RESUMO
Ephedra herb, a dried terrestrial stem of Ephedra sinica, is used in traditional Japanese medicine (Kampo) and Chinese medicine to treat the common cold, headaches, bronchial asthma, and nasal inflammation. E. sinica predominantly contains two ephedrine alkaloids-(-)-ephedrine and (+)-pseudoephedrine-which are crucial for its medicinal effects. This study aimed to reveal the influence of genetic and environmental factors on ephedrine alkaloids content using statistical genetic analyses. To evaluate the influence of genetic factors on ephedrine alkaloids content, 25 clonal lines were cultivated in Ibaraki and the broad-sense heritability of the traits was estimated. The heritabilities of (-)-ephedrine, (+)-pseudoephedrine, and "total alkaloids" (TA) content were 0.871, 0.969, and 0.865, respectively. The heritabilities of ephedrine alkaloids content were high. To evaluate the influence of environmental factors on ephedrine alkaloids content, four clonal lines which have different genotypes were cultivated in three locations (Ibaraki, Shizuoka, and Yamanashi prefectures). The effects of genotype (G), location (L), and genotype by environment (G × E) interactions on ephedrine alkaloids content were found to be significant (p < 0.05) by two-way ANOVA, and, in particular, the genotypic effects were found to be the largest. Our results indicate that the ephedrine alkaloids content in E. sinica is under relatively strong genetic control and remains stable under various environments. These findings suggest that E. sinica with a higher and stable ephedrine alkaloids content could be cultivated in different locations through selective breeding.
Assuntos
Alcaloides , Medicamentos de Ervas Chinesas , Ephedra sinica , Efedrina , Ephedra sinica/genética , PseudoefedrinaRESUMO
A total of 147 oral Kampo prescriptions, which are used clinically in Japan, were evaluated for their anti-glycation activity. Kakkonto demonstrated significant anti-glycation activity, prompting further analysis of its chemical constituents using LC-MS, which revealed the presence of two alkaloids, fourteen flavonoids, two but-2-enolides, five monoterpenoids, and four triterpenoid glycosides. To identify the components responsible for its anti-glycation activity, the Kakkonto extract was reacted with glyceraldehyde (GA) or methylglyoxal (MGO) and analyzed using LC-MS. In LC-MS analysis of Kakkonto reacted with GA, the peak intensity of ephedrine was attenuated, and three products from ephedrine-scavenging GA were detected. Similarly, LC-MS analysis of Kakkonto reacted with MGO revealed two products from ephedrine reacting with MGO. These results indicated that ephedrine was responsible for the observed anti-glycation activity of Kakkonto. Ephedrae herba extract, which contains ephedrine, also showed strong anti-glycation activity, further supporting ephedrine's contribution to Kakkonto's reactive carbonyl species' scavenging ability and anti-glycation activity.
Assuntos
Medicamentos de Ervas Chinesas , Efedrina , Efedrina/farmacologia , Efedrina/análise , Cromatografia Líquida , Óxido de Magnésio , Espectrometria de Massas em Tandem , Aldeído Pirúvico , Produtos Finais de Glicação Avançada/análiseRESUMO
In the Yarlung Zangbo River Valley of the southeastern Tibetan Plateau, China (29°07'49.5"N, 92°41'11.0"E, 3256 m above sea level), we found an Ephedra saxatilis community in the xeric steppe with shrubland vegetation habitat of the broad alluvial plain of the river with soil having relatively higher water-soluble cation (Ca2+, 8.62; K+, 1.94; Mg2+, 2.38 mmol/100 g dry soil weight) and nitrogen (NO3-, 21.78; NH4+, 1.82 mmol/100 g dry soil weight) content. The ranges of ephedrine and pseudoephedrine in 13 E. saxatilis samples were as follows: ephedrine, not detected-3.03 of dry weight (%DW) and pseudoephedrine, not detected-1.36%DW. The 13 E. saxatilis plants collected in the study area showed intraspecific variability of ephedrine and pseudoephedrine with 6 samples containing ephedrine and pseudoephedrine, 6 samples containing only ephedrine, and 1 sample containing only pseudoephedrine.
