Comparing massa medicata fermentata before and after charred in terms of digestive promoting effect via metabolomics and microbiome analysis.

ETHNOPHARMACOLOGICAL RELEVANCE: Massa Medicata Fermentata, a fermented Chinese medicine, is produced by the fermentation of six traditional Chinese medicines. Liu Shenqu (LSQ) and charred Liu Shenqu (CLSQ) have been used for strengthening the spleen and enhancing digestion for over a thousand years, and CLSQ is commonly used in clinical practice. However, it is unclear whether there is a difference in the spleen strengthening and digestion effects between LSQ and CLSQ, as well as their mechanisms of action. AIM OF STUDY: This study aims to compare the effects of LSQ and CLSQ on the digestive function of functional dyspepsia (FD) rats and reveal their mechanisms of action. MATERIALS AND METHODS: SPF grade SD rats were randomly divided into 6 groups: control group, model group, Liu Shenqu decoction low-dosage (LSQ LD) group, Liu Shenqu decoction high-dosage (LSQ HD) group, charred Liu Shenqu decoction low-dosage (CLSQ LD) group, and charred Liu Shenqu decoction high-dosage (CLSQ HD) group. Rats were injected intraperitoneally with reserpine to create an FD model and then treated by intragastric administration. During this period, record the weight and food intake of the animals. After 18 days of treatment, specimens of the gastric antrum, spleen, and duodenum of rats were taken for pathological staining and immunohistochemical detection of Ghrelin protein expression. Enzyme linked immunosorbent assay (ELISA) was used to determine the concentration of relevant gastrointestinal hormones in serum. The 16 S rDNA sequencing method was used to evaluate the effect of cecal contents on the structure of the gut microbiota in experimental rats. Plasma metabolomics analysis was performed using ultra high performance liquid chromatography coupled with quadrupole time of flight mass spectrometry (UPLC-QTOF-MS) to further reveal their mechanism of action. RESULTS: LSQ and CLSQ improved the pathological tissue histological structure of FD rats and increased the levels of MTL and GAS hormones in serum and the levels of ghrelin in the gastric antrum, spleen, and duodenum, while reducing VIP, CCK, and SP hormone levels. The above results showed that the therapeutic efficacy of CLSQ is better than that of LSQ. Futhermore, the mechanism of action of LSQ and CLSQ were revealed. The 16 S rDNA sequencing results showed that both LSQ and CLSQ can improve the composition and diversity of the gut microbiota. And metabolomic analysis demonstrated that 20 metabolites changed after LSQ treatment, and 16 metabolites underwent continuous changes after CLSQ treatment. Further analysis revealed that LSQ mainly intervened in the metabolic pathways of glycerol phospholipid metabolism and arginine and proline metabolism, but CLSQ mainly intervened in the metabolic pathways of ether lipid metabolism, sphingolipid metabolism, and glycerophospholipid metabolism. CONCLUSIONS: Both LSQ and CLSQ can improve functional dyspepsia in FD rats, but CLSQ has a stronger improvement effect on FD. Although their mechanisms of action are all related to regulating gastrointestinal hormone secretion, significantly improving intestinal microbiota disorders, and improving multiple metabolic pathways, but the specific gut microbiota and metabolic pathways they regulate are different.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Targeted arginine metabolomics combined with metagenomics revealed the potential mechanism of Pueraria lobata extract in treating myocardial infarction.

The extraction methods for traditional Chinese medicine (TCM) may have varying therapeutic effects on diseases. Currently, Pueraria lobata (PL) is mostly extracted with ethanol, but decoction, as a TCM extraction method, is not widely adopted. In this study, we present a strategy that integrates targeted metabolomics, 16 s rDNA sequencing technology and metagenomics for exploring the potential mechanism of the water extract of PL (PLE) in treating myocardial infarction (MI). Using advanced analytical techniques like ultra-high performance liquid chromatography with quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS) and ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS), we comprehensively characterized PLE's chemical composition. Further, we tested its efficacy in a rat model of MI induced by ligation of the left anterior descending branch of the coronary artery (LAD). We assessed cardiac enzyme levels and conducted echocardiograms. UPLC-MS/MS was used to compare amino acid differences in serum. Furthermore, we investigated fecal samples using 16S rDNA sequencing and metagenomic sequencing to study intestinal flora diversity and function. This study demonstrated PLE's effectiveness in reducing cardiac injury in LAD-ligated rats. Amino acid metabolomics revealed significant improvements in serum levels of arginine, citrulline, proline, ornithine, creatine, creatinine, and sarcosine in MI rats, which are key compounds in the arginine metabolism pathway. Enzyme-linked immunosorbent assay (ELISA) results showed that PLE significantly improved arginase (Arg), nitric oxide synthase (NOS), and creatine kinase (CK) contents in the liver tissue of MI rats. 16 s rDNA and metagenome sequencing revealed that PLE significantly improved intestinal flora imbalance in MI rats, particularly in taxa such as Tuzzerella, Desulfovibrio, Fournierella, Oscillibater, Harryflintia, and Holdemania. PLE also improved the arginine metabolic pathway in the intestinal microorganisms of MI rats. The findings indicate that PLE effectively modulates MI-induced arginine levels and restores intestinal flora balance. This study, the first to explore the mechanism of action of PLE in MI treatment considering amino acid metabolism and intestinal flora, expands our understanding of the potential of PL in MI treatment. It offers fresh insights into the mechanisms of PL, guiding further research and development of PL-based medicines.

