Antimicrobial Dialkylresorcins from Marine-Derived Microorganisms: Insights into Their Mode of Action and Putative Ecological Relevance.

Zobellia galactanivorans has been reported as a seaweed-associated or marine-derived species with largely unknown secondary metabolites. The combination of bioinformatic analysis and MS- and bioactivity guided separation led to the isolation of a new antibiotically active dialkylresorcin from the marine bacterium Z. galactanivorans. The antibiotic profile of the new dialkylresorcin zobelliphol (1: ) was investigated and compared with related and naturally occurring dialkyresorcins (i.e., stemphol (2: ) and 4-butyl-3,5-dihydroxybenzoic acid (3: )) from the marine-derived fungus Stemphylium globuliferum. Bacterial reporter strain assays provided insights into the mode of action of this antibiotic compound class. We identified an interference with bacterial DNA biosynthesis for the dialkylresorcin derivative 1: . In addition, the putative biosynthetic gene cluster corresponding to production of 1: was identified and a biosynthetic hypothesis was deduced.

Antibacterial mechanism of fraxetin against Staphylococcus aureus.

Fraxetin is one of the main constituents of the traditional medicinal plant Fraxinus rhynchophylla. The inhibitory effect of fraxetin on various bacterial strains has been extensively reported, however, its mechanism of action on bacterial cells remains to be elucidated. In the present study, the antibacterial mechanism of fraxetin on Staphylococcus aureus was systematically investigated by examining its effect on cell membranes, protein synthesis, nucleic acid content and topoisomerase activity. The results indicated that fraxetin increased the permeability of the cell membrane but did not render it permeable to macromolecules, such as DNA and RNA. Additionally, the quantity of protein, DNA and RNA decreased to 55.74, 33.86 and 48.96%, respectively following treatment with fraxetin for 16 h. The activity of topoisomerase I and topoisomerase II were also markedly inhibited as fraxetin concentration increased. The result of the ultraviolet­visible spectrophotometry demonstrated that the DNA characteristics exhibited a blue shift and hypochromic effect following treatment with fraxetin. These results indicated that fraxetin had a marked inhibitory effect on S.aureus proliferation. Further mechanistic studies showed that fraxetin could disrupt nucleic acid and protein synthesis by preventing topoisomerase from binding to DNA.

ArgR of Streptomyces coelicolor is a versatile regulator.

ArgR is the regulator of arginine biosynthesis genes in Streptomyces species. Transcriptomic comparison by microarrays has been made between Streptomyces coelicolor M145 and its mutant S. coelicolor ΔargR under control, unsupplemented conditions, and in the presence of arginine. Expression of 459 genes was different in transcriptomic assays, but only 27 genes were affected by arginine supplementation. Arginine and pyrimidine biosynthesis genes were derepressed by the lack of ArgR, while no strong effect on expression resulted on arginine supplementation. Several nitrogen metabolism genes expression as glnK, glnA and glnII, were downregulated in S. coelicolor ΔargR. In addition, downregulation of genes for the yellow type I polyketide CPK antibiotic and for the antibiotic regulatory genes afsS and scbR was observed. The transcriptomic data were validated by either reverse transcription-PCR, expression of the gene-promoter coupled to the luciferase gene, proteomic or by electrophoresis mobility shift assay (EMSA) using pure Strep-tagged ArgR. Two ARG-boxes in the arginine operon genes suggest that these genes are more tightly controlled. Other genes, including genes encoding regulatory proteins, possess a DNA sequence formed by a single ARG-box which responds to ArgR, as validated by EMSA.

The complete genome sequence of 'Candidatus Liberibacter solanacearum', the bacterium associated with potato zebra chip disease.

Zebra Chip (ZC) is an emerging plant disease that causes aboveground decline of potato shoots and generally results in unusable tubers. This disease has led to multi-million dollar losses for growers in the central and western United States over the past decade and impacts the livelihood of potato farmers in Mexico and New Zealand. ZC is associated with 'Candidatus Liberibacter solanacearum', a fastidious alpha-proteobacterium that is transmitted by a phloem-feeding psyllid vector, Bactericera cockerelli Sulc. Research on this disease has been hampered by a lack of robust culture methods and paucity of genome sequence information for 'Ca. L. solanacearum'. Here we present the sequence of the 1.26 Mbp metagenome of 'Ca. L. solanacearum', based on DNA isolated from potato psyllids. The coding inventory of the 'Ca. L. solanacearum' genome was analyzed and compared to related Rhizobiaceae to better understand 'Ca. L. solanacearum' physiology and identify potential targets to develop improved treatment strategies. This analysis revealed a number of unique transporters and pathways, all potentially contributing to ZC pathogenesis. Some of these factors may have been acquired through horizontal gene transfer. Taxonomically, 'Ca. L. solanacearum' is related to 'Ca. L. asiaticus', a suspected causative agent of citrus huanglongbing, yet many genome rearrangements and several gene gains/losses are evident when comparing these two Liberibacter. species. Relative to 'Ca. L. asiaticus', 'Ca. L. solanacearum' probably has reduced capacity for nucleic acid modification, increased amino acid and vitamin biosynthesis functionalities, and gained a high-affinity iron transport system characteristic of several pathogenic microbes.

