageal cancer were expounded based on network pharmacology and molecular docking. The key compound was identified by high-performance liquid chromatography and mass spectrometry (HPLC-MS) to verify the malignant phenotype of the key compounds in the treatment of esophageal cancer. Then, the interaction proteins of key compounds were screened by pull-down assay combined with mass spectrometry. RNA-seq was used to screen the differential genes in the treatment of esophageal cancer by key compounds, and the potential mechanism of key compounds on the main therapeutic targets was verified. RESULTS: Totally 76 effective compounds of YSQTG were found, as well as 309 related targets, and 102 drug and disease interaction targets. The drug-compound-target network of YSQTG was constructed, suggesting that quercetin, luteolin, wogonin, kaempferol and baicalein may be the most important compounds, while quercetin had higher degree value and degree centrality, which might be the key compound in YSQTG. The HPLC-MS results also showed the stable presence of quercetin in YSQTG. By establishing a protein interaction network, the main therapeutic targets of YSQTG in treating esophageal cancer were Jun proto-oncogene, interleukin-6, tumor necrosis factor, and RELA proto-oncogene. The results of cell function experiments in vitro showed that quercetin could inhibit proliferation, invasion, and clonal formation of esophageal carcinoma cells. Quercetin mainly affected the biological processes of esophageal cancer cells, such as proliferation, cell cycle, and cell metastasis. A total of 357 quercetin interacting proteins were screened, and 531 genes were significantly changed. Further pathway enrichment analysis showed that quercetin mainly affects the metabolic pathway, MAPK signaling pathway, and nuclear factor kappa B (NF- κ B) signaling pathway, etc. Quercetin, the key compound of YSQTG, had stronger binding activity by molecular docking. Pull-down assay confirmed that NF- κ B was a quercetin-specific interaction protein, and quercetin could significantly reduce the protein level of NF- κ B, the main therapeutic target. CONCLUSION: YSQTG can be multi-component, multi-target, multi-channel treatment of esophageal cancer, it is a potential drug for the treatment of esophageal cancer.
Assuntos
Medicamentos de Ervas Chinesas , Neoplasias Esofágicas , Humanos , Farmacologia em Rede , Quercetina , Medicina Tradicional Chinesa , Simulação de Acoplamento MolecularRESUMO
OBJECTIVE@#To explore the potential mechanism of Yishen Qutong Granules (YSQTG) for the treatment of esophageal cancer using network pharmacology and experimental research.@*METHODS@#The effective components and molecular mechanism of YSQTG in treating esophageal cancer were expounded based on network pharmacology and molecular docking. The key compound was identified by high-performance liquid chromatography and mass spectrometry (HPLC-MS) to verify the malignant phenotype of the key compounds in the treatment of esophageal cancer. Then, the interaction proteins of key compounds were screened by pull-down assay combined with mass spectrometry. RNA-seq was used to screen the differential genes in the treatment of esophageal cancer by key compounds, and the potential mechanism of key compounds on the main therapeutic targets was verified.@*RESULTS@#Totally 76 effective compounds of YSQTG were found, as well as 309 related targets, and 102 drug and disease interaction targets. The drug-compound-target network of YSQTG was constructed, suggesting that quercetin, luteolin, wogonin, kaempferol and baicalein may be the most important compounds, while quercetin had higher degree value and degree centrality, which might be the key compound in YSQTG. The HPLC-MS results also showed the stable presence of quercetin in YSQTG. By establishing a protein interaction network, the main therapeutic targets of YSQTG in treating esophageal cancer were Jun proto-oncogene, interleukin-6, tumor necrosis factor, and RELA proto-oncogene. The results of cell function experiments in vitro showed that quercetin could inhibit proliferation, invasion, and clonal formation of esophageal carcinoma cells. Quercetin mainly affected the biological processes of esophageal cancer cells, such as proliferation, cell cycle, and cell metastasis. A total of 357 quercetin interacting proteins were screened, and 531 genes were significantly changed. Further pathway enrichment analysis showed that quercetin mainly affects the metabolic pathway, MAPK signaling pathway, and nuclear factor kappa B (NF- κ B) signaling pathway, etc. Quercetin, the key compound of YSQTG, had stronger binding activity by molecular docking. Pull-down assay confirmed that NF- κ B was a quercetin-specific interaction protein, and quercetin could significantly reduce the protein level of NF- κ B, the main therapeutic target.@*CONCLUSION@#YSQTG can be multi-component, multi-target, multi-channel treatment of esophageal cancer, it is a potential drug for the treatment of esophageal cancer.
