Development of a Genus-Universal Nucleotide Signature for the Identification and Supervision of Ephedra-Containing Products.

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.

Relationship between ephedrine alkaloid profile in Ephedra gerardiana and soil characteristics of glacial landforms in southeastern Tibetan Plateau, China.

In the Kaluxung River catchment of the southeastern Tibetan Plateau in China, we identified three Ephedra gerardiana communities on different soils and glacial landforms from 4842 to 4899 m above sea level: a moraine community located on constantly collapsing sandy gravel alpine steppe slopes with exposed bedrock on the outer slope of the terminal moraine of the Qiangyong Glacier on Mt. Kaluxung; an outwash plain community located on a gentle alpine steppe slope with exposed bedrock at the terminal end of the outwash plain in the glacial valley of the southeast side of Mt. Noijinkangsang; and a river terrace community located in an alpine meadow on a rock-scattered flat river terrace along a glacier-fed river in the outwash plain in the glacial valley of the southeast side of Mt. Noijinkangsang. Based on the finding of identical DNA sequences of the intergenic spacers of chloroplast trnT-trnF and trnS-trnfM regions for all Ephedra specimens examined in this study, the E. gerardiana in this study were considered to comprise a genetically homogeneous population. Analysis of the relationship between ephedrine alkaloid profiles of these three communities and soil characteristics showed that the river terrace community in wet alpine meadow had significantly lower ephedrine content than did the moraine and outwash plain communities in dry alpine steppe (moraine community, 1.52 ± 0.44; outwash plain community, 1.42 ± 0.68; river terrace community, 0.33 ± 0.65%DW), but pseudoephedrine content showed the reverse pattern (moraine community, 0.86 ± 0.30; outwash plain community, 0.73 ± 0.60; river terrace community, 1.50 ± 0.71%DW). In addition, total alkaloid (ephedrine and pseudoephedrine) content in the river terrace community (1.83 ± 0.24%DW) was significantly lower than that in the moraine community (2.38 ± 0.64%DW) and outwash plain community (2.15 ± 0.55%DW).

Identification and Phylogenetic Analysis of the Complete Chloroplast Genomes of Three Ephedra Herbs Containing Ephedrine.

Ephedrae Herba and Ephedrae Radix et Rhizoma (Mahuang) have been used as Chinese herbal medicines. Ephedra plants mainly live in deserts and have good governance of desertification. Despite their important medicinal and environmental protection value, dietary supplements containing ephedrine from Ephedra species may threaten the health of people. Morphological resemblance amongst species causes difficulty in identifying the original species of Ephedra herbs. Chloroplast (CP) genome shows good prospects in identification and phylogenetic analysis. This study introduced the structures of the CP genomes of three Ephedra species and analysed their phylogenetic relationships. Three complete CP genomes of Ephedra showed four-part annular structures, namely, two single-copy regions and two inverted repeat regions. The entire CP genomes of three Ephedra species in terms of size were 109,550 bp (E. sinica), 109,667 bp (E. intermedia), and 109,558 bp (E. equisetina). Each CP genome of the three Ephedra species encoded 118 genes, including 73 protein-coding genes, 37 tRNA genes and 8 ribosomal RNA genes. Eleven high-variation regions were screened through mVISTA to be potential specific DNA barcodes for identifying Ephedra species. Maximum likelihood and maximum parsimony trees showed that CP genomes could be used to identify Ephedra species. The Ephedra species had a close phylogenetic relationship with Gnetum species and Welwitschia mirabilis. This research provided valuable information for the identification and phylogenetic analysis of gymnosperms and drug safety of Ephedra.

Phylogenic Analysis and Evaluation of Ephedra Plants and Aconites for Medicinal Use.