End product yields from the extraruminal fermentation of various polysaccharide, protein and nucleic acid components of biofuels feedstocks.

"Extraruminal" fermentations employing in vitro incubation of mixed ruminal bacterial consortia, are capable of converting a complex array of biomass materials to mixtures of volatile fatty acids (VFA), methane, and carbon dioxide. Most of the potential energy in the biomass feedstock is retained in the VFA products, which are potential reactants for electrochemical conversion to hydrocarbon fuels. Quantitative data on VFA yields and proportions from biomass components are necessary for determining industrial feasibility, but such measurements have not been systematically reported. VFA yields and proportions were determined for a variety of carbohydrates, proteins and nucleic acids. Carbohydrates yielded primarily acetic and propionic acids, while proteins also yielded a more favorable product mix (longer average chain length and branched chain VFAs). Addition of certain co-substrates (e.g., glycerol) favorably improved the VFA product mix. The results have implications for hydrocarbon fuel generation from biomass materials by hybrid fermentation/chemical processes.

Parallel multiplicative target screening against divergent bacterial replicases: identification of specific inhibitors with broad spectrum potential.

Typically, biochemical screens that employ pure macromolecular components focus on single targets or a small number of interacting components. Researches rely on whole cell screens for more complex systems. Bacterial DNA replicases contain multiple subunits that change interactions with each stage of a complex reaction. Thus, the actual number of targets is a multiple of the proteins involved. It is estimated that the overall replication reaction includes up to 100 essential targets, many suitable for discovery of antibacterial inhibitors. We have developed an assay, using purified protein components, in which inhibitors of any of the essential targets can be detected through a common readout. Use of purified components allows each protein to be set within the linear range where the readout is proportional to the extent of inhibition of the target. By performing assays against replicases from model Gram-negative and Gram-positive bacteria in parallel, we show that it is possible to distinguish compounds that inhibit only a single bacterial replicase from those that exhibit broad spectrum potential.

Low-oxygen-recovery assay for high-throughput screening of compounds against nonreplicating Mycobacterium tuberculosis.

Screening for new antimicrobial agents is routinely conducted only against actively replicating bacteria. However, it is now widely accepted that a physiological state of nonreplicating persistence (NRP) is responsible for antimicrobial tolerance in many bacterial infections. In tuberculosis, the key to shortening the 6-month regimen lies in targeting this NRP subpopulation. Therefore, a high-throughput, luminescence-based low-oxygen-recovery assay (LORA) was developed to screen antimicrobial agents against NRP Mycobacterium tuberculosis. M. tuberculosis H37Rv containing a plasmid with an acetamidase promoter driving a bacterial luciferase gene was adapted to low oxygen conditions by extended culture in a fermentor with a 0.5 headspace ratio. The MICs of 31 established antimicrobial agents were determined in microplate cultures maintained under anaerobic conditions for 10 days and, for comparative purposes, under aerobic conditions for 7 days. Cultures exposed to drugs under anaerobic conditions followed by 28 h of "recovery" under ambient oxygen produced a luminescent signal that was, for most compounds, proportional to the number of CFU determined prior to the recovery phase. No agents targeting the cell wall were active against NRP M. tuberculosis, whereas drugs hitting other cellular targets had a range of activities. The calculated Z' factor was in the range of 0.58 to 0.84, indicating the suitability of the use of LORA for high-throughput assays. This LORA is sufficiently robust for use for primary high-throughput screening of compounds against NRP M. tuberculosis.

Altered spectrum of multidrug resistance associated with a single point mutation in the Escherichia coli RND-type MDR efflux pump YhiV (MdtF).

