The composition characteristics of endophytic communities and their relationship with metabolites profile in Ephedra sinica under wild and cultivated conditions.

Ephedra sinica is one of the most famous Chinese medicinal plants. The insufficient supply of wild resources has led to the increased use of cultivated products. However, the related medicinal quality differs significantly. Although the influence of external environment on the quality of E. sinica has been studied, the impact of endophytic microbes on it remains vague. This study characterized differential metabolites and microbial community compositions in wild and cultivated E. sinica by combining metabolomics with microbiomics, and explored the effect of endophytes on the formation of differential metabolites further. The results showed that the difference in quality between wild and cultivated E. sinica was mainly in the productions of alkaloids, flavonoids, and terpenoids. The associated endophytes had special compositional characteristics. For instance, the distribution and abundance of dominant endophytes varied between wild and cultivated E. sinica. Several endophytes had significant or highly significant correlations with the formations of ephedrine, pseudoephedrine, D-cathinone, methcathinone, coumarin, kaempferol, rhamnetin, or phenylacetic acid. This study will deepen our understanding of the plant-endophyte interactions and provide a strategy for the quality control of E. sinica products.

Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Localization of Major Ephedra Alkaloids in Whole Aerial Parts of Ephedrae Herba Using Direct Analysis in Real Time-Time of Flight-Mass Spectrometry.

Mass spectrometry-based molecular imaging has been utilized to map the spatial distribution of target metabolites in various matrixes. Among the diverse mass spectrometry techniques, matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS) is the most popular for molecular imaging due to its powerful spatial resolution. This unparalleled high resolution, however, can paradoxically act as a bottleneck when the bio-imaging of large areas, such as a whole plant, is required. To address this issue and provide a more versatile tool for large scale bio-imaging, direct analysis in real-time-time of flight-mass spectrometry (DART-TOF-MS), an ambient ionization MS, was applied to whole plant bio-imaging of a medicinal plant, Ephedrae Herba. The whole aerial part of the plant was cut into 10-20 cm long pieces, and each part was further cut longitudinally to compare the contents of major ephedra alkaloids between the outer surface and inner part of the stem. Using optimized DART-TOF-MS conditions, molecular imaging of major ephedra alkaloids of the whole aerial part of a single plant was successfully achieved. The concentration of alkaloids analyzed in this study was found to be higher on the inner section than the outer surface of stems. Moreover, side branches, which are used in traditional medicine, represented a far higher concentration of alkaloids than the main stem. In terms of the spatial metabolic distribution, the contents of alkaloids gradually decreased towards the end of branch tips. In this study, a fast and simple macro-scale MS imaging of the whole plant was successfully developed using DART-TOF-MS. This application on the localization of secondary metabolites in whole plants can provide an area of new research using ambient ionization mass spectroscopy and an unprecedented macro-scale view of the biosynthesis and distribution of active components in medicinal plants.

Identification and Phylogenetic Analysis of the Complete Chloroplast Genomes of Three Ephedra Herbs Containing Ephedrine.

Ephedrae Herba and Ephedrae Radix et Rhizoma (Mahuang) have been used as Chinese herbal medicines. Ephedra plants mainly live in deserts and have good governance of desertification. Despite their important medicinal and environmental protection value, dietary supplements containing ephedrine from Ephedra species may threaten the health of people. Morphological resemblance amongst species causes difficulty in identifying the original species of Ephedra herbs. Chloroplast (CP) genome shows good prospects in identification and phylogenetic analysis. This study introduced the structures of the CP genomes of three Ephedra species and analysed their phylogenetic relationships. Three complete CP genomes of Ephedra showed four-part annular structures, namely, two single-copy regions and two inverted repeat regions. The entire CP genomes of three Ephedra species in terms of size were 109,550 bp (E. sinica), 109,667 bp (E. intermedia), and 109,558 bp (E. equisetina). Each CP genome of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes. Eleven high-variation regions were screened through mVISTA to be potential specific DNA barcodes for identifying Ephedra species. Maximum likelihood and maximum parsimony trees showed that CP genomes could be used to identify Ephedra species. The Ephedra species had a close phylogenetic relationship with Gnetum species and Welwitschia mirabilis. This research provided valuable information for the identification and phylogenetic analysis of gymnosperms and drug safety of Ephedra.

Ephedrine as a lead compound for the development of new DPP-IV inhibitors.