Assuntos
Humanos , Farmacologia em Rede , Quercetina , Medicina Tradicional Chinesa , Simulação de Acoplamento Molecular , Neoplasias Esofágicas , Medicamentos de Ervas ChinesasRESUMO
italic>Artemisia argyi (A. argyi) is a Chinese herbal medicine in China. The main active components are volatile oils, flavonoids, and other compounds, which have various pharmacological activities. Methoxylated flavonoids are the main active ingredients in A. argyi. Flavonoid O-methyltransferase (FOMT) is a key enzyme in the O-methylation of flavonoids. In order to further understand the function and characteristics of FOMT proteins, this paper carried out the whole genome mining and identification of FOMT genes in A. argyi and performed phylogenetic, chromosomal localization, gene sequence characterization, subcellular localization prediction, protein structure, gene structure analysis, and expression pattern analysis. The results showed that a total of 83 FOMT genes were identified in the genome of A. argyi. The phylogenetic tree shows that FOMT genes are divided into two subgroups, CCoAOMT (caffeoyl CoA O-methyltransferase) subfamily (32 genes) and COMT (caffeic acid O-methyltransferase) subfamily (51 genes). Gene sequence analysis showed that the number of amino acids encoded by FOMT was 70-734 aa, the molecular weight was 25 296.55-34 241.3 Da, and the isoelectric point was 4.51-9.99. Compared with 32 members of the CCoAOMT subfamily, nearly 1/3 of the 51 members of the COMT subfamily were hydrophobic proteins and 2/3 were hydrophilic proteins. Subcellular localization prediction showed that more than 80% of CCoAOMT subfamily members were located in the cytoplasm, and 96% of COMT subfamily members were located in the chloroplast. COMT subfamily members have more motifs than CCoAOMT subfamily members. The N-terminal motifs of COMT subfamily proteins are relatively variable, while the C-terminal motifs are relatively conserved. Expression pattern analysis showed that CCoAOMT subfamily members were mainly expressed in roots, while COMT members were mainly expressed in leaves. Some FOMTs showed the tissue expression specificity by real-time quantitative PCR analysis, especially in leaves. In this study, we identified and analyzed the FOMT gene family in A. argyi, and provided a theoretical basis for further research on the function of FOMTs and the biosynthesis of methylated flavonoids in A. argyi.
RESUMO
The lateral hypothalamus (LH) is an important brain region mediating sleep-wake behavior. Recent evidence has shown that astrocytes in central nervous system modulate the activity of adjacent neurons and participate in several physiological functions. However, the role of LH astrocytes in sleep-wake regulation remains unclear. Here, using synchronous recording of electroencephalogram/electromyogram in mice and calcium signals in LH astrocytes, we show that the activity of LH astrocytes is significantly increased during non-rapid eye movement (NREM) sleep-to-wake transitions and decreased during Wake-to-NREM sleep transitions. Chemogenetic activation of LH astrocytes potently promotes wakefulness and maintains long-term arousal, while chemogenetic inhibition of LH astrocytes decreases the total amount of wakefulness in mice. Moreover, by combining chemogenetics with fiber photometry, we show that activation of LH astrocytes significantly increases the calcium signals of adjacent neurons, especially among GABAergic neurons. Taken together, our results clearly illustrate that LH astrocytes are a key neural substrate regulating wakefulness and encode this behavior through surrounding GABAergic neurons. Our findings raise the possibility that overactivity of LH astrocytes may be an underlying mechanism of clinical sleep disorders.
