Simultaneous inorganic nitrogen and phosphate removal by aerobic-heterotrophic fungus Fusarium keratoplasticum FSP1: Performance, pathway and application.

Fungi with multiple contaminant removal function have rarely been studied. Here, a novel fungal strain Fusarium keratoplasticum FSP1, which was isolated from halophilic granular sludge, is reported for first time to perform simultaneous nitrogen and phosphate removal. The strain showed wide adaptability under C/N ratios of 30-35, salinities of 0 %-3 % (m/v), and pH of 7.5-9.5. The maximum removal rates of ammonium, nitrate and nitrite were 4.43, 4.01 and 2.97 mg N/L/h. The nitrogen balance, enzyme activity and substrate conversion experiments demonstrated a single strain FSP1 can assimilate inorganic nitrogen and convert inorganic nitrogen to gaseous nitrogen through heterotrophic nitrification or aerobic denitrification. About 39 %-42 % of the degraded phosphorus was in the extracellular polymeric substances (EPS). Orthophosphate was the main phosphorus species in the cell, whereas phosphate monoester and diester were in the EPS. The novel strain FSP1 is a potential candidate for wastewater treatment.

Meta-omics profiling of full-scale groundwater rapid sand filters explains stratification of iron, ammonium and manganese removals.

Rapid sand filters (RSF) are an established and widely applied technology for groundwater treatment. Yet, the underlying interwoven biological and physical-chemical reactions controlling the sequential removal of iron, ammonia and manganese remain poorly understood. To resolve the contribution and interactions between the individual reactions, we studied two full-scale drinking water treatment plant configurations, namely (i) one dual-media (anthracite and quartz sand) filter and (ii) two single-media (quartz sand) filters in series. In situ and ex situ activity tests were combined with mineral coating characterization and metagenome-guided metaproteomics along the depth of each filter. Both plants exhibited comparable performances and process compartmentalization, with most of ammonium and manganese removal occurring only after complete iron depletion. The homogeneity of the media coating and genome-based microbial composition within each compartment highlighted the effect of backwashing, namely the complete vertical mixing of the filter media. In stark contrast to this homogeneity, the removal of the contaminants was strongly stratified within each compartment, and decreased along the filter height. This apparent and longstanding conflict was resolved by quantifying the expressed proteome at different filter heights, revealing a consistent stratification of proteins catalysing ammonia oxidation and protein-based relative abundances of nitrifying genera (up to 2 orders of magnitude difference between top and bottom samples). This implies that microorganisms adapt their protein pool to the available nutrient load at a faster rate than the backwash mixing frequency. Ultimately, these results show the unique and complementary potential of metaproteomics to understand metabolic adaptations and interactions in highly dynamic ecosystems.

The phosphorus harvest from low-temperature mainstream wastewater through iron phosphate crystallization in a pilot-scale partial nitritation/anammox reactor.

The phosphorus harvest along nitrogen removal in the partial nitritation/anammox (PNA) reactor is promising for saving space and simplifying the management of mainstream wastewater treatment facilities. In this study, the phosphorus recovery from the low-temperature mainstream wastewater was explored through iron phosphate crystallization in a pilot-scale PNA reactor. With the COD-alleviated municipal wastewater as the influent, the ammonium concentration of about 50 mg/L and the phosphorus concentration ranged from 5.4 to 7.1 mg/L, under the temperature of 15 °C and the addition of external ferrous iron of 14 mg/L, the achieved nitrogen removal efficiency and the phosphorus removal efficiency were 37.6 % and 62.7 %, respectively. The good settleability of sludge indicated that the formed iron phosphate was well combined with the biomass. The quantitative analysis confirmed that the main iron phosphate in dry sludge was graftonite, and qualitative analysis confirmed that the equivalent of P2O5 content in the sludge was 5.8 %, which was suitable as fertilizer on agricultural land to realize the direct recycle of discharged phosphorus. In all, this study proposed a pioneering scheme to realize the nitrogen removal and phosphorus cycle in human society and given a meaningful reference for further research and application.