OBJECTIVES: YhiV (MdtF) is an resistance nodulation division (RND) type efflux pump in Escherichia coli with significant homology to AcrB but usually expressed at a low level in clinical isolates. When overexpressed the pump confers decreased susceptibility to a variety of substances including erythromycin and ethidium bromide (EtBr). We characterized two mutants of E. coli E12 (DeltaacrB DeltaacrF) overexpressing yhiV that showed surprising differences in their spectrum of multidrug resistance (MDR). METHODS: The two mutants obtained after repeated exposure of E. coli E12 to levofloxacin were tested for antimicrobial susceptibility to a variety of agents and for intracellular accumulation of selected pump substrates. Gene expression was studied by quantitative RT-PCR, and yhiV was sequenced. Gene inactivation and replacement were done by phage lambda-based homologous recombination. RESULTS: Mutant DKO20/1 overexpressed yhiV, showed a wild-type yhiV sequence and had >2-fold increased MICs of fluoroquinolones, novobiocin, macrolides/ketolides, EtBr, oxacillin and Phe-Arg-beta-naphthylamide (PAbetaN, a putative efflux pump inhibitor) compared with the E12 parent. A second mutant, strain DKO1/17 that had the Val-610-->Phe point mutation in YhiV differed from DKO20/1 by faster growth, >2-fold increased MICs of linezolid and tetracycline, but >2-fold decreased MICs of PAbetaN, azithromycin and telithromycin. Inactivation of yhiV in DKO1/17 and reintroduction of the wild-type and mutant yhiV sequence confirmed that the differing MICs of most of the drugs were associated with the observed single point mutation. Intracellular drug accumulation studies with linezolid and PAbetaN were consistent with the MIC results. CONCLUSIONS: The region around amino acid Val-610 in YhiV appears to be involved in determining recognition and efficiency of export of a number of MDR efflux pump substrates. This single point mutation in the periplasmic loop of the pump can increase resistance to a given drug such as a fluoroquinolone while decreasing resistance to another one.

Controlled expression of an rpoS antisense RNA can inhibit RpoS function in Escherichia coli.

We show that an inducible rpoS antisense RNA complementary to the rpoS message can inhibit expression of RpoS in both exponential and stationary phases and can attenuate expression of the rpoS regulon in Escherichia coli. Plasmids containing rpoS antisense DNA expressed under the control of the T7lac promoter and T7 RNA polymerase were constructed, and expression of the rpoS antisense RNA was optimized in the pET expression system. rpoS antisense RNA levels could be manipulated to effectively control the expression of RpoS and RpoS-dependent genes. RpoS expression was inhibited by the expression of rpoS antisense RNA in both exponential and stationary phases in E. coli. RpoS-dependent catalase HPII was also downregulated, as determined by catalase activity assays and with native polyacrylamide gels stained for catalase. Induced RpoS antisense expression also reduced the level of RpoS-dependent glycogen synthesis. These results demonstrate that controlled expression of antisense RNA can be used to attenuate expression of a regulator required for the expression of host adaptation functions and may offer a basis for designing effective antimicrobial agents.

A genome-based functional screening approach to vaccine development that combines in vitro assays and DNA immunization.

A two-step screening strategy was developed to identify strong immunogenic polypeptides with putative vaccine and/or adjuvant activity. In the first step, a mycobacterial genomic DNA library was screened in vitro to identify plasmids encoding polypeptides that stimulate splenocytes from mycobacteria-immunized mice and T cells from PPD-positive healthy donors to produce interferon-gamma. In the second step, plasmids were selected for their ability to induce protective immunity in a mouse model of tuberculosis following DNA immunization. The potential of this approach is illustrated by the identification of a panel of immunogenic polypeptides that may be used to engineer a new generation of vaccines.

A facile and effective screening method for p21WAF1 promoter activators from microbial metabolites.

We have developed a novel p21WAF1 promoter activator screening system based on rapid and facile luciferase activity assay of a model cell system (H1299/tsp53-luc cells), a stable luciferase expression cell line established by transfecting H1299/tsp53 cells with a reporter gene construct pWWP-Luc-BSD. This plasmid was constructed by subcloning the 2.4 kb p21WAF1 promoter and a 2.6 kb of luciferase cDNA fragment activated by the p21WAF1 promoter into a pMAM2-BSD expression vector containing the blasticidin S deaminase gene (BSD). A BSD-resistant clone H1299/tsp53-luc#4, showing the highest response to p53 activation (by temperature shift from 37 degrees C to 32 degrees C) by luciferase production, was used for screening microbial culture broths. Among approximately 1200 screened samples, trichostatin A related compounds and a new compound, lucilactaene, were isolated. This provides an effective and facile screening system for p21WAF1 promoter activators which should be of considerable value in the rapid identification of new anticancer agents.