Assuntos
Ephedra , Efedrina , Pseudoefedrina , Rios , Tibet , Solo , ChinaRESUMO
Ephedrae Herba is among the important crude drugs prescribed in Kampo medicine for the treatment of cold, flue, rhinitis, nasal congestion, cough, and asthma. The active ingredients of Ephedrae Herba, ephedrine (E) and pseudoephedrine (PE), are potent sympathomimetic compounds that stimulate α-, ß1-, and ß2-adrenoceptors resulting in dilatation and alleviation of nasal mucosal hyperemia. Hypertension, palpitations, insomnia, and dysuria are the main adverse effects of E and PE, which can be avoided by determining the actual contents of these alkaloids in Kampo extracts containing Ephedrae Herba. However, the extraction efficiencies of E and PE from Ephedrae Herba contained in Kampo formulas in combination with other crude drugs remain unknown. Therefore, we comprehensively determined the E and PE contents of 34 Kampo extracts containing Ephedrae Herba used clinically in Japan. The E and PE contents per daily dosage in Kampo extracts were generally proportional to the compounding amount of Ephedrae Herba. In contrast, the extraction efficiencies of E or PE were not constant and not influenced by the pH of the extracts. We assume that the extraction efficiencies of E and PE may be independently affected by other constituent crude drugs. Thus, it is necessary to investigate the cause and mechanism in the future. In conclusion, these results show that the E and PE content of each Kampo formulation can be estimated from the compounding amount of Ephedrae Herba. Therefore, the amount of Ephedrae Herba should be carefully considered to ensure the safe use of Kampo formulations containing Ephedrae Herba.
Assuntos
Medicamentos de Ervas Chinesas , Efedrina , Pseudoefedrina , Medicina Kampo , JapãoRESUMO
The differences in rooting characteristics of cuttings prepared from E. sinica strains were investigated and found that cuttings prepared from strains with high rooting characteristics showed approximately 90% of the cuttings were rooted, whereas cuttings prepared from low rooting characteristics did not root. To understand the reason for this substantial difference, the anatomy of nodes was examined and found that adventitious roots were generated from the cortex and parenchyma in pith. Calculations of the correlation coefficients between the rooting rate and the value of anatomy indicated that the rooting rate was positively correlated with the parenchyma in pith in the node. On the basis of the positive correlation, it is possible to estimate the rooting characteristics of new strains without having to prepare cuttings. Next, we conducted a screening for E. sinica strains on the basis of total alkaloids content [ephedrine (E) + pseudoephedrine (PE)] and selected strains having no less than 0.7% total alkaloids content as defined by the Japanese Pharmacopoeia 18th edition. Strains having characteristic E or PE content were uncovered: E-rich strains had 100% E content and PE-rich strains had 99% PE content. We were able to select E. sinica strains on the basis of two factors: high rooting rate of cuttings and high or characteristic alkaloid content. These strains are valuable for breeding.
Assuntos
Alcaloides , Antineoplásicos , Ephedra , Efedrina , PseudoefedrinaRESUMO
We investigated the seasonal variation of alkaloids (ephedrine and pseudoephedrine), total polyphenol, and sugar contents in Ephedra sinica cultivated in Japan and elucidated the controlling factors for the variation. In 2018, alkaloids and polyphenol contents increased dramatically from May to July, decreased to their lowest in October, and slightly increased again in November. The reduction of alkaloids and polyphenol contents in the autumn may be affected by precipitation in summer. In 2020, alkaloids and polyphenol contents started to decrease in late July when rainfall was abundant from July to August. In contrast, sucrose and starch contents continued to increase until September and remained high until October. Vascular bundles and fiber developed, and herbal stem weight increased from August to October. Alkaloids and total polyphenol contents tended to increase in November. At the same time, starch and sucrose contents decreased dramatically, whereas glucose and fructose contents increased. Sugar content decreased from October and was lowest in November. The seasonal variation of alkaloids and total polyphenol contents exhibited a contrasting tendency to the seasonal variation of sugar content and tissue development. The seasonal variation of alkaloids and total polyphenol contents was caused by the seasonal variation of sugar content and tissue development. In addition, it is suggested that anatomy may be used for alkaloids content estimation in Ephedra plants.