Effectiveness of Green Chemical Solvent-based on Triethylammonium Methanesulfonate Ion Liquid for the OPEFB Pretreatment Process.

Many studies have explored the pretreatment of lignocellulosic biomass based on oil palm empty fruit bunch (OPEFB) which is categorized as potential biomass waste for bioethanol production. Before proceeding further to obtain bioethanol, several steps such as pretreatment to increase organic constituents are needed. The ionic liquids (ILs) were commonly investigated by many researchers for lignocellulosic pretreatment because it is easy solubilization property, non-toxic, and not harmful impacts on the environment. Therefore in this study, the hypothesis and main objective were to observe the effectiveness of triethylammonium methanesulfonate ion liquid (TMS IL) in the OPEFB lignocellulose pretreatment process. Three variations were studied to obtain optimization of the pretreatment process, such as times duration, IL composition, and temperature. Based on these results, we observed the effectiveness of the time duration for OPEFB pretreatment of 20 hours. Furthermore, it was applied to determine the optimization of IL composition and temperature showing that using 91% (1:1:10) at 120°C for 20 hours has provided good performance for the OPEFB lignocellulose pretreatment process. TMS IL has exhibited the ability to reduce hemicellulose and lignin contents to 7.35% and 17.80%, whereas cellulose was increased by 54.24%. This has the opportunity to be projected to a larger scale for bioethanol production based on OPEFB lignocellulose.

Synthesis of Ammonium-Based Ionic Liquids for the Extraction Process of a Natural Pigment (Betanin).

The use of new synthesized ammonium-based ionic liquids was explored as an alternative to the current process implemented in the betanin extraction from red beet juice, resulting in high yields: 70% and 82%. Betanin is a vegetal pigment that has been applied to a large variety of products in the food industry, which is important, for it can work as a substitute for the red synthetic dyes used nowadays. Additionally, the use of the kosmotropic salt sodium acetate was explored in order to separate the complex formed by the ionic liquid and pigment of interest in a process that combined two techniques: ATPS (aqueous two-phase system) and SOES (salting-out extraction system). The results reveal that the studied techniques could work as a novel process for the extraction of betanin from red beet juice employing ionic liquids, which have not been tested for this purpose in other research.

Assessment of anammox, microalgae and white-rot fungi-based processes for the treatment of textile wastewater.

The treatability of seven wastewater samples generated by a textile digital printing industry was evaluated by employing 1) anammox-based processes for nitrogen removal 2) microalgae (Chlorella vulgaris) for nutrient uptake and biomass production 3) white-rot fungi (Pleurotus ostreatus and Phanerochaete chrysosporium) for decolorization and laccase activity. The biodegradative potential of each type of organism was determined in batch tests and correlated with the main characteristics of the textile wastewaters through statistical analyses. The maximum specific anammox activity ranged between 0.1 and 0.2 g N g VSS-1 d-1 depending on the sample of wastewater; the photosynthetic efficiency of the microalgae decreased up to 50% during the first 24 hours of contact with the textile wastewaters, but it improved from then on; Pleurotus ostreatus synthetized laccases and removed between 20-62% of the colour after 14 days, while the enzymatic activity of Phanerochaete chrysosporium was inhibited. Overall, the findings suggest that all microbes have great potential for the treatment and valorisation of textile wastewater after tailored adaptation phases. Yet, the depurative efficiency can be probably enhanced by combining the different processes in sequence.

Structure of Yak Lactoperoxidase at 1.55 Å Resolution.