AIM: Extracts from Ephedra species have been reported to be effective as antidiabetics. A previous in silico study predicted that ephedrine and five ephedrine derivatives could contribute to the described antidiabetic effect of Ephedra extracts by inhibiting dipeptidyl peptidase IV (DPP-IV). Finding selective DPP-IV inhibitors is a current therapeutic strategy for Type 2 diabetes mellitus management. Therefore, the main aim of this work is to experimentally determine whether these alkaloids are DPP-IV inhibitors. Materials & methods: The DPP-IV inhibition of Ephedra's alkaloids was determined via a competitive-binding assay. Then, computational analyses were used in order to find out the protein-ligand interactions and to perform a lead optimization. RESULTS: Our results show that all six molecules are DPP-IV inhibitors, with IC50 ranging from 124 µM for ephedrine to 28 mM for N-methylpseudoephedrine. CONCLUSION: Further computational analysis shows how Ephedra's alkaloids could be used as promising lead molecules for designing more potent and selective DPP-IV inhibitors.

Determination of the Metabolite of Ephedrine, 4-Hydroxyephedrine, by LC-MS-MS in Rat Urine and Its Application in Excretion Profiles After Oral Administration of Ephedra sinica Stapf and Processing Ephedra sinica Stapf.

This study aims to study the changes of metabolism of Ephedra sinica Stapf caused by processing. A sensitive and rapid high-performance liquid chromatographic tandem mass spectrometry (LC-MS-MS) method was developed for the quantitation of the major metabolite of ephedrine, 4-hydroxyephedrine, utilizing lidocaine as the internal standard in rat urine. Urine samples were precipitated with acetonitrile. Chromatographic separation was achieved on an Ultimate C18 analytical column. Detection was performed by a multiple reaction monitoring mode via an electrospray ionization source operating in the positive ionization mode. The method was linear over the concentration range of 0.05-1.0c for all components. The intra- and inter-day precision values were <13.2% and the deviations ranged from -8.4% to 7.5%. The recoveries at three levels were more than 66.2%. The fully validated method was used to study the pharmacokinetic profile of 4-hydroxyephedrine in rat urine to investigate the effects caused by processing.

Benzaldehyde is a precursor of phenylpropylamino alkaloids as revealed by targeted metabolic profiling and comparative biochemical analyses in Ephedra spp.

Ephedrine and pseudoephedrine are phenylpropylamino alkaloids widely used in modern medicine. Some Ephedra species such as E. sinica Stapf (Ephedraceae), a widely used Chinese medicinal plant (Chinese name: Ma Huang), accumulate ephedrine alkaloids as active constituents. Other Ephedra species, such as E. foeminea Forssk. (syn. E. campylopoda C.A. Mey) lack ephedrine alkaloids and their postulated metabolic precursors 1-phenylpropane-1,2-dione and (S)-cathinone. Solid-phase microextraction analysis of freshly picked young E. sinica and E. foeminea stems revealed the presence of increased benzaldehyde levels in E. foeminea, whereas 1-phenylpropane-1,2-dione was detected only in E. sinica. Soluble protein preparations from E. sinica and E. foeminea stems catalyzed the conversion of benzaldehyde and pyruvate to (R)-phenylacetylcarbinol, (S)-phenylacetylcarbinol, (R)-2-hydroxypropiophenone (S)-2-hydroxypropiophenone and 1-phenylpropane-1,2-dione. The activity, termed benzaldehyde carboxyligase (BCL) required the presence of magnesium and thiamine pyrophosphate and was 40 times higher in E. sinica as compared to E. foeminea. The distribution patterns of BCL activity in E. sinica tissues correlates well with the distribution pattern of the ephedrine alkaloids. (S)-Cathinone reductase enzymatic activities generating (1R,2S)-norephedrine and (1S,1R)-norephedrine were significantly higher in E. sinica relative to the levels displayed by E. foeminea. Surprisingly, (1R,2S)-norephedrine N-methyltransferase activity which is a downstream enzyme in ephedrine biosynthesis was significantly higher in E. foeminea than in E. sinica. Our studies further support that benzaldehyde is the metabolic precursor to phenylpropylamino alkaloids in E. sinica.

Metabolome analysis of Ephedra plants with different contents of ephedrine alkaloids by using UPLC-Q-TOF-MS.