Assuntos
Alcaloides , Ephedra sinica , Ephedra , Estações do Ano , Japão , Efedrina , SacaroseRESUMO
ETHNOPHARMACOLOGICAL RELEVANCE: In our previous study, we reported that Ephedra Herb extract (EHE) increased the locomotor activity of mice in the open-field test and reduced the immobility time in the forced swim test. Ephedrine alkaloids (EAs) are thought to be responsible for the adverse effects of Ephedra Herb. However, there are no reports to verify that the adverse effects of Ephedra Herb are caused by the amount of EAs in the herb. Therefore, we investigated whether these adverse effects of EHE are caused by the amounts of ephedrine (Eph) and pseudoephedrine (Pse) in the herbal extract. In a preliminary study of the time course analysis of the open field test, we newly observed that EHE evoked switching from transient sedation to sustained excitement. AIM OF THE STUDY: We aimed to confirm whether EHE evokes switching from transient sedation to sustained excitement, investigate whether these actions of EHE are caused by the amount of ephedrine (Eph) and pseudoephedrine (Pse) in the herbal extract, and clarify the molecular mechanism of the transient sedative effect. MATERIALS AND METHODS: The locomotor activity of mice was tested using the open-field test. The immobility times were measured using a forced swim test, and the motor dysfunction in mice was tested using the rotarod test. RESULTS: EHE, Eph, and Pse induced transient motionlessness between 0 and 15 min after oral administration, however, they did not induce depression-like behavior and motor dysfunction in mice, suggesting that the motionlessness induced by EHE, Eph, or Pse resulted from sedation. The α2a adrenoceptor inhibitor, atipamezole, decreased their sedative effects. Thus, immediately after EHE administration, the transient sedative effect is mediated through the activation of the α2a adrenoreceptor by Eph and Pse. EHE and Eph increased total locomotor activity for 15-120 min after oral administration; however, Pse had no effect. Therefore, the slow-onset and sustained excitatory effects of EHE are mediated by Eph. CONCLUSIONS: We discovered for the first time that EHE evokes diphasic action by switching from transient sedation to sustained excitement. The transient sedation was evoked by the Eph and Pse in the herbal extract via activation of the α2a adrenoceptor and the sustained excitement was caused by the Eph in the herbal extract.
Assuntos
Alcaloides , Ephedra , Camundongos , Animais , Ephedra/química , Efedrina/farmacologia , Pseudoefedrina , Alcaloides/química , Extratos Vegetais/química , Hipnóticos e Sedativos/farmacologia , Receptores AdrenérgicosRESUMO
Nos últimos anos, a obesidade vem aumentando consideravelmente entre adultos e crianças e, segundo a OMS, estima-se que em 2025 o número de obesos ultrapasse a 2,3 milhões em todo o mundo. O indivíduo obeso apresenta maiores riscos de desenvolver doenças crônicas não transmissíveis, como diabetes, doenças cardiovasculares, dislipidemias e ainda alguns tipos de cânceres. O tratamento para a obesidade é variado e inclui mudanças no estilo de vida como: hábitos alimentares e prática de atividade física, tratamento medicamentoso, cirurgia bariátrica e fitoterápicos com o potencial de auxiliar no tratamento. O objetivo deste trabalho foi realizar uma revisão bibliográfica a fim de avaliar os benefícios da utilização de medicamentos fitoterápicos como auxiliar no tratamento da obesidade, seus principais ativos, mecanismos de ação e sua utilização popular. Dentre as plantas pesquisadas e que demonstraram potencial para atuar no tratamento da obesidade encontram-se Camelia sinensis, Citrus aurantium, Hibiscus sabdariffa, Coffea arabica, Ephedra sinica, Zingiber oficinale e Senna alexandrina. Os principais mecanismos de ação envolvidos no potencial anti-obesidade das plantas medicinais são a capacidade de controle do apetite e ingestão de energia, estímulo da termogênese, inibição da lipase pancreática e redução da absorção de gordura, diminuição da lipogênese e aumento da lipólise. Desta forma, conclui-se que as plantas selecionadas neste estudo apresentaram efeitos positivos nos parâmetros bioquímicos e físicos, podendo ser incluídas nos protocolos como coadjuvantes nos tratamentos de emagrecimento.