Lactoperoxidase (LPO) is a heme containing oxido-reductase enzyme. It is secreted from mammary, salivary, lachrymal and mucosal glands. It catalyses the conversion of thiocyanate into hypothiocyanate and halides into hypohalides. LPO belongs to the superfamily of mammalian heme peroxidases which also includes myeloperoxidase (MPO), eosinophil peroxidase (EPO) and thyroid peroxidase (TPO). The heme prosthetic group is covalently linked in LPO through two ester bonds involving conserved residues Glu258 and Asp108. It was isolated from colostrum of yak (Bos grunniens), purified to homogeneity and crystallized using ammonium iodide as a precipitating agent. The crystals belonged to monoclinic space group P21 with cell dimensions of a = 53.91 Å, b = 78.98 Å, c = 67.82 Å and ß = 92.96°. The structure was determined at 1.55 Å resolution. This is the first structure of LPO from yak. Also, this is the highest resolution structure of LPO determined so far from any source. The structure determination revealed that three segments (Ser1-Cys15), (Thr117-Asn138) and (Cys167-Leu175) were disordered and formed one surface of LPO structure. In the substrate binding site, the iodide ions were observed in three subsites which are formed by (1) heme moiety and residues, Gln105, Asp108, His109, Phe113, Arg255, Glu258, Phe380 and Phe381, (2) residues, Asn230, Lys232, Pro236, Cys248, Phe254, Phe381 and Pro424 and (3) residues, Ser198, Leu199 and Arg202. The structure determination also revealed that the side chain of Phe254 was disordered. It was observed to adopt two conformations in the structures of LPO.

Recovery phosphate and ammonium from aqueous solution by the process of electrochemically decomposing dolomite.

The cost-effective recovery of phosphate is of great significance to the mitigation of phosphorus resource depletion crisis. The electrochemical-decomposition of dolomite was developed to recover phosphate and ammonium from aqueous solution. The dolomite ore is mainly composed of CaMg(CO3)2 (53.73%), CaCO3 (28.93%) and SiO2 (16.59%). The continuous release of Mg2+ and Ca2+ were achieved by electrochemically decomposing dolomite ore, accompanied by the generation of base solution (9.0-10.5). The main factors affecting the recovery performance of phosphate (PO4-P) and ammonium (NH4-N) are current, initial concentration of PO4-P and NH4-N, initial pH of feed solution and feed rate. For a 30-d operation, the recovery rate of PO4-P was maintained at 90-97% and that of NH4-N at 50-60% under optimized operating conditions. The recovered product had low water solubility but high citric-acid-soluble, and was proposed as a slow-release fertilizer for crops. The proposed process as a simple, effective and green route may serve as a new strategy for recovering PO4-P and NH4-N from wastewaters.

Antibacterial, Antifungal and Ecotoxic Effects of Ammonium and Imidazolium Ionic Liquids Synthesized in Microwaves.

Ionic liquids are increasingly used for their superior properties. Four water-immiscible ionic liquids (butyltriethylammonium bis(trifluoromethylsulfonyl)imide, octyltriethylammonium bis(trifluoromethylsulfonyl)imide, dodecyltriethylammonium bis(trifluoromethylsulfonyl)imide, butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide) and their water miscible precursors (bromides) were synthesized in a microwave reactor and by conventional heating. The best conditions for microwave-assisted synthesis concerning the yield and the purity of the product are proposed. The heating in the microwave reactor significantly shortened the reaction time. Biocide and ecotoxic effects of synthesized ionic liquids and their precursors were investigated. All tested compounds had at least a little effect on the growth or living of microorganisms (bacteria or mold). The precursor dodecyltriethylammonium bromide was found to be the strongest biocide, but posed a risk to the aquatic environment due to its relatively high EC50 value in the test with Vibrio fischeri. We assumed that apart from the alkyl chain length, the solubility in water, duration of action, or type of anion can influence the final biocide and ecotoxic effect.

Novel Acetylcholinesterase Inhibitors Based on Uracil Moiety for Possible Treatment of Alzheimer Disease.