Revealing Medicinal Constituents of Bistorta vivipara Based on Non-Targeted Metabolomics and 16S rDNA Gene Sequencing Technology.

Bistorta vivipara is a medicinal plant with a long history, but there are few studies on the effects of its medicinal components and endophytic bacteria on the accumulation of secondary metabolites. Therefore, in this study, non-targeted metabolomics techniques and 16s rDNA techniques were used to study B. vivipara from different regions. A total of 1290 metabolites and 437 differential metabolites were identified from all samples. Among them, flavonoids, isoflavonoids, and benzopyrans are the main medicinal components of B. vivipara; these have potential anticancer, antiviral, and antioxidant properties, as well as potential applications for the treatment of atrial fibrillation. In addition, irigenin, an important medicinal component, was identified for the first time. The endophytic bacterial communities in the root tissues of B. vivipara from different regions were also different in composition and richness. Hierarchical clustering heat map analysis showed that Proteobacteria and Actinobacteriota bacteria significantly affected the accumulation of many medicinal components in the roots of B. vivipara.

Modulation of cellular metabolism and alleviation of bacterial dysbiosis by Aconiti Lateralis Radix Praeparata in non-small cell lung cancer treatment.

BACKGROUND: Non-small cell lung cancer (NSCLC) is a highly prevalent and fatal form of lung cancer. In China, Aconiti Lateralis Radix Praeparata (Fuzi in Chinese), derived from the lateral root of Aconitum carmichaeli Debx. (Ranunculaceae, Aconitum), is extensively prescribed to treat cancer in traditional medicine and clinical practice. However, the precise mechanism by which Fuzi treats NSCLC remains unknown. PURPOSE: This article aims to assess the efficacy of Fuzi against NSCLC and elucidate its underlying mechanism. METHODS: Marker ingredients of Fuzi decoction were quantified using UPLC-TSQ-MS. The effectiveness of Fuzi on NSCLC was evaluated using a xenograft mouse model. Subsequently, a comprehensive approach involving network pharmacology, serum metabolomics, and 16S rDNA sequencing was employed to investigate the anti-NSCLC mechanism of Fuzi. RESULTS: Pharmacological evaluation revealed significant tumour growth inhibition by Fuzi, accompanied by minimal toxicity. Network pharmacology identified 29 active Fuzi compounds influencing HIF-1, PI3K/Akt signalling, and central carbon metabolism in NSCLC. Integrating untargeted serum metabolomics highlighted 30 differential metabolites enriched in aminoacyl-tRNA biosynthesis, alanine, aspartate, and glutamate metabolism, and the tricarboxylic acid (TCA) cycle. Targeted serum metabolomics confirmed elevated glucose content and reduced levels of pyruvate, lactate, citrate, α-ketoglutarate, succinate, fumarate, and malate following Fuzi administration. Furthermore, 16S rDNA sequencing assay showed that Fuzi ameliorated the dysbiosis after tumorigenesis, decreased the abundance of Proteobacteria, and increased that of Firmicutes and Bacteriodetes. PICRUSt analysis revealed that Fuzi modulated the pentose phosphate pathway of the gut microbiota. Spearman correlation showed that Proteobacteria and Escherichia_Shigella accelerated the TCA cycle, whereas Bacteroidota, Bacteroides, and Lachnospiraceae_NK4A136_group suppressed the TCA cycle. CONCLUSIONS: This study firstly introduces a novel NSCLC mechanism involving Fuzi, encompassing energy metabolism and intestinal flora. It clarifies the pivotal role of the gut microbiota in treating NSCLC and modulating the TCA cycle. Moreover, these findings offer valuable insights for clinical practices and future research of Fuzi against NSCLC.

Acidic growth conditions stabilize the ribosomal RNA gene cluster and extend lifespan through noncoding transcription repression.