Although Kampo medicine is now fully integrated into the modern Japanese healthcare system, most Kampo formulations depend on imported crude drugs from limited foreign areas. To prepare for possible shortages of crude drugs in the future, a wider scope for the supply of medicinal plants is necessary. We conducted field research and collaborated with international laboratories for phylogenic analysis and evaluation of medicinal plant resources. Our research on ephedra plants from a wide region of Eurasia has, for example, confirmed their phylogenic structure: based on DNA sequencing analysis of nuclear ribosomal internal transcribed spacer region 1 (ITS1) as well as the chloroplast intergenic spacer between trnL and trnF (trnL-F), the 8 major Chinese species and related plants grown on the continent could be divided into 3 groups. Additionally, Ephredra sinica was found to be synonymous with Ephredra dahurica and was reduced to a subspecies of Ephredra distachya. Furthermore, Ephredra likiangensis and Ephredra gerardiana, which are grouped in separate phylogenic trees, would be good candidates for medicinal material. Aconites from Hokkaido, as an example of domestic plants reviewed, were collected for phylogenic and aconitine alkaloid content analysis. The phylogenic analysis of nr ITSs revealed that the majority of specimens were genetically similar. However, the aconitine alkaloid content of the tuberous roots demonstrated that specimens from different habitats had varying alkaloid profiles. Environmental pressure of each habitat is presumed to have caused the morphology and aconitine alkaloid profiles of these genetically similar specimens to diversify.

Deep sequencing of plant and animal DNA contained within traditional Chinese medicines reveals legality issues and health safety concerns.

Traditional Chinese medicine (TCM) has been practiced for thousands of years, but only within the last few decades has its use become more widespread outside of Asia. Concerns continue to be raised about the efficacy, legality, and safety of many popular complementary alternative medicines, including TCMs. Ingredients of some TCMs are known to include derivatives of endangered, trade-restricted species of plants and animals, and therefore contravene the Convention on International Trade in Endangered Species (CITES) legislation. Chromatographic studies have detected the presence of heavy metals and plant toxins within some TCMs, and there are numerous cases of adverse reactions. It is in the interests of both biodiversity conservation and public safety that techniques are developed to screen medicinals like TCMs. Targeting both the p-loop region of the plastid trnL gene and the mitochondrial 16S ribosomal RNA gene, over 49,000 amplicon sequence reads were generated from 15 TCM samples presented in the form of powders, tablets, capsules, bile flakes, and herbal teas. Here we show that second-generation, high-throughput sequencing (HTS) of DNA represents an effective means to genetically audit organic ingredients within complex TCMs. Comparison of DNA sequence data to reference databases revealed the presence of 68 different plant families and included genera, such as Ephedra and Asarum, that are potentially toxic. Similarly, animal families were identified that include genera that are classified as vulnerable, endangered, or critically endangered, including Asiatic black bear (Ursus thibetanus) and Saiga antelope (Saiga tatarica). Bovidae, Cervidae, and Bufonidae DNA were also detected in many of the TCM samples and were rarely declared on the product packaging. This study demonstrates that deep sequencing via HTS is an efficient and cost-effective way to audit highly processed TCM products and will assist in monitoring their legality and safety especially when plant reference databases become better established.

Successful isolation and PCR amplification of DNA from National Institute of Standards and Technology herbal dietary supplement standard reference material powders and extracts.

Twenty-four herbal dietary supplement powder and extract reference standards provided by the National Institute of Standards and Technology (NIST) were investigated using three different commercially available DNA extraction kits to evaluate DNA availability for downstream nucleotide-based applications. The material included samples of Camellia, Citrus, Ephedra, Ginkgo, Hypericum, Serenoa, And Vaccinium. Protocols from Qiagen, MoBio, and Phytopure were used to isolate and purify DNA from the NIST standards. The resulting DNA concentration was quantified using SYBR Green fluorometry. Each of the 24 samples yielded DNA, though the concentration of DNA from each approach was notably different. The Phytopure method consistently yielded more DNA. The average yield ratio was 22 : 3 : 1 (ng/microL; Phytopure : Qiagen : MoBio). Amplification of the internal transcribed spacer II region using PCR was ultimately successful in 22 of the 24 samples. Direct sequencing chromatograms of the amplified material suggested that most of the samples were comprised of mixtures. However, the sequencing chromatograms of 12 of the 24 samples were sufficient to confirm the identity of the target material. The successful extraction, amplification, and sequencing of DNA from these herbal dietary supplement extracts and powders supports a continued effort to explore nucleotide sequence-based tools for the authentication and identification of plants in dietary supplements.