In this study, novel derivatives based on 6-methyluracil and condensed uracil were synthesized, namely, 2,4-quinazoline-2,4-dione with ω-(ortho-nitrilebenzylethylamino) alkyl chains at the N atoms of the pyrimidine ring. In this series of synthesized compounds, the polymethylene chains were varied from having tetra- to hexamethylene chains, and secondary NH, tertiary ethylamino, and quaternary ammonium groups were introduced into the chains. The molecular modeling of the compounds indicated that they could function as dual binding site acetylcholinesterase inhibitors, binding to both the peripheral anionic site and active site. The data from in vitro experiments show that the most active compounds exhibit affinity toward acetylcholinesterase within a nanomolar range, with selectivity for acetylcholinesterase over butyrylcholinesterase reaching four orders of magnitude. In vivo biological assays demonstrated the potency of these compounds in the treatment of memory impairment using an animal model of Alzheimer disease.

Phosphonium-ammonium-based di-cationic ionic liquids as antibacterial over the ESKAPE group.

Emergence of antibioresistance is currently a major threat of public health worldwide. Hence there is an urge need of finding new antibacterial material. Herein, we report a simple and eco-friendly method to synthesize homo and heterodicationic ionic liquids based on quaternary phosphonium and ammonium salt. In order to investigate the structure activity relationship (SAR) we measured the MICs of a series of 16 derivatives with structural variations (nature of cations and counter-ions, size of linker and alkyl side chains as well as structural symmetry) over a range of Gram-positive and Gram-negative bacterial strains from the ESKAPE group. Some of the tested structures exhibit high antimicrobial activities (MIC = 0.5 mg/L) and are active over a wide range of bacteria from Gram-positive to Gram-negative. Overall, these results reveal the strong potential of di-cationic derivatives as antibacterial agents and the determination of activities from structural features gives decisive information for future synthesis of such di-cationic structures for biocidal purpose.

Postpartum supplementation with fermented ammoniated condensed whey altered nutrient partitioning to support hepatic metabolism.

Our previously published paper demonstrated that fermented ammoniated condensed whey (FACW) supplementation improved feed efficiency and metabolic profile in postpartum dairy cows. The objective of this study was to further explore the effects of FACW supplementation on liver triglyceride content, hepatic gene expression and protein abundance, and plasma biomarkers related to liver function, inflammation, and damage. Individually fed multiparous Holstein cows were blocked by calving date and randomly assigned to postpartum (1 to 45 d in milk, DIM) isonitrogenous treatments: control diet (n = 20) or diet supplemented with FACW (2.9% dry matter of diet as GlucoBoost; Fermented Nutrition, Luxemburg, WI, replacing soybean meal; n = 19). Liver biopsies were performed at 14 and 28 DIM for analysis of mRNA expression, protein abundance, and liver triglyceride content. There was marginal evidence for a reduction in liver triglyceride content at 14 DIM in FACW-supplemented cows compared with the control group. Cows supplemented with FACW had greater mRNA expression of glucose-6-phosphatase at 14 DIM relative to control. Supplementation with FACW increased mRNA expression of pyruvate carboxylase (PC), but did not alter cytosolic phosphoenolpyruvate carboxykinase (PCK1), resulting in a 2.4-fold greater PC:PCK1 ratio for FACW-supplemented cows compared with control. There was no evidence for a FACW effect on mRNA expression of propionyl-CoA carboxylase nor on mRNA expression or protein abundance of lactate dehydrogenase A or B. Cows supplemented with FACW had lower plasma urea nitrogen compared with control. Plasma l-lactate was greater for FACW-supplemented cows compared with control at 2 h before feeding time at 21 DIM. There was no evidence for altered expression of IL1B or IL10, or blood biomarkers related to liver function and damage. Greater glucose-6-phosphatase and PC gene expression, together with greater blood glucose and similar milk lactose output, suggests that FACW increased the supply of glucose precursors, resulting in greater gluconeogenesis between 3 and 14 DIM. Greater hepatic PC:PCK1 ratio, together with previously reported decreased plasma ß-hydroxybutyrate and the marginal evidence for lower liver triglyceride content at 14 DIM, suggests greater hepatic capacity for complete oxidation of fatty acids in FACW-supplemented cows compared with control. Overall, improvements in metabolite profile and feed efficiency observed with postpartum supplementation of FACW may be attributed to increased gluconeogenic and anaplerotic precursors, most likely propionate, due to modulated rumen fermentation.