In recent years, obesity has increased considerably among adults and children and according to the WHO, it is estimated that in 2025 the number of obese people will exceed 2.3 million worldwide. The obese individual is at greater risk of developing non-communicable chronic diseases, such as diabetes, cardiovascular disease, dyslipidemia and even some types of cancer. The treatment for obesity is varied, including changes in lifestyle such as eating habits and physical activity, drug treatment, bariatric surgery and phytotherapy with the potential to aid in the treatment. The objective of this work was to carry out a literature review, evaluating the benefits of using herbal medicines as an aid in the treatment of obesity, their main assets, mechanisms of action and their popular use. Among the plants researched and that have shown potential to act in the treatment of obesity are Camelia sinensis, Citrus aurantium, Hibiscus sabdariffa, Coffea arabica, Ephedra sinica, Zingiber officiale and Senna alexandrina. The main mechanisms of action involved in the antiobesity potential of medicinal plants are the ability to control appetite and energy intake, thermogenesis stimulation, pancreatic lipase inhibition and reduction of fat absorption, lipogenesis decrease and lipolysis increase. Thus, it is concluded that the plants selected in this study showed positive effects on biochemical and physical parameters, and can be included in the protocols as adjuvants in weight loss treatments.
En los últimos años, la obesidad ha aumentado considerablemente entre adultos y niños y, según la OMS, se estima que en 2025 el número de obesos superará los 2,3 millones en todo el mundo. Los individuos obesos tienen un mayor riesgo de desarrollar enfermedades crónicas no transmisibles, como la diabetes, las enfermedades cardiovasculares, las dislipidemias e incluso algunos tipos de cáncer. El tratamiento de la obesidad es variado e incluye cambios en el estilo de vida como: hábitos alimenticios y práctica de actividad física, tratamiento farmacológico, cirugía bariátrica y medicamentos a base de hierbas con potencial para ayudar en el tratamiento. El objetivo de este trabajo fue realizar una revisión bibliográfica para evaluar los beneficios del uso de las hierbas medicinales como ayuda en el tratamiento de la obesidad, sus principales activos, mecanismos de acción y su uso popular. Entre las plantas investigadas y que mostraron potencial para actuar en el tratamiento de la obesidad están Camelia sinensis, Citrus aurantium, Hibiscus sabdariffa, Coffea arabica, Ephedra sinica, Zingiber oficinale y Senna alexandrina. Los principales mecanismos de acción implicados en el potencial antiobesidad de las plantas medicinales son la capacidad de controlar el apetito y la ingesta de energía, estimular la termogénesis, inhibir la lipasa pancreática y reducir la absorción de grasas, disminuir la lipogénesis y aumentar la lipólisis. Por lo tanto, se concluye que las plantas seleccionadas en este estudio mostraron efectos positivos sobre los parámetros bioquímicos y físicos, y pueden ser incluidas en los protocolos como coadyuvantes en los tratamientos de pérdida de peso.
Assuntos
Medicamento Fitoterápico , Obesidade/terapia , Plantas Medicinais/efeitos dos fármacos , Chá/efeitos dos fármacos , Redução de Peso/efeitos dos fármacos , Citrus/efeitos dos fármacos , Zingiber officinale/efeitos dos fármacos , Sobrepeso/terapiaRESUMO
Pinellia ternata (Thunb.) Druce is a traditional medicinal plant containing a variety of alkaloids, which are important active ingredients. Brassinolide (BR) is a plant hormone that regulates plant response to environmental stress and promotes the accumulation of secondary metabolites in plants. However, the regulatory mechanism of BR-induced alkaloid accumulation in P. ternata is not clear. In this study, we investigated the effects of BR and BR biosynthesis inhibitor (propiconazole, Pcz) treatments on alkaloid biosynthesis in the bulbil of P. ternata. The results showed that total alkaloid content and bulbil yield was enhanced by 90.87% and 29.67% under BR treatment, respectively, compared to the control. We identified 818 (476 up-regulated and 342 down-regulated) and 697 (389 up-regulated and 308 down-regulated) DEGs in the BR-treated and Pcz-treated groups, respectively. Through this annotated data and the Kyoto encyclopedia of genes and genomes (KEGG), the expression patterns of unigenes involved in the ephedrine alkaloid, tropane, piperidine, pyridine alkaloid, indole alkaloid, and isoquinoline alkaloid biosynthesis were observed under BR and Pcz treatments. We identified 11, 8, 2, and 13 unigenes in the ephedrine alkaloid, tropane, piperidine, and pyridine alkaloid, indole alkaloid, and isoquinoline alkaloid biosynthesis, respectively. The expression levels of these unigenes were increased by BR treatment and were decreased by Pcz treatment, compared to the control. The results provided molecular insight into the study of the molecular mechanism of BR-promoted alkaloid biosynthesis.