Blackcurrant (Ribes nigrum L.) is a classical fruit that has long been used to make juice, jam, and liqueur. Blackcurrant extract is known to relieve cells from DNA damage caused by hydrogen peroxide (H2 O2 ), methyl methane sulfonate (MMS), and ultraviolet (UV) radiation. We found that blackcurrant extract (BCE) stabilizes the ribosomal RNA gene cluster (rDNA), one of the most unstable regions in the genome, through repression of noncoding transcription in the intergenic spacer (IGS) which extended the lifespan in budding yeast. Reduced formation of extrachromosomal circles (ERCs) after exposure to fractionated BCE suggested that acidity of the growth medium impacted rDNA stability. Indeed, alteration of the acidity of the growth medium to pH ~4.5 by adding HCl increased rDNA stability and extended the lifespan. We identified RPD3 as the gene responsible for this change, which was mediated by the RPD3L histone deacetylase complex. In mammals, as inflammation sites in a tissue are acidic, DNA maintenance may be similarly regulated to prevent genome instability from causing cancer.

Croton tiglium L. seeds ameliorate loperamide-induced constipation via regulating gastrointestinal hormones and gut microbiota before and after processing.

ETHNOPHARMACOLOGICAL RELEVANCE: Crotonis Fructus (CF), the seeds of Croton tiglium L., have been commonly used in the treatment of constipation for more than two thousand years in traditional Chinese medicine (TCM). CF needs to be processed before clinical use and Crotonis Semen Pulveratum (CP) is the processed cream of CF, which could reduce the drastic purgative action and gastrointestinal damages. However, the mechanism of CF and CP in the treatment of constipation is still unclear. AIM OF THE STUDY: This study was to evaluate the effects of CF and CP on loperamide-induced constipation and the underlying mechanism. MATERIALS AND METHODS: The chemical compositions of CF and CP were analyzed by UPLC-Q-TOF-MS. Constipated mouse model was established by loperamide (9.6 mg/kg, b.w., i.g.) for two weeks. After successful modeling, the mice were treated with CF or CP (45.5 and 136.5 mg/kg, b.w., i.g.) once a day for seven days. The physiological status, defecation indices, defecation time, and intestinal propulsion rate in mice were measured. Histopathologic examination and serum biochemical parameters were further estimated. 16S rDNA gene sequencing was carried out to characterize the effects of CF and CP on intestinal microbiome structure. Spearman correlation analysis was also performed to explore the association between gut microbiotic abundance and serum indices. RESULTS: The results verified the therapeutic effects of CF and CP on loperamide-induced constipation. CF and CP could significantly ameliorate the reduction of fecal number, fecal weight, fecal water content, and intestinal propulsion rate in mice with constipation, and the first stool defecation time was also obviously reduced. Moreover, CF and CP could regulate the secretion of gastrointestinal hormones and inflammatory factors induced by constipation. Histopathologic examination showed that CP was superior to CF in relieving pathological injury and inflammatory cell infiltration. According to 16S rDNA sequencing, CF and CP treatment could improve gut microbiota disturbance in mice with constipation and the abundance of opportunistic pathogens such as Parabacteroides, Parasutterella and Bacillus remarkably declined, while the levels of beneficial bacterial such as Candidatus_Arthromitus significantly increased. Besides, CP may play a better role in correcting the intestinal flora disorder than CF, which was more obvious in the high-dose group. In addition, phytochemical analysis revealed the presence of diterpenoids and alkaloids in CF and CP. CONCLUSIONS: CF and CP could ameliorate loperamide-induced constipation by regulating gastrointestinal hormones secretion, reducing the levels of inflammatory cytokines and improving the disturbance of gut microbiota. Moreover, CP was superior to CF in the enrichment of beneficial bacteria and reduction of harmful bacteria and histopathological damage induced by constipation, which may be related to the changes in the species and content of diterpenoids after processing. The study provides new evidence for the processing mechanism and clinical application of CF and CP.

[Therapeutic effect and mechanism of Mailuo Shutong Pills on posterior limb swelling caused by femur fracture in rats based on intestinal flora and intestinal metabolism].