Vegetable oil-based polyurethanes as antimicrobial wound dressings: in vitro and in vivo evaluation.

Preparation of efficient polyurethane-type wound dressings with tunable physicomechanical properties and widespread antimicrobial activity is considered in this work. A new type of soybean oil-based polyol with built-in urethane and quaternary ammonium groups is synthesized through a nonisocyanate route using carbonated soybean oil as an environmentally friendly, renewable resource-based raw material. Different formulations from this polyol and castor oil are prepared and converted to the polyurethane wound dressings via a reaction with isophorone diisocyanate. The dressing sample, with good cytocompatibility and efficient antimicrobial activity against various microbial strains, having tensile strength of 5 and 17 MPa at hydrated and dry state, elongation at the break of up to 400%, equilibrium water absorption and a water vapor transmission rate of 50% and 390 g m-2 day-1, is used for in vivo assay on a rat. Evaluation of the optimized dressing for a full-thickness non-sterilized wound has shown excellent progress of wound healing, since the tensile strength of regenerated skin reaches about 80% of normal healthy skin on day 21 after wounding. This has been significantly superior to the tensile strength of the regenerated skin of rats covered with non-antibacterial (∼50%) and cotton gauze (∼40%) dressings as blank and control groups.

A rapid ammonium fluoride method to determine the oxygen isotope ratio of available phosphorus in tropical soils.

RATIONALE: The isotopic composition of oxygen bound to phosphorus (δ18 OP value) offers an opportunity to gain insight into P cycling mechanisms. However, there is little information for tropical forest soils, which presents a challenge for δ18 OP measurements due to low available P concentrations. Here we report the use of a rapid ammonium fluoride extraction method (Bray-1) as an alternative to the widely used anion-exchange membrane (AEM) method for quantification of δ18 OP values of available P in tropical forest soils. METHODS: We compared P concentrations and δ18 OP values of available and microbial P determined by AEM and Bray-1 extraction for a series of tropical forest soils from Panama spanning a steep P gradient. This involved an assessment of the influence of extraction conditions, including temperature, extraction time, fumigation time and solution-to-soil ratio, on P concentrations and isotope ratios. RESULTS: Depending on the extraction conditions, Bray-1 P concentrations ranged from 0.2 to 66.3 mg P kg-1 across the soils. Extraction time and temperature had only minor effects on Bray-1 P, but concentrations increased markedly as the solution-to-soil ratio increased. In contrast, extraction conditions did not affect Bray-1 δ18 OP values, indicating that Bray-1 provides a robust measure of the isotopic composition of available soil P. For a relatively high P soil, available and fumigation-released (microbial) δ18 OP values determined by Bray-1 extraction (20‰ and 16‰, respectively) were higher than those determined by the AEM method (18‰ and 12‰, respectively), which we attribute to slightly different P pools extracted by the two methods and/or differences resulting from the longer extraction time needed for the AEM method. CONCLUSIONS: The short extraction time, insensitivity to extraction conditions and smaller mass of soil required to extract sufficient P for isotopic analysis make Bray-1extraction a suitable alternative to the AEM method for the determination of δ18 OP values of available P in tropical soils.

A biophysical strategy to examine the impact of newly synthesized polymerizable ammonium-based ionic liquids on the structural stability and proteolytic activity of stem bromelain.