Assuntos
Alcaloides , Pinellia , Alcaloides/metabolismo , Brassinosteroides , Efedrina , Perfilação da Expressão Gênica , Isoquinolinas/metabolismo , Pinellia/genética , Piperidinas/metabolismo , Reguladores de Crescimento de Plantas/metabolismo , Reguladores de Crescimento de Plantas/farmacologia , Piridinas/metabolismo , Esteroides Heterocíclicos , Transcriptoma , TropanosRESUMO
The study objective was to analyse the phytochemical constituents in aerial extracts of these plants using an HPTLC method and optimization by quality by design. Qualitative analysis of ephedrine in hydro-alcoholic extract was done via HPTLC, using a mobile phase of toluene-ethyl acetate-chloroform-formic acid in the ratio of 1:0.5:0.5:01 and the peaks were monitored at 366 nm. In the hydro-alcoholic aerial part extract, ephedrine was identified using the HPTLC method and the retardation factor (Rf) value was found to be 0.69 ± 0.01 and 0.69 ± 0.01, as compared with the standard sample. The extraction of plant materials was done using different concentration of water and alcohol solvents and quality by design was applied to optimize the extraction process and to find out the best extraction in an 80:20 ratio of hydro-alcoholic extract. In the hydro-alcoholic extract, the ephedrine was characterized using the HPTLC method and compared with the standard solution, and this method was used in herbal as well as academic research for the identification of ephedrine in poly herbal formulations as well as the ephedrine present in different plant extracts. Response surface methodology software was utilized to predict the path or choose the best extraction method. Sida rhombifolia and Sida cordifolia can be used as substitutes for Ephedra gerardiana based on the HPTLC profile.
Assuntos
Efedrina , Extratos Vegetais , Efedrina/análise , Extratos Vegetais/química , Compostos Fitoquímicos , Solventes , ClorofórmioRESUMO
The Chinese medicinal herb Mahuang is herbaceous stem of Ephedra sinica, E. intermedia, or E. equisetina(Family, Ephedraceae). In China, Mahuang has been used, all the way over a millennium, as a key component herb of many herbal medicines for management of epidemics of acute respiratory illness and is also used in officially recommended herbal medicines for COVID-19. Mahuang is the first-line medicinal herb for cold and wheezing and also an effective diuretic herb for edema. However, Mahuang can also exert significant adverse effects. The key to safety and effectiveness is rational and precise use of the herb. In this review article, we comprehensively summarize chemical composition of Mahuang and associated differences in pharmacognosy, pharmacodynamics and pharmacokinetics of Mahuang compounds, along with the adverse effects of Mahuang compounds and products. Based on full understanding of how Mahuang is used in Chinese traditional medicine, systematic research on Mahuang in line with contemporary standards of pharmaceutical sciences will facilitate promoting Chinese herbal medicines to become more efficient in management of epidemic illnesses, such as COVID-19. To this end, we recommend research on Mahuang of two aspects, i.e., pharmacological investigation for its multicompound-involved therapeutic effects and toxicological investigation for clinical manifestation of the adverse effects, chemicals responsible for the adverse effects, and conditions for safe use of the herb and the herb-containing medicines.