Assuntos
Região Hipotalâmica Lateral , Vigília , Animais , Camundongos , Vigília/fisiologia , Região Hipotalâmica Lateral/fisiologia , Astrócitos , Cálcio , Sono/fisiologia , Neurônios GABAérgicos/fisiologia , HipotálamoRESUMO
BACKGROUND: Scutellaria baicalensis, a medicinal herb belonging to the Lamiaceae family, has been recorded in the Chinese, European, and British Pharmacopoeias. The medicinal properties of this plant are attributed to the total flavonoids of Scutellaria baicalensis (TFSB), particularly the main component, baicalin. This study provides a systematic and comprehensive list of the identified TFSB components and their chemical structures. The quality control process, pharmacokinetics, clinical application, and safety of Scutellaria baicalensis are discussed, and its pharmacological effect on cardiovascular diseases (CVDs) is detailed. Finally, the future research trends and prospects of this medicinal plant are provided. METHODS: The Chinese and English papers related to TFSB were collected from the PubMed and CNKI databases using the relevant keywords. To highlight the pharmacological mechanism, clinical application, and safety of TFSB, the collected articles were screened and classified based on their research content. RESULTS: TFSB contains at least 100 different kinds of flavonoids, of which baicalin, baicalein, wogonin, wogonoside, scutellarin, and scutellarein are the main active ingredients. The preparation process of TFSB is relatively well established, and the extraction rate can be significantly increased by enzymatic pretreatment and ultrasonication. The low oral availability of TFSB may be effectively enhanced using nanoformulations. The available pharmacokinetic data show that flavonoid glycosides and aglycones with the same parent nucleus may be converted to structures that are conducive to absorption in vivo. Moreover, TFSB can protect against CVDs by inhibiting apoptosis, regulating oxidative stress response, participating in inflammatory response, protecting against myocardial fibrosis, inhibiting myocardial hypertrophy, and regulating blood vessels. In terms of clinical application and animal safety, the available studies show that TFSB can be applied in a wide range of clinical treatments and is safe to use is animals. CONCLUSION: This article systematically reviews the therapeutic effect and underlying pharmacological mechanism of TFSB against CVDs. The available studies clearly suggest that TFSB has great potential for the treatment of CVDs and is worthy of in-depth research and development.
Assuntos
Doenças Cardiovasculares , Flavanonas , Plantas Medicinais , Animais , Doenças Cardiovasculares/tratamento farmacológico , Flavanonas/análise , Flavonoides/análise , Flavonoides/farmacologia , Flavonoides/uso terapêutico , Glicosídeos/análise , Raízes de Plantas/química , Plantas Medicinais/química , Scutellaria baicalensis/químicaRESUMO
Objective: To investigate the main pharmacological basis and mechanism of action of Gujiansan in the treatment of steroid-induced avascular necrosis of the femoral head (SANFH). Methods: The active constituents and targets of Gujiansan were screened by using TCMSP and other databases, and relevant disease targets were obtained by analyzing the microarray of SANFH in the GEO database. The intersection of the two was taken to obtain the potential targets of Gujiansan for the treatment of SANFH, and key active constituents were screened with the "active constituent-target" network constructed by the Cytoscape software; then, the STRING database was used to construct the protein interaction network to screen the key targets. The Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analyses of key targets were performed by the DAVID database, and the relationship between the "key active constituent-key target-key signaling pathway" was explored. Finally, the molecular docking between key active constituents and key targets was verified. In addition, qPCR detection technology was used to evaluate the preventive and therapeutic effects of key active constituents of Gujiansan in a rat osteoblast model of SANFH to verify the possible mechanism of the effect of Gujiansan in the treatment of SANFH. Results: (1) 106 active constituents and 55 targets were obtained for the treatment of SANFH. (2) Quercetin, luteolin, kaempferol, cryptotanshinone, and naringenin were the key active constituents for the treatment of SANFH. (3) IL1B, STAT3, CAT, PTGS2, and MAPK3 were the key targets for the treatment of SANFH. (4) IL1B, STAT3, CAT, PTGS2, MAPK3, and HMOX1 are key targets in the protein interaction network. (5) DAVID enrichment analysis mainly covers the regulation of DNA-binding transcription factor activity, positive regulation of cytokine production, and response to oxidative stress and other biological processes, involving IL-17, AGE-RAGE, C-type lectin receptor, and other signaling pathways. (6) Gujiansan is a multitarget and multisignaling pathway for the treatment of SANFH. (7) Good binding activity exists between key active constituents and key targets. Conclusion: This study analyzes the potential mechanism of action of Gujiansan in the treatment of SANFH with network pharmacology, which can provide a reference for the further study of its pharmacological basis and targets.