This study aimed to investigate the protective effect and underlying mechanism of Mailuo Shutong Pills(MLST) on posterior limb swelling caused by femur fracture in rats. The rats were randomly divided into a sham operation group, a model group, a low-dose MLST group(1.8 g·kg~(-1)·d~(-1)), a high-dose MLST group(3.6 g·kg~(-1)·d~(-1)), and a positive drug group(60 mg·kg~(-1)·d~(-1) Maizhiling Tablets). The femur in the sham operation group was exposed and the wound was sutured, while the other four groups underwent mechanical damage to cause femur fracture. The rats were treated with corresponding drugs by gavage 7 days before modeling and 5 days after modeling, while those in the sham operation group and the model group were given an equivalent dose of distilled water by gavage. Hematoxylin-eosin(HE) staining was used to detect the pathological injury of the posterior limb muscle tissues in rats, and the degree of hind limb swelling was measured. The enzyme-linked immunosorbent assay(ELISA) kit was used to detect the expression levels of interleukin-6(IL-6), interleukin-1ß(IL-1ß), and tumor necrosis factor-α(TNF-α) in the serum of rats in each group. The activity of superoxide dismutase(SOD), malondialdehyde(MDA), catalase(CAT), and glutathione peroxidase(GSH-Px) in rat serum was also measured. Western blot was used to detect the protein expression levels of heme oxygenase 1(HO-1), NAD(P)H quinone oxidoreductase 1(NQO1), and nuclear transcription factor E2-related factor 2(Nrf2) in rat posterior limb muscle tissues. The changes in the intestinal flora and intestinal metabolites in rats were detected by 16S rDNA sequencing and ultra-performance liquid chromatography-tandem mass spectrometry(UPLC-MS/MS), respectively, to explore the underlying mechanism of MLST in treating posterior limb swelling caused by femur fracture in rats. Compared with the model group, MLST significantly improved the degree of posterior limb swelling in rats, reduced the levels of serum inflammatory factors, and alleviated oxidative stress injury. The HE staining results showed that the inflammatory infiltration in the posterior limb muscle tissues of rats in the MLST groups was significantly improved. Western blot results showed that MLST significantly increased the protein expression of HO-1, NQO1, and Nrf2 in rat posterior limb muscle tissues compared with the model group. The 16S rDNA sequencing results showed that MLST improved the disorder of intestinal flora in rats after femur fracture. The UPLC-MS/MS results showed that MLST significantly affected the bile acid biosynthesis and metabolism pathway in the intestine after femur fracture, and the Spearman analysis confirmed that the metabolite deoxycholic acid involved in bile acid biosynthesis was positively correlated with the abundance of Turicibacter. The metabolite cholic acid was positively correlated with the abundance of Papilibacter, Staphylococcus, and Intestinimonas. The metabolite lithocholic acid was positively correlated with Papilibacter and Intestinimonas. The above results indicated that MLST could protect against the posterior limb swelling caused by femur fracture in rats. This protective effect may be achieved by improving the pathological injury of the posterior limb muscle, reducing the expression levels of inflammatory and oxidative stress-related factors in serum, reducing the oxidative injury of the posterior limb muscle, improving intestinal flora, and balancing the biosynthesis of bile acids in the intestine.

The efficacy and mechanism of Angelica sinensis (Oliv.) Diels root aqueous extract based on RNA sequencing and 16S rDNA sequencing in alleviating polycystic ovary syndrome.

BACKGROUND: Polycystic ovary syndrome (PCOS) leads to persistent anovulation, hyperandrogenism, insulin resistance, and polycystic ovary, and is mainly characterized by menstrual disorders, and reproductive dysfunction. Angelica sinensis (Oliv.) Diels root has been used in many classical formulas of traditional Chinese medicine, and is commonly used to treat various gynecological diseases. PURPOSE: To investigate the protective effect of water extract of A. sinensis root (WEA) on PCOS rats, and the mechanism by RNA sequencing, and 16S rDNA sequencing. METHODS: The PCOS rat model was established by letrozole combined with high-fat diet (gavage; 2 months), and treated with WEA (gavage; 2 g/kg, 4 g/kg or 8 g/kg; 1 month). To evaluate the therapeutic effect of WEA on PCOS rats, vaginal smear, hematoxylin-eosin staining, and biochemical indicators detection were performed. The rat ovarian tissue was analyzed by RNA sequencing, and the results were verified by qRT-PCR, and Western blot. 16S rDNA sequencing was used to analyze the gut microbiota of rats. RESULTS: The results of the vaginal smear, and hematoxylin-eosin staining showed that WEA improved estrous cycle disorder, and ovarian tissue lesions. WEA (4 g/kg or 8 g/kg; 1 months) alleviated hormone disorders, insulin resistance, and dyslipidemia. RNA sequencing showed that WEA intervention significantly changed the expressions of 2756 genes, which were enriched in phosphatidylinositol3-kinase/phosphorylated protein kinase B (PI3K/AKT), peroxisome proliferator-activated receptor (PPAR), mitogen-activated protein kinase (MAPK), AMP-activated protein kinase (AMPK), and insulin signaling pathways. 16S rDNA sequencing found that WEA increased the species diversity of gut microbiota, and regulated the abundance of some microbiota (genus level: Dubosiella, Bifidobacterium, Coriobacteriaceae (UCG-002), and Treponema; species level: Bifidobacterium animalis, Lactobacillus murinus, and Lactobacillus johnsonii). CONCLUSION: WEA regulated hormone, and glycolipid metabolism disorders, thereby relieving the PCOS induced by letrozole combined with high-fat diet. The mechanism was related to the regulation of PI3K/AKT, PPAR, MAPK, AMPK, and insulin signaling pathways in ovarian tissues, and the maintenance of gut microbiota homeostasis. Clarifying the efficacy and mechanism of WEA in alleviating PCOS based on RNA sequencing and 16S rDNA sequencing will guide the more reasonable clinical use of WEA.

The mechanism of action of safflower total flavonoids in the treatment of endometritis caused by incomplete abortion based on network pharmacology and 16S rDNA sequencing.