The present manuscript reports the synthesis and characterization of polymerizable ammonium-based ionic liquids (ILs) and explores their influence on structural stability of stem bromelain (BMN) by using various biophysical techniques. Thermal fluorescence results showed that N-ethyl-2-(methylacryloyloxy)-N,N-dimethylethan-1-ammonium bromide (IL2C) (at lower concentration (0.1 mg/mL)) is found to be increasing the thermal stability of BMN which can be evident from the transition temperature (Tm) for BMN in IL2C (68.51 °C) is higher than BMN in buffer (66.24 °C). Whereas, N-(2-(methacryloyloxy)ethyl)-N,N-dimethylpropan-1-ammonium bromide (IL3C) and N-(2-(methacryloyloxy)ethyl)-N,N-dimethylpentan-1-ammonium bromide (IL5C) are maintaining the Tm values very near to Tm of pure BMN. Though, N-(2-(methacryloyloxy)ethyl)-N,N-dimethylhexan-1-ammonium bromide (IL6C) is found to be destabilizing IL as it significantly decreased the Tm value of BMN at all concentrations. Additionally, consequence of ILs on the proteolytic activity of BMN has also performed for IL2C up to 5 mg/mL while IL3C and IL5C at 0.1 mg/mL and 0.5 mg/mL are enhancing the proteolytic activity of BMN. Later, molecular docking studies are also performed with AutoDock vina and results showed that all ILs have different binding sites on BMN however IL6C is observed to be binding to the catalytic site of the BMN, it turns out to be the most destabilizing IL.

Preparation and evaluation of bis(diallyl alkyl tertiary ammonium salt) polymer as a promising adsorbent for phosphorus removal.

Problems associated with water eutrophication due to high phosphorus concentrations and related environmentally safe solutions have attracted wide attention. A novel bis(diallyl alkyl tertiary ammonium salt) polymer, particularly poly(N1,N1,N6,N6-tetraallylhexane-1,6-diammonium dichloride) (PTAHDADC), was synthesized and characterized by Fourier transform infrared spectroscopy, nuclear magnetic resonance, scanning electron microscopy, mercury intrusion method, and thermogravimetric analysis. The adsorption characteristics in phosphorus were evaluated in dilute solution, and the recycling properties of PTAHDADC were investigated. Results showed that PTAHDADC possessed macropores with a size distribution ranging from 30 to 130 µm concentrating at 63 µm in diameter and had 46.52% of porosity, excellent thermal stability below 530K, and insolubility. PTAHDADC could effectively remove phosphorus at pH = 7-11 and had a removal efficiency exceeding 98.4% at pH = 10-11. The adsorption equilibrium data of PTAHDADC for phosphorus accorded well with the Langmuir and pseudo-second-order kinetic models. Maximum adsorption capacity was 52.82 mg/g at 293 K. PTAHDADC adsorbed phosphorus rapidly and reached equilibrium within 90 min. Calculated activation energy Ea was 15.18 kJ/mol. PTAHDADC presented an excellent recyclability with only 8.23% loss of removal efficiency after five adsorption-desorption cycles. The morphology and structure of PTAHDADC slightly changed as evidenced by the pre- and post-adsorption of phosphorus, but the process was accompanied by the partial deprotonation of the (-CH2)3NH+ group of PTAHDADC. The adsorption was a spontaneous exothermic process driven by entropy through physisorption, electrostatic attraction, and ion exchange. Survey results showed that PTAHDADC was a highly efficient and fast-adsorbing phosphorus-removal material prospective in treating wastewater.

A novel submerged Rotala rotundifolia, its growth characteristics and remediation potential for eutrophic waters.

The vegetative growth and remediation potential of Rotala rotundifolia, a novel submerged aquatic plant, for eutrophic waters were investigated on different sediments, and under a range of nitrogen concentrations. Rotala Rotundifolia grew better on silt than on sand and gravel in terms of plant height, tiller number and biomass accumulation. Percent increment of biomass was enhanced at low water nitrogen (ammonium nitrogen concentration ≤10 mg/L). The maximum total nitrogen and total phosphorus removals in the overlying water were between 54% to 66% and 42% to 57%, respectively. Nitrogen contents in the sediments increased with increasing water nitrogen levels, whereas, nitrogen contents in the plant tissues showed no apparent regularity, and the greatest value was obtained at ammonium nitrogen concentration 15 mg/L. Both phosphorus contents in the sediments and tissues of plants were not affected significantly by additional nitrogen supply. Direct nitrogen uptake by plants was in the range of 16% to 39% when total phosphorus concentration was 1.0 mg/L. These results suggested that Rotala Rotundifolia can be used to effectively remove nitrogen and phosphorus in eutrophic waters.