Assuntos
Tratamento Farmacológico da COVID-19 , Medicamentos de Ervas Chinesas , Ephedra sinica , Ephedra , Medicamentos de Ervas Chinesas/química , Medicamentos de Ervas Chinesas/farmacologia , Ephedra sinica/química , Efedrina/química , Humanos , PlantasRESUMO
In the Kaluxung River catchment of the southeastern Tibetan Plateau in China, we identified three Ephedra gerardiana communities on different soils and glacial landforms from 4842 to 4899 m above sea level: a moraine community located on constantly collapsing sandy gravel alpine steppe slopes with exposed bedrock on the outer slope of the terminal moraine of the Qiangyong Glacier on Mt. Kaluxung; an outwash plain community located on a gentle alpine steppe slope with exposed bedrock at the terminal end of the outwash plain in the glacial valley of the southeast side of Mt. Noijinkangsang; and a river terrace community located in an alpine meadow on a rock-scattered flat river terrace along a glacier-fed river in the outwash plain in the glacial valley of the southeast side of Mt. Noijinkangsang. Based on the finding of identical DNA sequences of the intergenic spacers of chloroplast trnT-trnF and trnS-trnfM regions for all Ephedra specimens examined in this study, the E. gerardiana in this study were considered to comprise a genetically homogeneous population. Analysis of the relationship between ephedrine alkaloid profiles of these three communities and soil characteristics showed that the river terrace community in wet alpine meadow had significantly lower ephedrine content than did the moraine and outwash plain communities in dry alpine steppe (moraine community, 1.52 ± 0.44; outwash plain community, 1.42 ± 0.68; river terrace community, 0.33 ± 0.65%DW), but pseudoephedrine content showed the reverse pattern (moraine community, 0.86 ± 0.30; outwash plain community, 0.73 ± 0.60; river terrace community, 1.50 ± 0.71%DW). In addition, total alkaloid (ephedrine and pseudoephedrine) content in the river terrace community (1.83 ± 0.24%DW) was significantly lower than that in the moraine community (2.38 ± 0.64%DW) and outwash plain community (2.15 ± 0.55%DW).
Assuntos
Alcaloides , Ephedra , China , Ephedra/genética , Efedrina , Pseudoefedrina , Solo , TibetRESUMO
Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.
Assuntos
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleotídeos , Extratos VegetaisRESUMO
Ephedrae Herba is one of the most commonly used herbal medicines, and it has been shown that most of the clinical efficacy for cold and asthma is exerted by its alkaloidal components. A simple and sensitive high-performance liquid chromatography method was developed using a perfluorooctyl column for the simultaneous determination of five alkaloids (norephedrine, norpseudoephedrine, ephedrine, pseudoephedrine, and methylephedrine) in Ephedrae Herba. The mobile phase comprising acetonitrile and 15 mM ammonium trifluoroacetate was used to elute the targets in isocratic elution mode. The method was validated for linearity (R2 > 0.999), repeatability, intraday and interday precision, recoveries with trueness (93.87-110.99%), limits of detection (5.35-5.76 µg/mL), and limits of quantification (20 µg/mL). The quantitative results revealed that the developed method was precise and accurate. Then it was successfully applied to determine the difference in the contents of three batches of Ephedrae Herba from three pharmaceutical companies.
Assuntos
Alcaloides , Medicamentos de Ervas Chinesas , Cromatografia Líquida de Alta Pressão , Medicamentos de Ervas Chinesas/análise , Efedrina/análise , Pseudoefedrina/análiseRESUMO
The pathogenic hyper-inflammatory response has been revealed as the major cause of the severity and death of the Corona Virus Disease 2019 (COVID-19). Xuanfei Baidu Decoction (XFBD) as one of the "three medicines and three prescriptions" for the clinically effective treatment of COVID-19 in China, shows unique advantages in the control of symptomatic transition from moderate to severe disease states. However, the roles of XFBD to against hyper-inflammatory response and its mechanism remain unclear. Here, we established acute lung injury (ALI) model induced by lipopolysaccharide (LPS), presenting a hyperinflammatory process to explore the pharmacodynamic effect and molecular mechanism of XFBD on ALI. The in vitro experiments demonstrated that XFBD inhibited the secretion of IL-6 and TNF-α and iNOS activity in LPS-stimulated RAW264.7 macrophages. In vivo, we confirmed that XFBD improved pulmonary injury via down-regulating the expression of proinflammatory cytokines such as IL-6, TNF-α and IL1-ß as well as macrophages and neutrophils infiltration in LPS-induced ALI mice. Mechanically, we revealed that XFBD treated LPS-induced acute lung injury through PD-1/IL17A pathway which regulates the infiltration of neutrophils and macrophages. Additionally, one major compound from XFBD, i.e. glycyrrhizic acid, shows a high binding affinity with IL17A. In conclusion, we demonstrated the therapeutic effects of XFBD, which provides the immune foundations of XFBD and fatherly support its clinical applications.