Assuntos
Medicamentos de Ervas Chinesas , Necrose da Cabeça do Fêmur , Animais , Biologia Computacional , Ciclo-Oxigenase 2 , Medicamentos de Ervas Chinesas/química , Necrose da Cabeça do Fêmur/induzido quimicamente , Necrose da Cabeça do Fêmur/tratamento farmacológico , Necrose da Cabeça do Fêmur/genética , Medicina Tradicional Chinesa , Simulação de Acoplamento Molecular , Ratos , EsteroidesRESUMO
Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 µm (578.75 - 902.65 µm), maximum body width (W) = 471.97 ± 70.95 µm (318.7 - 586.3 µm), stylet length = 15.18 ± 0.96 µm (13.52 - 17.04 µm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 µm (2.60 - 3.80µm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 µm (375.3 - 552.5 µm), stylet length =12.59 ± 1.39 µm (10.5 - 16.8 µm), tail length= 53.35 ± 1.55 µm (51.8 - 54.9 µm), hyaline tail terminus =11.45 ± 0.65 µm (10.2 - 12.1 µm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.
RESUMO
The present study explored the differences in active ingredients and in vitro anti-inflammatory effects of the decoction pieces by integrated processing(IPDP) and traditional processing(TPDP) of Polygoni Cuspidati Rhizoma et Radix(PCRER).The content of polydatin, resveratrol, emodin-8-O-ß-D-glucoside, emodin, and physcion in IPDP and TPDP was determined by high-performance liquid chromatography(HPLC).The inflammation model was induced by lipopolysaccharide(LPS) in RAW264.7 cells.The mRNA levels of inflammatory cytokines tumor necrosis factor-α(TNF-α), interleukin-6(IL-6), and interleukin-1ß(IL-1ß) in 60% ethanol extracts of IPDP and TPDP of different concentrations(5 and 10 µg·mL~(-1)) were determined by PCR.The results showed that the content of polydatin and emodin-8-O-ß-D-glucoside in IPDP was significantly higher than that in TPDP, while the content of resveratrol, emodin, and physcion was higher in TPDP.The anti-inflammatory results showed that ethanol extracts of IPDP of different concentrations(5 and 10 µg·mL~(-1)) significantly inhibited the increase in the mRNA levels of IL-1ß and TNF-α induced by LPS, whereas TPDP only had a significant inhibitory effect on IL-1ß.This study preliminarily showed that the total content of five active ingredients in IPDP was higher than that in TPDP, and IPDP was superior to TPDP in anti-inflammatory activity in vitro, which provided an experimental basis for the production and application of IPDP.
Assuntos
Medicamentos de Ervas Chinesas , Emodina , Anti-Inflamatórios/farmacologia , Medicamentos de Ervas Chinesas/farmacologia , Emodina/farmacologia , Etanol , Lipopolissacarídeos , RNA Mensageiro/genética , Resveratrol/farmacologia , Fator de Necrose Tumoral alfa/genéticaRESUMO
Elsholtziazhongyangii (Lamiaceae), a new species from Sichuan Province, China, is described and illustrated. The new species is morphologically similar to E.feddeif.feddei, but it can be easily distinguished from E.feddeif.feddei by smaller corolla (3.2-3.5 mm vs. 4.5-5.3 mm), bract indumentum (glabrous, except margin ciliate vs. villous, especially on veins abaxially, glabrous adaxially) and bract stalked (ca. 1.2 mm vs. sessile). Phylogenetic analyses, based on two nuclear ribosomal (ETS, ITS) and five plastid (rbcL, matK, trnL-F, ycf1, ycf1-rps15) regions, confirmed that the new species formed a monophyletic clade with robust support. The new species is currently known from western Sichuan.
RESUMO
The medicinal plant Scutellaria baicalensis Georgi is rich in specialized 4'-deoxyflavones, which are reported to have many health-promoting properties. We assayed Scutellaria flavones with different methoxyl groups on human cancer cell lines and found that polymethoxylated 4'-deoxyflavones, like skullcapflavone I and tenaxin I have stronger ability to induce apoptosis compared to unmethylated baicalein, showing that methoxylation enhances bioactivity as well as the physical properties of specialized flavones, while having no side-effects on healthy cells. We investigated the formation of methoxylated flavones and found that two O-methyltransferase (OMT) families are active in the roots of S. baicalensis. The Type II OMTs, SbPFOMT2 and SbPFOMT5, decorate one of two adjacent hydroxyl groups on flavones and are responsible for methylation on the C6, 8 and 3'-hydroxyl positions, to form oroxylin A, tenaxin II and chrysoeriol respectively. The Type I OMTs, SbFOMT3, SbFOMT5 and SbFOMT6 account mainly for C7-methoxylation of flavones, but SbFOMT5 can also methylate baicalein on its C5 and C6-hydroxyl positions. The dimethoxylated flavone, skullcapflavone I (found naturally in roots of S. baicalensis) can be produced in yeast by co-expressing SbPFOMT5 plus SbFOMT6 when the appropriately hydroxylated 4'-deoxyflavone substrates are supplied in the medium. Co-expression of SbPFOMT5 plus SbFOMT5 in yeast produced tenaxin I, also found in Scutellaria roots. This work showed that both type I and type II OMT enzymes are involved in biosynthesis of methoxylated flavones in S. baicalensis.