ETHNOPHARMACOLOGICAL RELEVANCE: Safflower is a traditional Chinese medicine used for treating gynaecological diseases. However, its material basis and mechanism of action in the treatment of endometritis induced by incomplete abortion are still unclear. AIM OF THE STUDY: This study aimed to reveal the material basis and mechanism of action of safflower in the treatment of endometritis induced by incomplete abortion through comprehensive methods, including network pharmacology and 16S rDNA sequencing. MATERIALS AND METHODS: Network pharmacology and molecular docking methods were used to screen the main active components and potential mechanisms of action of safflower in the treatment of endometritis induced by incomplete abortion in rats. A rat model of endometrial inflammation by incomplete abortion was established. The rats were treated with safflower total flavonoids (STF) based on forecasting results, serum levels of inflammatory cytokines were analysed, and immunohistochemistry, Western blots, and 16S rDNA sequencing were performed to investigate the effects of the active ingredient and the treatment mechanism. RESULTS: The network pharmacology prediction results showed 20 active components with 260 targets in safflower, 1007 targets related to endometritis caused by incomplete abortion, and 114 drug-disease intersecting targets, including TNF, IL6, TP53, AKT1, JUN, VEGFA, CASP3 and other core targets, PI3K/AKT, MAPK and other signalling pathways may be closely related to incomplete abortion leading to endometritis. The animal experiment results showed that STF could significantly repair uterine damage and reduce the amount of bleeding. Compared with the model group, STF significantly down-regulated the levels of pro-inflammatory factors (IL-6, IL-1ß, NO, TNF-α) and the expression of JNK, ASK1, Bax, caspase3, and caspase11 proteins. At the same time, the levels of anti-inflammatory factors (TGF-ß and PGE2) and the protein expression of ERα, PI3K, AKT, and Bcl2 were up-regulated. Significant differences in the intestinal flora were seen between the normal group and the model group, and the intestinal flora of the rats was closer to the normal group after the administration of STF. CONCLUSIONS: The characteristics of STF used in the treatment of endometritis induced by incomplete abortion were multi-targeted and involved multiple pathways. The mechanism may be related to the activation of the ERα/PI3K/AKT signalling pathway by regulating the composition and ratio of the gut microbiota.

Developing population identification tool based on polymorphism of rDNA for traditional Chinese medicine: Artemisia annua L.

BACKGROUND: Artemisia annua, a well-known traditional Chinese medicine, is the main source for production of artemisinin, an anti-malaria drug. A. annua is distributed globally, with great diversity of morphological characteristics and artemisinin contents. Diverse traits among A. annua populations impeded the stable production of artemisinin, which needs an efficient tool to identify strains and assess population genetic homogeneity. PURPOSE: In this study, ribosomal DNA (rDNA), were characterized for A. annua for strains identification and population genetic homogeneity assessment. METHODS: The ribosomal RNA (rRNA) genes were identified using cmscan and assembled using rDNA unit of LQ-9 as a reference. rDNA among Asteraceae species were compared performing with 45S rDNA. The rDNA copy number was calculated based on sequencing depth. The polymorphisms of rDNA sequences were identified with bam-readcount, and confirmed by Sanger sequencing and restriction enzyme experiment. The ITS2 amplicon sequencing was used to verify the stability of ITS2 haplotype analysis. RESULTS: Different from other Asteraceae species, 45S and 5S linked-type rDNA was only found in Artemisia genus. Rich polymorphisms of copy number and sequence of rDNA were identified in A. annua population. The haplotype composition of internal transcribed spacer 2 (ITS2) region which had moderate sequence polymorphism and relative short size was significantly different among A. annua strains. A population discrimination method was developed based on ITS2 haplotype analysis with high-throughput sequencing. CONCLUSION: This study provides comprehensive characteristics of rDNA and suggests that ITS2 haplotype analysis is ideal tool for A. annua strain identification and population genetic homogeneity assessment.

The Antibacterial Activity of Rhazya stricta Extracts against Klebsiella pneumoniae Isolated from Some Soil Invertebrates at High Altitudes.