Evaluation of the adsorption of ammonium-nitrogen and phosphate on a granular composite adsorbent derived from zeolite.

To remove the extra ammonium-nitrogen (NH3-N) and phosphorus (P) from contaminated water, a novel granular adsorbent (GAZCA) was fabricated with zeolite powders and Al-Mn binary oxide (AMBO) via the compression method. The SEM-EDS and mapping and XRD results illustrated the microstructure of GAZCA: the homogeneous aggregation of zeolite and AMBO nanoparticles with their crystal integrity and the uniform distribution of Al/Mn/Si/O elements on the adsorbent surface. FTIR and XPS results demonstrated the existence of impregnated sodium cations and hydroxyl groups, which were responsible for the removal of NH3-N and P, respectively. The results of BET analysis and compression tests exhibited a high surface area (14.4 m2/g) and a satisfactory mechanical strength of GAZCA. Kinetic adsorption results showed a fast adsorption rate for NH3-N and P, and mutual inference was not observed between the adsorption kinetics of NH3-N and P in the bi-component system. The adsorption isotherm results demonstrated that the maximum adsorption capacities of NH3-N and P were calculated as 12.9 mg/g and 9.3 mg/g via the Langmuir model, respectively. In the bi-component system, the adsorption capacities of NH3-N and P were maintained at low and moderate concentrations and decreased at high concentrations due to the blockage effects of NH4MnPO4·H2O precipitates. The removal efficiency of NH3-N could be maintained in a wide pH range of 4~10, while P adsorption was inhibited at alkali conditions. The solution of sodium bicarbonate (0.4 M) was used for the regeneration of saturated adsorbents, which permitted GAZCA to keep 98% and 78% of its adsorption capacity for NH3-N and P even after three regeneration and reuse cycles. Dynamic experiments illustrated that a satisfactory performance was obtained for the in situ treatment of simulated N- and P-contaminated water by using a column reactor packed with GAZCA, thus further confirming its great potential for the control of eutrophication.

Differences in main processes to transform phosphorus influenced by ammonium nitrogen in flooded intensive agricultural and steppe soils.

Exogenous ammonium nitrogen (AN) fertilization/deposition and the subsequently induced soil acidification, might exacerbate soil phosphorus (P) transformation and mobility, whereas poor understanding in abiotic and biotic processes still existed between intensively cultivated soil with high proportion of legacy inorganic P (Pi) in comparison to natural steppe soil with high proportion of organic P (Po). Column batch flooded experiment using vegetable (VEG) and steppe (STE) soils was conducted to investigate the P transformation and mobility influenced by 60-day intermittent elution with an (1500 mg N kg-1) solution or an acid sulfate (107 mmol H+ kg-1) solution. The results showed that AN elution significantly decreased the contents of all Pi fractions and strengthened Pi leaching, whereas acid elution increased the contents of Al-Pi, Fe-Pi, and reductant-soluble Pi and reduced P leaching in VEG soil. In contrast, AN elution increased the contents of soluble-Po and Al-(Pi + Po) and decreased Ca-P and Fe-Pi, no effects on P leaching, whereas acid elution increased the contents of soluble-(Pi + Po), Al-(Pi + Po), Fe-(Pi + Po) and reduced P leaching in STE soil. Variances analysis showed that pH and microbial biomass carbon were the most important factors to predict the P composition of the VEG and the STE soil, respectively. This indicated that AN elution released the soil mineral-bound phosphate with ammonia oxidation coupled with Fe(III) reduction, besides the same chemical influences on Fe/Al oxides as acid elution in VEG soil; while predominantly affected biochemical/biological processes of soil P by changing microbial biomass and enzyme activities in STE soil.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.