Assuntos
Plantas Medicinais , Scutellaria baicalensis , Flavonoides/metabolismo , Metiltransferases/genética , Metiltransferases/metabolismo , Raízes de Plantas/metabolismo , Scutellaria baicalensis/química , Scutellaria baicalensis/metabolismoRESUMO
Tanshinone â ¡A (Tâ ¡A), a diterpene quinone with a furan ring, is a bioactive compound found in the medicinal herb redroot sage (Salvia miltiorrhiza Bunge), in which both furan and dihydrofuran analogs are present in abundance. Progress has been made recently in elucidating the tanshinone biosynthetic pathway, including heterocyclization of the dihydrofuran D-ring by cytochrome P450s; however, dehydrogenation of dihydrofuran to furan, a key step of furan ring formation, remains uncharacterized. Here, by differential transcriptome mining, we identified six 2-oxoglutarate-dependent dioxygenase (2-ODD) genes whose expressions corresponded to tanshinone biosynthesis. We showed that Sm2-ODD14 acts as a dehydrogenase catalyzing the furan ring aromatization. In vitro Sm2-ODD14 converted cryptotanshinone to Tâ ¡A and thus was designated Tâ ¡A synthase (SmTâ ¡AS). Furthermore, SmTâ ¡AS showed a strict substrate specificity, and repression of SmTâ ¡AS expression in hairy root by RNAi led to increased accumulation of total dihydrofuran-tanshinones and decreased production of furan-tanshinones. We conclude that SmTâ ¡AS controls the metabolite flux from dihydrofuran- to furan-tanshinones, which influences medicinal properties of S. miltiorrhiza.
Assuntos
Dioxigenases/genética , Dioxigenases/metabolismo , Diterpenos/metabolismo , Furanos/metabolismo , Plantas Medicinais/metabolismo , Salvia miltiorrhiza/genética , Salvia miltiorrhiza/metabolismo , Vias Biossintéticas , Regulação da Expressão Gênica de Plantas , Genes de Plantas , Raízes de Plantas/metabolismoRESUMO
Breast cancer is one of the most common malignancies in women worldwide. Traditional Chinese medicine has been used as adjunctive or complementary therapy for breast cancer. Diterpenoids from Euphorbia fischeriana Steud. have been demonstrated to possess anti-breast-cancer activity. This research was aimed to systematically explore the diterpenoids from E. fischeriana and study the multiple mechanisms on breast cancer. The structures of diterpenoids were identified by the integrated strategy of UHPLC-Q-TOF-MS and molecular networking. A total of 177 diterpenoids belonging to 13 types were collected. In silico ADME analysis was performed on these compounds. It indicated that 130 of 177 diterpenoids completely adjusted to Lipinski's rule. The targets of compounds were obtained from PharmMapper. The targets of breast cancer were collected from GeneCards. Then, 197 compounds-related targets and 544 breast cancer-related targets were identified. After the intersection process, 58 overlapping targets between compounds-related targets and breast cancer-related targets were acquired. The STRING database was applied to predict the protein-protein interactions. The GO and KEGG pathway enrichment analysis were performed by using the KOBAS database. It indicated that these predicted pathways were closely related to breast cancer. The treatment effect of E. fischeriana on breast cancer might be performed through signaling pathways, such as IL-17 signaling pathway, MAPK signaling pathway, and PI3K-Akt signaling pathway. The predicted top genes such as EGFR, ESR, MAPK, SRC, CASP3, CDK2, and KDR were involved in cell proliferation, gene transcription, apoptosis, signal transduction, DNA damage and repair, tumor differentiation, metastasis, and cell cycle, which indicated that E. fischeriana might treat breast cancer comprehensively. A compounds-KEGG pathways-related targets network was built by using cytoHubba to analyze the hub compounds and targets. It concluded that E. fischeriana treated breast cancer not only by the main components but also by the microconstituents, which reflected the overall regulatory role of multicomponents treating breast cancer. To estimate the binding affinities, binding sites, and binding postures, molecular docking simulations between 177 diterpenoids and top 19 targets were carried out. The results are basically in line with expectations. In conclusion, these results can serve as references for researchers studying potential targets of diterpenoids from E. fischeriana on breast cancer in the future.