Klebsiella is a common dangerous pathogen for humans and animals and is widely present in the digestive system. The genus Klebsiella is ubiquitous, as it is endemic to surface water, soil, and sewage. In this study, 70 samples were obtained from soil-dwelling invertebrates from September 2021 to March 2022 from Taif and Shafa in different altitudinal regions of Saudi Arabia. Fifteen of these samples were identified as Klebsiella spp. The Klebsiella isolates were genetically identified as Klebsiella pneumoniae using rDNA sequencing. The antimicrobial susceptibility of the Klebsiella isolates was determined. Amplification of virulence genes was performed using PCR. In this study, 16S rDNA sequencing showed a similarity from 98% to 100% with related K. pneumonia from the NCBI database, and the sequences were deposited in the NCBI GenBank under accession numbers ON077036 to ON077050. The growth inhibition properties of ethanolic and methanolic extracts of the medicinal plant Rhazya stricta's leaves against K. pneumoniae strains using the minimum inhibitory concentration (MIC) method and disc diffusion were evaluated. In addition, the biofilm inhibitory potential of these extracts was investigated using crystal violet. HPLC analysis identified 19 components divided into 6 flavonoids, 11 phenolic acids, stilbene (resveratrol), and quinol, and revealed variations in the number of components and their quantities between extracts. Both extracts demonstrated interesting antibacterial properties against K. pneumoniae isolates. The 2 extracts also showed strong biofilm inhibitory activities, with percentages of inhibition extending from 81.5% to 98.7% and from 35.1% to 85.8% for the ethanolic and methanolic extracts, respectively. Rhazya stricta leaf extract revealed powerful antibacterial and antibiofilm activities against K. pneumoniae isolates and could be a good candidate for the treatment or prevention of K. pneumonia-related infections.

The Overlooked Microbiome-Considering Archaea and Eukaryotes Using Multiplex Nanopore-16S-/18S-rDNA-Sequencing: A Technical Report Focusing on Nasopharyngeal Microbiomes.

In contrast to bacteria, microbiome analyses often neglect archaea, but also eukaryotes. This is partly because they are difficult to culture due to their demanding growth requirements, or some even have to be classified as uncultured microorganisms. Consequently, little is known about the relevance of archaea in human health and diseases. Contemporary broad availability and spread of next generation sequencing techniques now enable a stronger focus on such microorganisms, whose cultivation is difficult. However, due to the enormous evolutionary distances between bacteria, archaea and eukaryotes, the implementation of sequencing strategies for smaller laboratory scales needs to be refined to achieve as a holistic view on the microbiome as possible. Here, we present a technical approach that enables simultaneous analyses of archaeal, bacterial and eukaryotic microbial communities to study their roles in development and courses of respiratory disorders. We thus applied combinatorial 16S-/18S-rDNA sequencing strategies for sequencing-library preparation. Considering the lower total microbiota density of airway surfaces, when compared with gut microbiota, we optimized the DNA purification workflow from nasopharyngeal swab specimens. As a result, we provide a protocol that allows the efficient combination of bacterial, archaeal, and eukaryotic libraries for nanopore-sequencing using Oxford Nanopore Technologies MinION devices and subsequent phylogenetic analyses. In a pilot study, this workflow allowed the identification of some environmental archaea, which were not correlated with airway microbial communities before. Moreover, we assessed the protocol's broader applicability using a set of human stool samples. We conclude that the proposed protocol provides a versatile and adaptable tool for combinatorial studies on bacterial, archaeal, and eukaryotic microbiomes on a small laboratory scale.

Non-targeted metabolomics and 16s rDNA reveal the impact of uranium stress on rhizosphere and non-rhizosphere soil of ryegrass.

As a radioactive heavy metal element with a long half-life, uranium causes environmental pollution when it enters the surrounding soil. This study analyzed the changes about soil enzyme activity, non-targeted metabolomics, microbial community structure and function microbial community structure and function to assess the differences in the effects of uranium stress on rhizosphere and non-rhizosphere soil. Results showed that uranium stress significantly inhibited the activities of urease and sucrase in rhizosphere and non-rhizosphere, which had less effect on rhizosphere. Compare to the non-rhizosphere soil, the uranium stress induced the production of gibberellin A1, to promoted several metabolic pathways, such as nitrogen and PTS (Phosphotransferase system) metabolic in rhizosphere soil. The species and abundance of Aspergillus, Acidobacter, and Synechococcus in both rhizosphere and non-rhizosphere soil were decreased by uranium stress. However, the microorganisms in rhizosphere soil were less inhibited according to the soil metabolism and microbial network map analysis. Furthermore, the Chujaibacter in rhizosphere soil under uranium stress was found significantly positively correlated with lipid and organic oxygen compounds. Overall, the results indicated that ryegrass roots significantly alleviated the effects of uranium stress on soil microbial activity and population abundances, thus playing a protective role. The study also provided a theoretical basis for in-depth understanding of the biological effects, prevention and control mechanisms of uranium-contaminated soil.

Characterization of a Root-Knot Nematode Infecting Aconitum carmichaelii in Southwest China.

Growth of the Chinese herbal medicine industry has resulted in several new pests and diseases. China is one of the world largest producers of monkshood (Aconitum carmichaelii Debx.), but an unidentified root-knot nematode has become a significant pest in the southwestern provinces of Yunnan and Sichuan. Morphological characteristics and the ribosomal DNA-internal transcribed spacer and D2-D3 region of the 28S ribosomal RNA gene sequences were used to identify the nematode as Meloidogyne hapla. Through investigation, this is the first report of M. hapla infecting monkshood in Yunnan and Sichuan Provinces.