Assuntos
Lesão Pulmonar Aguda/tratamento farmacológico , Medicamentos de Ervas Chinesas/farmacologia , Interleucina-17/metabolismo , Macrófagos/efeitos dos fármacos , Neutrófilos/efeitos dos fármacos , Receptor de Morte Celular Programada 1/metabolismo , Transdução de Sinais/efeitos dos fármacos , Lesão Pulmonar Aguda/metabolismo , Animais , COVID-19/metabolismo , Linhagem Celular , China , Citocinas/metabolismo , Contagem de Leucócitos/métodos , Macrófagos/metabolismo , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Neutrófilos/metabolismo , Células RAW 264.7 , Tratamento Farmacológico da COVID-19RESUMO
ETHNOPHARMACOLOGICAL RELEVANCE: The stems of Ephedra sinica and the fruits of Terminalia chebula are combined using in traditional Mongolian medicine formula "Gurigumu-7" for liver diseases. E. sinica stems contains ephedrine with broncho-dilatory activity. However, ephedrine can pass through the blood-brain barrier (BBB) and excite the central nervous system (CNS) to cause insomnia and restlessness. AIM OF THE STUDY: The present study was to investigate the structures and bioactivities of new compounds formed in vivo after co-administration of E. sinica stems and T. chebula fruits. MATERIALS AND METHODS: Pharmacokinetic investigation was carried out in rats. A parallel artificial membrane permeability measurement system was used to determine BBB permeability. Ex vivo experiments using tracheal rings of guinea pig was performed to examine the tracheal relaxation effect. In vivo hepatoprotective tests were carried out in Tg (fabp10a: dsRed) liver transgenic zebrafish. The fluorescent probe, 2,7-dichlorodihydrofluorescein diacetate, was used to measure reactive oxygen species, and UHPLC-MS was used to determine glutathione concentrations after derivatization with N-ethylmaleimide. RESULTS: New ephedrine derivatives (1 and 2) formed in vivo and reached their maximum serum concentrations at 0.5 h after administration of the two herbal drugs. Compounds 1 and 2 showed lower BBB permeability than ephedrine, suggesting that they have less adverse effects on the CNS. Compounds 1 and 2 relaxed the tracheal rings and had strong hepatoprotective effect on transgenic zebrafish with liver specific expression of RFP. Compounds 1 and 2 significantly reduced the level of reactive oxygen species while increasing that of glutathione in thioacetamide-treated zebrafish, which might be the hepatoprotective mechanism. CONCLUSION: These results provided evidences that the chemical constituents in various herbal drugs in a medicinal formula can interact to generate new compounds with fewer side effects and increased or additive bioactivity.
Assuntos
Ephedra sinica/química , Efedrina , Extratos Vegetais/farmacologia , Distúrbios do Início e da Manutenção do Sono , Terminalia/química , Animais , Barreira Hematoencefálica/efeitos dos fármacos , Broncodilatadores/farmacologia , Sistema Nervoso Central/efeitos dos fármacos , Combinação de Medicamentos , Efedrina/análogos & derivados , Efedrina/farmacocinética , Cobaias , Extratos Vegetais/química , Ratos , Distúrbios do Início e da Manutenção do Sono/induzido quimicamente , Distúrbios do Início e da Manutenção do Sono/prevenção & controleRESUMO
A sensitive and reproducible liquid chromatography-tandem mass spectrometry (LC-MS/MS) system was developed and fully validated for the simultaneous determination of ephedrine and pseudoephedrine in human plasma after oral administration of the herbal prescription Ojeok-san (OJS); 2-phenylethylamine was used as the internal standard (IS). Both compounds presented a linear calibration curve (r2 ≥ 0.99) over a concentration range of 0.2-50 ng/mL. The developed method was fully validated in terms of selectivity, lower limit of quantitation, precision, accuracy, recovery, matrix effect, and stability, according to the regulatory guidelines from the U.S. Food and Drug Administration and the Korea Ministry of Food and Drug Safety. This validated method was successfully applied for the pharmacokinetic assessment of ephedrine and pseudoephedrine in 20 healthy Korean volunteers administered OJS.