Ephedra resource in Sichuan and Yunnan Provinces 2007.

Wild Ephedra plants growing near the Tibetan border of Yunnan and Sichuan Provinces and north-central Sichuan were surveyed and their DNA and ephedrine alkaloids content were analyzed. By analysis of internal transcribed spacer 1 (ITS) 1 DNA, E. likiangensis was found to be the dominant species in these regions, which clustered into 2 major groups in the phylogenic tree. Most Ephedra plants in these regions of ordinal size contained ephedrine and pseudoephedrine of more than 0.7%, the requirement for Japanese Pharmacopoeia 15th edition, suggesting that they have potential for crude drug production of Ephedra herbs.

Molecular analysis and chemical evaluation of ephedra plants in Mongolia.

Ephedrae herba has been used in traditional Chinese and Japanese (Kampo) medicine from ancient times, with the primary resource being in China. In the present study, a field survey as well as molecular and chemical assessments were conducted on Ephedra plants in Mongolia to clarify whether they could be an alternative resource of the Ephedrae herba used in Japanese Kampo medicine. Ephedra sinica, E. equisetina, E. przewalskii, E. regeliana, E. monosperma and an unknown taxon (ESP) collected in Mongolia were divided into 9 genotypes on the basis of nucleotide sequences of 18S ribosomal RNA (rRNA) gene and trnK gene. E. sinica, E. equisetina, and E. monosperma presented completely identical sequences to the corresponding species from China. The sequences of trnK gene and 18S rRNA gene provide a useful index for identification and taxonomic classification of Mongolian Ephedra plants. Quantitative analysis of 5 ephedrine alkaloids revealed that almost all Mongolian Ephedra plants contained high amounts of total ephedrine alkaloids (TAs, 1.86-4.90%) and a high percentage of pseudoephedrine in TAs differed obviously from the Chinese. E. sinica and E. equisetina found in eastern and central Mongolia, showing total contents of ephedrine and pseudoephedrine higher than 1.43%, were potential new resources of Japanese Pharmacopoeia grade Ephedrae herba.

[Staining and slide-preparing technique of mitotic chromosomes and application in karyotype determination of Ephedra].

OBJECTIVE: To study the karyotype of four Ephedra plants in order to provide the cytologic evidence for the genetic diversity and identification genetic resources of Ephedra. METHOD: The roots of germinating seeds were used to study the karyotype of four Ephedra plants by staining and slide-preparing technique of mitotic chromosomes. RESULT: the optimal root-sampling time was about 10: 20 - 10:40 am. Using 0.002 mol x L(-1) 8-Hydroxyquinoline to pretreating the intravital root tips, the optimal pretreatment time for E. Sinica, E. intermedina, E. equisetina and E. przewalskii was 4, 5, 4.5 and 3.5 h, respectively. E. przewalskii and E. equisetina were diploid, E. Sinica and E. intermedina were belonged quadruple. The karyotype formulae of the four species were 2n = 2x = 14 = 2M + 8m + 4sm, 2n = 2x = 14 = 10m + 4st, 2n = 4x = 28 = 20m (2SAT) +8st, and 2n = 4x = 28 = 20m (SAT) + 6st + 2sm, respectively. CONCLUSION: All the karyotypes of four Ephedra species were 2A type, which was the symmetric karyotype.

Molecular characterization of Ephedra species found in Pakistan.

Ephedra, also known as "ma huang", is a dioecious, drought- and frost-resistant, perennial, evergreen shrub with compelling medicinal value. The genus is represented by 42 species around the world, 9 of which were provisionally reported from Pakistan. Species of the genus have a controversial taxonomy due to their overlapping morphological features. Conventional tools alone are not sufficient for characterizing the species. The objective of present study was to assess the genetic variability present in different biotypes of Ephedra growing in Pakistan using molecular markers. A total of six genotypes collected from diverse geographic zones of Pakistan were used. The DNA of all genotypes was amplified using nine randomly amplified polymorphic DNA (RAPD) primers to study genetic variability at the molecular level. The dissimilarity coefficient matrix based on the data of 9 RAPD primers was used to construct a dendrogram which was then used to group the genotypes in clusters. Based on the dendrogram and dissimilarity coefficient matrix, the RAPD markers used here revealed a moderate to high level of genetic polymorphism (6 to 49%) among the genotypes. It was found that the collection of genotype accessions from Swat Valley in northwestern Pakistan was most distantly related to the other five collections. More molecular markers including functional genes and ribosomal spacer regions are suggested to find a better estimate of the genetic diversity present in Ephedra growing in Pakistan. The information provided here is useful for identifying valuable Ephedra variants which will be used for medicinal purposes and earning foreign currency.