Metabolome analysis of four varieties of Ephedra plants, which contain different amounts of ephedrine alkaloids, was demonstrated in this study. The metabolites were comprehensively analyzed by using ultra performance liquid chromatography (UPLC) coupled with quadrupole time-of-flight mass spectrometry (Q-TOF-MS) and the ephedrine alkaloids were also profiled. Subsequently, multivariate analyses of principal component analysis (PCA) and batch-learning self-organizing mapping (BL-SOM) analysis were applied to the raw data of the total ion chromatogram (TIC). PCA was performed to visualize the fingerprints characteristic for each Ephedra variant and the independent metabolome clusters were formed. The metabolite fingerprints were also visualized by BL-SOM analysis and were displayed as a lattice of colored individual cells which was characteristic for each Ephedra variant. BL-SOM analysis was also used for identification of chemical marker peaks because the information assigned to a cell represented either increases or decreases in peak intensities. Using this analysis, ephedrine alkaloids were successfully selected from the TICs as chemical markers for each Ephedra variant and this result suggested that BL-SOM analysis was an effective method for the selection of marker metabolites. We report our study here as a practical case of metabolomic study on medicinal resources.

[Studies on the semi-biosynthesis of L-ephedrine (I). Studies on the biosynthesis of L-phenyl acetyl carbinol].

OBJECTIVE: The optimal biosynthesis of L-PAC by immobilized Sc-5 yeast cell was systematically studied in this paper. METHOD: Biosynthesis. RESULT AND CONCLUSION: The average of L-PAC yield produced by the immobilized Sc-5 yeast cell is > or = 2 g.L-1 and half life > or = 240 h.

Selected herbals and human exercise performance.

Herbs have been used throughout history to enhance physical performance, but scientific scrutiny with controlled clinical trials has only recently been used to study such effects. The following herbs are currently used to enhance physical performance regardless of scientific evidence of effect: Chinese, Korean, and American ginsengs; Siberian ginseng, mahuang or Chinese ephedra; ashwagandha; rhodiola; yohimbe; CORDYCEPS: fungus, shilajit or mummio; smilax; wild oats; Muira puama; suma (ecdysterone); Tribulus terrestris; saw palmetto berries; beta-sitosterol and other related sterols; and wild yams (diosgenin). Controlled studies of Asian ginsengs found improvements in exercise performance when most of the following conditions were true: use of standardized root extracts, study duration (>8 wk, daily dose >1 g dried root or equivalent, large number of subjects, and older subjects. Improvements in muscular strength, maximal oxygen uptake, work capacity, fuel homeostasis, serum lactate, heart rate, visual and auditory reaction times, alertness, and psychomotor skills have also been repeatedly documented. Siberian ginseng has shown mixed results. Mahuang, ephedrine, and related alkaloids have not benefited physical performance except when combined with caffeine. Other herbs remain virtually untested. Future research on ergogenic effects of herbs should consider identity and amount of substance or presumed active ingredients administered, dose response, duration of test period, proper experimental controls, measurement of psychological and physiologic parameters (including antioxidant actions), and measurements of performance pertinent to intended uses.

The effect of an herbal dietary supplement containing ephedrine and caffeine on oxygen consumption in humans.

OBJECTIVE: To determine if an herbal dietary supplement for weight loss increases metabolism. DESIGN: Measurement of peak oxygen consumption in response to the supplement followed by a double-blind placebo-controlled crossover measurement of oxygen consumption in response to the supplement. SETTING: The study was conducted in an academic research clinic. SUBJECTS: Ten obese females (aged 41 +/- 4 years [body mass index (BMI)] 33.3 +/- 2.6 kg/m2) participated in the peak oxygen consumption test; six of these females participated in the crossover trial. INTERVENTIONS AND OUTCOME MEASURES: Peak oxygen consumption was measured for 45 minutes after taking two herbal dietary supplement capsules orally, each containing the equivalent of 10 mg of caffeine and 5 mg of ephedrine. The crossover trial measured oxygen consumption for 45 minutes after taking two herbal dietary supplement capsules or two placebo capsules orally. RESULTS: The herbal dietary supplement increased peak oxygen consumption 0.178 +/- 0.03 (SEM) kcal/min (8.01 +/- 1.35 kcal/min expressed over 45 minutes) above baseline (p < 0.0001), and 2.0 +/- 0.56 kcal/min over 45 minutes compared to placebo (p < 0.006). CONCLUSIONS: The herbal dietary supplement increased oxygen consumption when taken according to the package directions. The significance of this rise for weight loss requires further research.

Investigation of the impurities found in methamphetamine synthesised from pseudoephedrine by reduction with hydriodic acid and red phosphorus.

The synthesis of methamphetamine from pseudoephedrine via the reduction with hydriodic acid and red phosphorus was studied and the impurities which were generated, along with the methamphetamine, were investigated. Some of the impurities found have been reported previously, while the diastereoisomers of N-methyl-N-(alpha- methylphenethyl)amino-1-phenyl-2-propanone and the cis-cinnamoyl derivative of methamphetamine are reported here for the first time. Further work on the sequence of reactions occurring in this reduction is also reported.