Creation of genetic information by DNA polymerase of the thermophilic bacterium Thermus thermophilus.

Genetic information encoded in a template of a genome is replicated in a complementary way by DNA polymerase or RNA polymerase with high fidelity; no creation of information occurs in this reaction unless an error occurs. We report here that DNA polymerase of the thermophilic bacterium Thermus thermophilus can synthesize up to 200 kb linear double-stranded DNA in vitro in the complete absence of added primer and template DNAs, indicating that genetic information is actively created by protein. This ab initio DNA synthesis occurs at 74 degrees C and requires magnesium ion. There is a lag time of approximately 1 h and then the reaction proceeds linearly. The synthesized DNAs have a variety of sequences; they are mostly tandem repetitive sequences, e.g. (CATGTATA) n , (TGTATGTATACATACATA) n and (TATACGTA) n . Some degenerate sequences of these basic repeat units are also found. The similar repetitive sequences are found in many natural genes. These results, together with similar results found using DNA polymerase of archaeon Thermococcus litoralis , suggest that creative, non-replicative synthesis of DNA by protein was a driving force for diversification of genetic information at a certain stage of the evolution of life on the early earth.

Generation of Rhizobium strains with improved symbiotic properties by random DNA amplification (RDA)

To select for bacterial strains with enhanced phenotypes, random fragments of a whole genome, or a defined region of the genome, are cloned in a nonreplicating vector. The resulting plasmids are integrated by recombination into the homologous DNA region of the original strain. Integration gives rise to a nontandem direct duplication of the corresponding DNA region separated by the vector moiety of the plasmid. Recombination between the direct repeats leads to tandem duplication and further amplification of the entire integrated DNA, including the vector. Bacteria harboring the amplified DNA are selected by increasing the dosage of an antibiotic corresponding to a resistance marker of the integrated vector. Pooled strains carrying amplifications are then challenged with a selective pressure for the desired phenotype. After repeated selection cycles, the most fit strains are isolated. We used this process, which we called random DNA amplification, to select Rhizobium strains with increased competitiveness for nodule formation. Derivatives containing randomly amplified DNA regions of the symbiotic plasmid of Rhizobium tropici CFN299 strain were generated. Pools of amplified strains were inoculated onto various tropical legumes. After several cycles of selection through plants, amplified derivatives showing an increased competitiveness for nodule formation with the leguminous plant Macroptilium atropurpureum were obtained.

Biological activities of the nortropane alkaloid, calystegine B2, and analogs: structure-function relationships.

Calystegines, polyhydroxy nortropane alkaloids, are a recently discovered group of plant secondary metabolites believed to influence rhizosphere ecology as nutritional sources for soil microorganisms and as glycosidase inhibitors. Evidence is presented that calystegines mediate nutritional relationships under natural conditions and that their biological activities are closely correlated with their chemical structures and stereochemistry. Assays using synthetic (+)- and (-)-enantiomers of calystegine B2 established that catabolism by Rhizobium meliloti, glycosidase inhibition, and allelopathic activities were uniquely associated with the natural, (+)-enantiomer. Furthermore, the N-methyl derivative of calystegine B2 was not catabolized by R. meliloti, and it inhibited alpha-galactosidase, but not beta-glucosidase, whereas the parent alkaloid inhibits both enzymes. This N-methyl analog therefore could serve to construct a cellular or animal model for Fabry's disease, which is caused by a lack of alpha-galactosidase activity.

Treatment of vancomycin-resistant Enterococcus faecium infections with an investigational streptogramin antibiotic (quinupristin/dalfopristin): a report of fifteen cases.

New therapies for vancomycin-resistant Enterococcus faecium (VREF) infections are urgently needed. We describe the treatment of 15 patients with VREF infection with quinupristin/dalfopristin (RP 59500), a new injectable streptogramin antibiotic. Primary infections treated were bacteremia (4), urinary tract (4), intraabdominal (5), otitis externa (1), and meningitis (1). Minimum inhibitory concentrations for quinupristin/dalfopristin ranged from 0.5 microgram/ml or less to 2 micrograms/ml, and minimum bactericidal concentrations were greater than 64 micrograms/ml for all VREF isolates tested. Peak serum inhibitory titers following infusion of quinupristin/dalfopristin ranged from 1:8 to 1:64; all bactericidal titers were less than 1:2. Development of resistance to quinupristin/dalfopristin during therapy was not observed. The only drug-related adverse effect noted was phlebitis in 4 patients; all had received quinupristin/dalfopristin by peripheral venous infusion. Three patients had clinical and bacteriologic cures. Relapses occurred in 5 patients with recovery of VREF from infected sites in post-treatment cultures. Ten patients died of severe underlying disease; VREF was believed to contribute directly to the death of only 1 patient. While evaluation of clinical efficacy was complicated by the severity of underlying disease in patients with VREF infection, our experience suggests that quinupristin/dalfopristin is a safe and potentially useful agent for the treatment of VREF infections.