Molecular characterization of Ephedra species found in Pakistan

Ephedra, also known as “ma huang”, is a dioecious, drought- and frost-resistant, perennial, evergreen shrub with compelling medicinal value. The genus is represented by 42 species around the world, 9 of which were provisionally reported from Pakistan. Species of the genus have a controversial taxonomy due to their overlapping morphological features. Conventional tools alone are not sufficient for characterizing the species. The objective of present study was to assess the genetic variability present in different biotypes of Ephedra growing in Pakistan using molecular markers. A total of six genotypes collected from diverse geographic zones of Pakistan were used. The DNA of all genotypes was amplified using nine randomly amplified polymorphic DNA (RAPD) primers to study genetic variability at the molecular level. The dissimilarity coefficient matrix based on the data of 9 RAPD primers was used to construct a dendrogram which was then used to group the genotypes in clusters. Based on the dendrogram and dissimilarity coefficient matrix, the RAPD markers used here revealed a moderate to high level of genetic polymorphism (6 to 49%) among the genotypes. It was found that the collection of genotype accessions from Swat Valley in northwestern Pakistan was most distantly related to the other five collections. More molecular markers including functional genes and ribosomal spacer regions are suggested to find a better estimate of the genetic diversity present in Ephedra growing in Pakistan. The information provided here is useful for identifying valuable Ephedra variants which will be used for medicinal purposes and earning foreign currency.

Sequence analysis of chloroplast chlB gene of medicinal Ephedra species and its application to authentication of Ephedra Herb.

Chloroplast chlB gene encoding subunit B of light-independent protochlorophyllide reductase was amplified from herbarium and crude drug specimens of Ephedra sinica, E. intermedia, E. equisetina, and E. przewalskii. Sequence comparison of the chlB gene indicated that all the E. sinica specimens have the same sequence type (Type S) distinctive from other species, while there are two sequence types (Type E1 and Type E2) in E. equisetina. E. intermedia and E. prezewalskii revealed an identical sequence type (Type IP). E. sinica was also identified by digesting the chlB fragment with Bcl I. A novel method for DNA authentication of Ephedra Herb based on the sequences of the chloroplast chlB gene and internal transcribed spacer of nuclear rRNA genes was developed and successfully applied for identification of the crude drugs obtained in the Chinese market.

Studies on cultivated ephedra plants in inner mongolia autonomous region and ningxia hui autonomous region.

Progression of the desertification in northern China has been causing damage to wild Ephedra plants on which we depend for most of supply of the traditional herbal medicine, "Ma huang." The Chinese government encourages the cultivation of Ephedra plants, and Ephedra fields have been reclaimed in the original Ephedra habitats in recent years. We surveyed 7 Ephedra fields that have been recently developed in the Inner Mongolia Autonomous Region and Ningxia Hui Autonomous Region to collect information on Ephedra plant cultivation, especially pertaining to crop species. Specimens taken from those Ephedra fields were genetically and morphologically analyzed, and their ephedrine alkaloid content was examined. DNA analyses of Ephedra specimens, including DNA sequencing of ITS (internal transcribing sequence of nuclear ribosomal DNA) and trn L/F (intron of trnL and intergenic spacer between the trnL and trnF of chloroplast DNA) region and species-specific amplification of trn L/F were conducted to identify Ephedra species. Based on the results of DNA sequencing and morphological determination, the crops grown in 6 fields ware identified as Ephedra sinica, while co-planting of E. sinica and E. intermedia was found in one field where a higher appearance rate of plants with varied morphology from wild Ephedra plants was observed. Furthermore, direct sequencing of the PCR product of the trn L/F region of some specimens from the field and their species-specific PCR showed ambivalent result. Cloning and sequencing of the PCR product of the trn L/F region of those specimens DNA suggested their heteroplasmy, containing both E. sinica- and E. intermedia-type chloroplasts. On the other hand, the profile of the ephedrine alkaloid content was clearly correlated with the result of direct sequencing of the trn L/F region; the specimens showing the E. sinica-type sequence contained more ephedrine than pseudoephedrine, and the specimens of the E. intermedia-type more pseudoephedrine.