Comprehensive evaluation of the mechanism of Gastrodia elata Blume in ameliorating cerebral ischemia-reperfusion injury based on integrating fecal metabonomics and 16S rDNA sequencing.

Gastrodia elata Blume was used to treat stroke and headaches caused by "Feng" for thousands of years. The present study has shown a significant effect of G. elata Blume in improving cerebral ischemia-reperfusion injury (CIRI). However, the mechanism of G. elata Blume in improving CIRI by regulating the intestinal flora has not been reported until now. This research aimed to comprehensively evaluate the mechanism of G. elata Blume in CIRI based on fecal metabolomics and 16S rDNA sequencing. The rat model with CIRI was created based on the Zea Longa method. Enzyme-linked immunosorbent assay (ELISA) was used to monitor the inflammatory factors in rat serum. Damages of brain tissues were observed using hematoxylin and eosin (H&E) staining. Cerebral infarction was observed by 2,3,5-triphenyltetrazolium chloride (TTC) staining. The balance of intestinal flora in cecal contents of rats was evaluated by high-throughput sequencing. Changes of metabolites in the intestinal flora were evaluated by fecal metabolomics through Ultra high performance liquid chromatography-orbitrap exploris-mass spectrometer (UHPLC-OE-MS). The area of brain necrosis, cerebral infarction volume, and the contents of inflammatory factors in CIRI rats can be effectively reduced after oral administration of G. elata Blume. CIRI can cause disturbances in the intestinal flora and its associated metabolites. G. elata Blume can significantly regulate the composition of the intestinal microflora. It reversed CIRI-induced changes in the levels of multiple intestinal bacteria, including Prevotellaceae, Coriobacteriaceae; Prevotella, Gamma proteobacteria unclassified, Barnesiella, Escherichia, Shigella; uncultured Shigella sp., Flavonifractor sp., Escherichia sp. enrichment culture clone NBAR004, Veillonella sp. R-32, and Lactobacillus intestinalis. The levels of metabolites in cecal contents were disturbed in rats with CIRI, including amino acid, purine, and sphingolipid metabolism. The changes in the level of biomarkers in amino acid metabolism induced by CIRI were significantly reversed after treatment with G. elata Blume. Correlation studies show that Prevotellaceae was significantly positively correlated with interleukin (IL)-6, and L. intestinalis and L-phenylalanine were negatively interrelated to IL-1ß. Beta-glycerophosphoric acid was significantly negatively interrelated to high-sensitivity C-reactive protein (hs-CRP). There were significantly negative correlations between L-phenylalanine and L. intestinalis, beta-glycerophosphoric acid and Prevotellaceae. G. elata Blume protected against CIRI, which may be related to improved intestinal microflora composition and metabolism, resulting in decreased inflammation.

Aspergillus violaceofuscus alleviates cadmium and chromium stress in Okra through biochemical modulation.

Endophytic fungi from the Chilli were used to help okra plants exposed to cadmium (Cd) or chromium (Cr) stress. Initially, the strain Ch06 produced higher amounts of indole acetic acid (IAA) (230.5 µg/mL), sugar (130.7 µg/mL), proteins (128.2 µg/mL), phenolics (525.6 µg/mL) and flavonoids (98.4 µg/mL) in Czapek broth supplemented with Cd or Cr. The production of IAA and other metabolites in such a higher concentration suggested that Ch06 might improve plant growth under heavy metal stress. For this reason, an experiment was designed, in which biomass of Ch06 (at 2g/100g of sand) were applied to the okra plants exposed to Cd or Cr stress (at 100 or 500 µg/g). The results exhibited that Ch06 improved the total chlorophyll (36.4±0.2 SPAD), shoot length (22.6±0.2 cm), root length (9.1±0.6 cm), fresh weight (5±0.6 g), dry weight (1.25±0.01 g), sugars (151.6 µg/g), proteins (114.8 µg/g), proline (6.7 µg/g), flavonoids (37.9 µg/g), phenolics (70.7 µg/g), IAA (106.7 µg/g), catalase (0.75 enzyme units/g tissue) and ascorbic acid oxidaze (2.2 enzyme units/g tissue) of the associated okra plants. Similar observations have been recorded in Ch06 associated okra plants under Cd and Cr stress. Also, Ch06 association reduced translocation of Cd (35% and 45%) and Cr (47% and 53%) to the upper parts of the okra plants and thus reduced their toxicity. The internal transcribed spacer (ITS) region amplification of 18S rDNA (ribosomal deoxyribo nucleic acid) exhibited that the potent strain Ch06 was Aspergillus violaceofuscus. The results implied that A. violaceofuscus has the ability to promote host species growth exposed to Cd and Cr. Moreover, it helped the host plants to recover in Cd and Cr polluted soils, hence can be used as biofertilizer.

Lycium barbarum Polysaccharide Regulates the Lipid Metabolism and Alters Gut Microbiota in High-Fat Diet Induced Obese Mice.