Role of topical phospholipids in the prophylaxis of silicone elastomer-associated infection in the abdominal cavity.

The present study evaluated the influence of phospholipids (phosphatidyl choline and phosphatidyl inositol) on the prevention of abdominal biomaterial-associated infection. Phospholipid-impregnated silicone elastomer (SE) fragments were either intraperitoneally implanted in rats or immersed in serum for 0, 4, and 14 days, and 3 x 10(9) cfu of 3H-labeled, live Escherichia coli were added in the peritoneal cavity or in vitro incubation medium. Three hours after incubation, the adherence of bacteria significantly decreased to phospholipid-impregnated SE fragments, which had been immersed/implanted for 0 and 4 days. However, the number of adhering bacteria did not differ between the impregnated and unimpregnated SE fragments after 14 days of immersion/implantation. A significantly lower number of adhering bacteria was noted on all unimpregnated SE fragments when phospholipid was supplemented in the peritoneal cavity or in vivo medium, compared with fragments with no supplement. The rate of bacterial DNA synthesis decreased significantly after incubation with phospholipid 2 h or more. Phospholipids did not further influence peritoneal morphology. Thus topical administration of phospholipids by impregnation to the surface of SE fragments or supplement in the incubation medium prevented bacterial adherence onto the SE fragments. This implies that the use of phospholipids might be a mode of preventing biomaterial-associated infections.

Quadruplex DNA formation in a region of the tRNA gene supF associated with hydrogen peroxide mediated mutations.

A hot spot for H2O2/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189 [Moraes et al. (1990) Carcinogenesis 11, 283; Akman et al. (1991) Mutat. Res. (in press)]. To further characterize this hot spot, we synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50 degrees C into two major forms, one of which migrates more slowly than does d(pT)33 on nondenaturing 12% polyacrylamide gels. We propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quartets involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following. (1) pZ33 migrates as a single form that comigrates with d(pT)33 on denaturing 20% acrylamide-8 M urea gels. (2) Annealing an equimolar mixture of 5'-32P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5'-32P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels. Mixing 5'-32P-labeled pZ33 with 5'-32P-labeled pZ49 resulted in five slowly migrating bands. (3) An oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating form. (4) Dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H2O2/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsteen bonded.

Partial deletion of the Rhizobium phaseoli CFN23 symbiotic plasmid implies a concomitant amplification of plasmid DNA sequences.

Rhizobium leguminosarum biovar phaseoli CFN23 loses its ability to nodulate beans at a high frequency because of a deletion of part of its symbiotic (pSym) plasmid (Soberón-Chávez et al., 1986). We report here that at least 80 kb of pSym are deleted upon loss of the symbiotic phenotype; the deletion removes the nitrogenase structural nifHDK and the common nodABC genes. The size of the deleted pSym is not reduced, since it is accompanied by an amplification of other pSym plasmid sequences. This genetic rearrangement is similar to the deletion and amplification of yeast mitochondrial DNA leading to 'petite' mutations.

Persistence of Pseudomonas aeruginosa during ciprofloxacin therapy of a cystic fibrosis patient: transient resistance to quinolones and protein F-deficiency.

The mechanism of persistence was characterized in Pseudomonas aeruginosa isolates obtained ten days before (4405), on the tenth day of (4419), and four days after (4478) ciprofloxacin therapy in a cystic fibrosis patient. Isolate 4419 showed a 16-fold increase in resistance to ciprofloxacin, norfloxacin and nalidixic acid. The outer membrane of 4419 had no detectable protein F. A modified lipopolysaccharide profile, a longer lag phase before growth and a slower generation time were also noted for isolate 4419. Cell surface hydrophobicity was increased by 20% in 4419 whereas uptake of [14C]ciprofloxacin was equivalent in all three isolates. Ciprofloxacin doses causing 50% inhibition of DNA synthesis were proportional to MICs for each isolate indicating that the DNA gyrase of 4419 was resistant to quinolones. A quinolone-susceptible revertant of 4419 remained deficient in protein F. Protein F-deficiency was not associated with resistance to quinolones, nor to other antibiotics, supporting the view that it plays little role in outer membrane permeability to antibiotics.