Survey on resources of Ephedra plants in Xinjiang.

The resources of wild Ephedra plants in the Xinjiang Uygur Autonomous Region were surveyed. Ephedra plants mainly grow on the fringes of the Taklimakan Desert and Gureban-tonggute Desert. We found six genotypes of Ephedra przewalskii growing widely in Xinjiang. Three genotypes of Ephedra intermedia were limited to the northern and eastern parts, and Ephedra regeliana scattered in the northern part of Xinjiang. These Ephedra specimens were analyzed for DNA sequences of nuclear ribosomal DNA, internal transcribed spacers 1 and 2, chloroplastic DNA, trnL intron and trnL-trnF intergenic spacer. Intraspecific variation of the nucleotide sequence in E. przewalskii was found in different habitats. Norephedrine, ephedrine, pseudoephedrine, and methylephedrine contents of the specimens were determined. Although Ephedra intermedia of all three genotypes contained ephedrine alkaloids, ephedrine alkaloids were not detected in E. regeliana and E. przewalskii.

On the evolutionary history of Ephedra: Cretaceous fossils and extant molecules.

Gnetales comprise three unusual genera of seed plants, Ephedra, Gnetum, and Welwitschia. Their extraordinary morphological diversity suggests that they are survivors of an ancient, more diverse group. Gnetalean antiquity is also supported by fossil data. Dispersed "ephedroid" (polyplicate) pollen first appeared in the Permian >250 million years ago (Myr), and a few megafossils document the presence of gnetalean features in the early Cretaceous. The Cretaceous welwitschioid seedling Cratonia cotyledon dates the split between Gnetum and Welwitschia to before 110 Myr. Ages and character evolution of modern diversity are, however, controversial, and, based on molecular data, it has recently been suggested that Ephedra is very young, only 8-32 Myr. Here, we present data on the evolutionary history of Ephedra. Fossil seeds from Buarcos, Portugal, unequivocally link one type of Cretaceous polyplicate pollen to Ephedra and document that plants with unique characters, including the peculiar naked male gametophyte, were established already in the Early Cretaceous. Clades in our molecular phylogeny of extant species correspond to geographical regions, with African species in a basal grade/clade. The study demonstrates extremely low divergence in both molecular and morphological characters in Ephedra. Features observed in the fossils are present in all major extant clades, showing that modern species have retained unique reproductive characters for >110 million years. A recent origin of modern species of Ephedra would imply that the Cretaceous Ephedra fossils discussed here were members of widespread, now extinct sister lineage(s), and that no morphological innovations characterized the second diversification.

Phylogenetic analysis of the DNA sequence of the non-coding region of nuclear ribosomal DNA and chloroplast of Ephedra plants in China.

Twenty-four Ephedra plants belonging to 8 species grown in the northern and western parts of China were phylogenetically analyzed for their non-coding DNA sequences, internal transcribed spacers (ITSs) of nuclear ribosomal DNA as well as trnL intron and intergenic spacers between trnL and trnF (trnL/ trnF) of the chloroplast. Based on the ITS sequences, the 8 species could be divided into 3 groups: Group 1 (Ephedra intermedia, E. sinica, E. przewalskii), Group 2 (E. equisetina, E. monosperma, E. gerardiana), and Group 3 (E. likiangensis, E. minuta). The species classified into Group 1 grow mainly in the north, Group 3 in the south and Group 2 in the center, suggesting their genetic and geographic relationships. A specific primer set was designed to classify the 3 groups by routine PCR. Combined analysis of ITS and trnL/ trnF differentiated the 8 Ephedra species.