Bioactive compounds provide new insights into the prevention and treatment of obesity. Lycium barbarum polysaccharide (LBP), a biological macromolecule extracted from Goji berry, has displayed potential for regulating lipid metabolism. However, the relationship between gut microbiota regulation and lipid metabolism is not entirely clear. In the present study, 50, 100, and 150 mg/kg LBP were intragastrically administered to C57BL/6J male mice fed with a high-fat diet simultaneously lasting for twelve weeks. The results showed that 150 mg/kg LBP showed significant results and all doses of LBP feeding (50, 100, 150 mg/kg) remarkably decreased both serum and liver total cholesterol (TC) and triglyceride (TG) levels. Treatment of 150 mg/kg LBP seems to be more effective in weight loss, lowering free fatty acid (FFA) levels in serum and liver tissues of mice. LBP feeding increased the gene expression of adiponectin and decreased the gene expression of peroxisome proliferator-activated receptor γ, Cluster of Differentiation 36, acetyl-coA carboxylase, and fatty acid synthase in a dose-dependent manner. In addition, the 16s rDNA Sequencing analysis showed that 150 mg/kg LBP feeding may significantly increase the richness of gut microbiota by up-regulation of the ACE and Chao1 index and altered ß-diversity among groups. Treatment of 150 mg/kg LBP feeding significantly regulated the microbial distribution by decreasing the relative abundance of Firmicutes and increasing the relative abundance of Bacteroidetes at the phylum level. Furthermore, the relative abundance of Faecalibaculum, Pantoea, and uncultured_bacterium_f_Muribaculaceae at the genus level was significantly affected by LBP feeding. A significant correlation was observed between body weight, TC, TG, FFA and bile acid and phyla at the genus level. The above results indicate that LBP plays a vital role in preventing obesity by co-regulating lipid metabolism and gut microbiota, but its effects vary with the dose.

Ameliorative Effect of Chitosan Oligosaccharides on Hepatic Encephalopathy by Reshaping Gut Microbiota and Gut-Liver Axis.

This study investigated the influence of chitosan oligosaccharides (COSs) on a thioacetamide-induced hepatic encephalopathy (HE) Wistar rat model. COS treatment statistically reduced the false neurotransmitters and blood ammonia in HE rats, along with the suppression of oxidative stress and inflammation. The disbalanced gut microbiota was detected in HE rats by 16S rDNA sequencing, but the abundance alterations of some intestinal bacteria at either the phylum or genus level were at least partly restored by COS treatment. According to metabolomics analysis of rat feces, six metabolism pathways with the greatest response to HE were screened, several of which were remarkably reversed by COS. The altered metabolites might serve as a bridge for the alleviated HE rats treated with COS and the enhanced intestinal bacterial structure. This study provides novel guidance to develop novel food or dietary supplements to improve HE diseases due to the potential beneficial effect of COS on gut-liver axis.

Phytoplankton community and HAB species in the South China Sea detected by morphological and metabarcoding approaches.

The southern Chinese coast is one of the most developed regions in China and is an area where harmful algal blooms (HABs) have occurred frequently. In this study, differences in the phytoplankton community between microscopic observations and 18S rDNA metabarcoding were compared in 89 surface water samples collected from the southern Chinese coast and the western South China Sea (SCS). This is the first report investigating the phytoplankton community and HAB species using a combination of morphological and metabarcoding approaches in this sea area. There were substantial differences in phytoplankton community structure detected by the two methods. Microscopic observation revealed diatom predominance in the phytoplankton community, while metabarcoding indicated dinoflagellate dominance. The phytoplankton community structure obtained by microscopic observation better reflects the real situation in the water column. Metabarcoding annotated more species than morphospecies observed by microscopy. Haptophyta and Cryptophyta were the specific phyla detected in metabarcoding but were missed in microscopy due to their small size. Conversely, some taxa were found in microscopic analysis alone, such as species in Dinophysis, Prorocentrum, and Scrippsiella, suggesting some biases during metabarcoding and gaps in sequence databases. Metabarcoding is superior for detecting morphologically cryptic, small-sized and HAB taxa, such as unarmored dinoflagellates, nanosized hatophytes and chlorophytes, as well as multiple species in Alexandrium, Pseudonitzschia, and Chaetoceros in our study. A total of 62 HAB taxa were identified in this study, including blooming and potentially toxic species. Diatom abundances generally decreased southward, while those of dinoflagellates and haptophytes showed the opposite trend. Chlorophytes were mainly distributed in coastal waters, especially in the Pearl River Estuary. Phytoplankton community structures were shaped by nutrients and salinity, and phosphorus was the most limiting factor for phytoplankton growth. The phytoplankton community in the western SCS showed unique characteristics away from those in the coastal sea areas. The results suggest that the combination of morphological and metabarcoding approaches comprehensively reveals the phytoplankton community structure and diversity of HAB species.