Assuntos
Efedrina , Extratos Vegetais/administração & dosagem , Pseudoefedrina , Espectrometria de Massas em Tandem , Administração Oral , Cromatografia Líquida , Efedrina/administração & dosagem , Efedrina/farmacocinética , Feminino , Humanos , Masculino , Pseudoefedrina/administração & dosagem , Pseudoefedrina/farmacocinética , República da CoreiaRESUMO
The coronavirus disease 2019 has infected over 150 million people worldwide and led to over 3 million deaths. Severe acute respiratory syndrome (SARS)-CoV-2 lineages B.1.1.7, B.1.617, B.1.351, and P.1 were reported to have higher infection rates than that of wild one. These mutations were noticed to happen in the receptor-binding domain of spike protein (S-RBD), especially mutations N501Y, E484Q, E484K, K417N, K417T, and L452R. Currently, there is still no specific medicine against the virus; moreover, cytokine storm is also a dangerous factor for severe infected patients. In this study, potential S-RBD-targeted active monomers from traditional Chinese medicine Ephedra sinica Stapf (ephedra) were discovered by virtual screening. NanoBiT assay was performed to confirm blocking activities of the screened compounds against the interaction between SARS-CoV-2 S-RBD and angiotensin-converting enzyme 2 (ACE2). We further analyzed the blocking effect of the active compounds on the interactions of mutated S-RBD and ACE2 by computational studies. Moreover, antiinflammatory activities were evaluated using qRT-PCR, enzyme-linked immune sorbent assay, and Western blot analysis. As a result, pseudoephedrine (MHJ-17) and its derivative (MHJ-11) were found as efficient inhibitors disrupting the interactions between ACE2 and both wild and mutated S-RBDs. In addition, they also have antiinflammatory activities, which can be potential drug candidates or lead compounds for further study.
Assuntos
COVID-19 , Pseudoefedrina , Humanos , Ligação Proteica , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus/metabolismoRESUMO
The purpose of this study was to investigate the pharmacokinetic properties of ephedrine, paeoniflorin, and cinnamic acid after single or multiple doses of Socheongryong-tang (SCRT) were administered to rats, and to present an example of the pharmacokinetic changes following multiple doses of an herbal medicine. SCRT is a traditional herbal medicine that has been used clinically for a long time, and its main ingredients include ephedrine, paeoniflorin, and cinnamic acid. However, studies on the pharmacokinetic properties of SCRT are insufficient, and particularly, no pharmacokinetic information has been reported for multiple doses. In this study, SCRT was administered orally to rats once or multiple times, and plasma sampled at different times was quantitatively analyzed for ephedrine, paeoniflorin, and cinnamic acid using ultra-high-performance liquid chromatography-tandem mass spectrometry. There was a difference between the pharmacokinetic parameter values of each component (especially in paeoniflorin and cinnamic acid) obtained after single or multiple doses of SCRT. The actual observed values of each component obtained after multiple doses of SCRT were clearly different from the predicted results of multiple-dose simulations based on the pharmacokinetic profiles obtained after a single dose. The results confirmed that the plasma concentrations and, thus, exposures to paeoniflorin and cinnamic acid were significantly increased when SCRT was administered multiple times, whereas that of ephedrine was not. The results of this study are expected to provide useful pharmacokinetic data for the safety and efficacy evaluation of SCRT in the future and demonstrate the necessity of pharmacokinetic comparison studies according to single or multiple oral administrations of herbal medicines.
RESUMO
A highly specific and sensitive proton nuclear magnetic resonance (1H-NMR) method has been developed for the quantification of ephedrine alkaloid derivatives in Ephedra herbal commercial prescriptions. At the region of δ 4.0 to 5.0 ppm in the 1H NMR spectrum, the characteristic signals are separated well from each other, and six analogues in total, methylephedrine (ME), ephedrine (EP), norephedrine (NE), norpseudoephedrine (NP), pseudoephedrine (PE), and methylpseudoephedrine (MP) could be identified. The quantities of these compounds are calculated by the relative ratio of the integral values of the target peak for each compound to the known concentrations of the internal standard anthracene. The present method allows for a rapid and simple quantification of ephedrine alkaloid derivatives in Ephedra-related commercial prescriptions without any preliminary purification steps and standard compounds, and accordingly it can be a powerful tool to verify different Ephedra species. In comparison to conventional chromatographic methods, the advantages of this method include the fact that no standard compounds are required, the quantification can be directly performed on the crude extracts, a better selectivity for various ephedrine alkaloid derivatives, and the fact that a very significant time-gain may be achieved.