RESUMO
BACKGROUND: Clinically, the traditional Chinese medicine compound Gujiansan has been widely used in the treatment of steroid-induced avascular necrosis of the femoral head (SANFH). The present study aimed to investigate the mechanisms underlying the therapeutic effect of Gujiansan. METHODS: A rat model of SANFH was established by the injection of dexamethasone (DEX) at a high dosage of 25 mg/kg/d. Then, Gujiansan was intragastrically administered for 2 weeks, 4 weeks, and 8 weeks, and histological examination of the femoral head was performed. The expression levels of related mRNAs and proteins were analyzed by qRT-PCR, Western blotting, and immunohistochemistry, and the levels of bone biochemical markers and cytokines were detected with ELISA kits. RESULTS: Gujiansan administration ameliorated SANFH and induced the expression of hypoxia-inducible factor-1α (HIF-1α), Bcl-2/adenovirus E1B 19 kDa interacting protein 3 (BNIP3), LC3, and Beclin-1 in the rat model in a dose- and time-dependent manner, and Gujiansan promoted osteocalcin secretion at the femoral head. In addition, Gujiansan increased the levels of bone formation- and bone resorption-specific markers (osteocalcin (OC), bone-specific alkaline phosphatase (BAP), tartrate resistant acid phosphatase-5b (TRACP-5b), N-terminal telopeptides of type I collagen (NTX-1), and C-terminal telopeptide of type I collagen (CTX-1)) and decreased the levels of proinflammatory cytokines (TNF-α, IL-6, and CRP) in a dose- and time-dependent manner. CONCLUSIONS: Gujiansan accelerates the formation of a new bone, promotes the absorption of the damaged bone, inhibits the inflammatory response, induces autophagy of the femoral head via the HIF-1α/BNIP3 pathway, and ultimately ameliorates SANFH.
RESUMO
OBJECTIVE: To observe the effect of moxibustion on postpartum urodynamics and recovery of pelvic floor function based on the pelvic floor muscle function training. METHODS: A total of 150 puerperal women were randomly divided into an observation group (75 cases, 15 cases dropped off) and a control group (75 cases, 15 cases dropped off). The control group was treated with pelvic floor muscle function training, twice a day. Based on the treatment in the control group, the observation group was treated with Baixiao moxibustion at Qihai (CV 6), Guanyuan (CV 4), Sanyinjiao (SP 6) and Zusanli (ST 36), twice a week. The treatment started on the 42nd day after delivery, totaling for 12 weeks. The urodynamic indexes (functional urethral length [FUL], stress leak point pressure [SLPP], maximum urethral closure pressure [MUCP], bladder compliance [BC], maximum urethral pressure [MUP], detrusor pressure at maximum urinary flow rate [Pdet Qmax]), the international consultation on incontinence questionnaire-urinary incontinence-short form (ICIQ-UI-SF) score and vaginal muscle voltage were observed before and after treatment. The prolapse rate of pelvic floor organ and normal rate of pelvic floor muscle strength of the two groups were recorded after treatment. RESULTS: Compared before treatment, the levels of FUL, MUCP, BC, Pdet Qmax and SLPP in the observation group after treatment were increased (P<0.05), while the FUL and SLPP in the control group after treatment were increased (P<0.05). After treatment, the levels of FUL, SLPP, MUCP and BC in the observation group were higher than those in the control group (P<0.05). Compared before treatment, the ICIQ-UI-SF scores in the two groups after treatment were decreased (P<0.01), and the vaginal muscle voltage was increased (P<0.01). After treatment, the ICIQ-UI-SF score in the observation group was lower than that in the control group (P<0.01), and the vaginal muscle voltage in the observation group was higher than that in the control group (P<0.01). The prolapse rate of pelvic floor organ was 6.7% (4/60) in the observation group, which was lower than 20.0% (12/60) in the control group (P<0.05). The normal rate of pelvic floor muscle strength in the observation group was 88.3% (53/60), which was higher than 65.0% (39/60) in the control group (P<0.05). CONCLUSION: The moxibustion combined with pelvic floor muscle function training could improve postpartum urodynamics and pelvic floor muscle strength.