Coagulation as an effective method for cyanobacterial bloom control: A review.

Eutrophication, the over-enrichment with nutrients, for example, nitrogen and phosphorus, of ponds, reservoirs and lakes, is an urgent water quality issue. The most notorious symptom of eutrophication is a massive proliferation of cyanobacteria, which cause aquatic organism death, impair ecosystem and harm human health. The method considered to be most effective to counteract eutrophication is to reduce external nutrient inputs. However, merely controlling external nutrient load is insufficient to mitigate eutrophication. Consequently, a rapid diminishing of cyanobacterial blooms is relied on in-lake intervention, which may encompass a great variety of different approaches. Coagulation/flocculation is the most used and important water purification unit. Since cyanobacterial cells generally carry negative charges, coagulants are added to water to neutralize the negative charges on the surface of cyanobacteria, causing them to destabilize and precipitate. Most of cyanobacteria and their metabolites can be removed simultaneously. However, when cyanobacterial density is high, sticky secretions distribute outside cells because of the small size of cyanobacteria. The sticky secretions are easily to form complex colloids with coagulants, making it difficult for cyanobacteria to destabilize and resulting in unsatisfactory treatment effects of coagulation on cyanobacteria. Therefore, various coagulants and coagulation methods were developed. In this paper, the focus is on the coagulation of cyanobacteria as a promising tool to manage eutrophication. Basic principles, applications, pros and cons of chemical, physical and biological coagulation are reviewed. In addition, the application of coagulation in water treatment is discussed. It is the aim of this review article to provide a significant reference for large-scale governance of cyanobacterial blooms. PRACTITIONER POINTS: Flocculation was a promising tool for controlling cyanobacteria blooms. Basic principles of four kinds of flocculation methods were elucidated. Flocculant was important in the flocculation process.

Comparison of the wastewater treatment performance of continuously and discontinuously mixed high-rate algal ponds at Kingston on Murray.

High-rate algal ponds (HRAPs) incorporate shallow raceway designs and paddlewheel mixing. HRAPs use UV disinfection and the symbiotic environment between microalgal photosynthesis and heterotrophic bacteria for the assimilation of nutrients for efficient wastewater treatment. Mixing of a HRAP provides a homogenous environment and influences both the disinfection of pathogens and algal growth by exposing the wastewater to sunlight. Guidelines require continuous mixing of the HRAP. This study aimed to determine the effect of cessation of mixing for 10 days, on wastewater treatment by comparison with a continuously mixed pond operated over the same period. The period of 10 days was equivalent to the HRAP hydraulic retention time. Samples of inlet and HRAP-treated wastewater were collected from the HRAP at Kingston on Murray. Parameters measured were Escherichia coli, chlorophyll a, total suspended solids (TSS), NH4-N, NO2-N, NO3-N, PO4-P and biochemical oxygen demand (BOD5). The discontinuously mixed and the continuously mixed HRAPs complied with the wastewater effluent guidelines, of an E. coli concentration ≤104 MPN100 mL-1 and a BOD5 of <20 mg L-1. An E. coli log reduction value of >1 was also recorded. This study shows that cessation of mixing for 10 days had no significant effect on HRAP wastewater treatment performance.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

Fertilization intensities at the buffer zones of ponds regulate nitrogen and phosphorus pollution in an agricultural watershed.

The sudden increase in water nutrients caused by environmental factors have always been a focus of attention for ecologists. Fertilizer inputs with spatio-temporal characteristics are the main contributors to water pollution in agricultural watersheds. However, there are few studies on the thresholds of nitrogen (N) and phosphorus (P) fertilization rates that affect the abrupt deterioration of water quality. This study aims to investigate 28 ponds in Central China in 2019 to reveal the relationships of basal and topdressing fertilization intensities in surrounding agricultural land with pond water N and P concentrations, including total N (TN), nitrate (NO3--N), ammonium (NH4+-N), total P (TP), and dissolved P (DP). Abrupt change analysis was used to determine the thresholds of fertilization intensities causing sharp increases in the pond water N and P concentrations. Generally, the observed pond water N and P concentrations during the high-runoff period were higher than those during the low-runoff period. The TN, NO3--N, TP, DP concentrations showed stronger positive correlations with topdressing intensities, while the NH4+-N concentrations exhibited a higher positive correlation with basal intensities. On the other hand, the NO3--N concentrations had a significant positive correlation with the topdressing N, basal N, and catchment slope interactions. Significant negative correlations were observed between all water quality parameters and pond area. Spatial scale analysis indicated that fertilization practices at the 50 m and 100 m buffer zone scales exhibited greater independent effects on the variations in the N and P concentrations than those at the catchment scale. The thresholds analysis results of fertilization intensities indicated that pond water N concentrations increased sharply when topdressing and basal N intensities exceeded 163 and 115 kg/ha at the 100 and 50 m buffer zone scales, respectively. Similarly, pond water P concentrations rose significantly when topdressing and basal P intensities exceeded 117 and 78 kg/ha at the 50 m buffer zone scale, respectively. These findings suggest that fertilization management should incorporate thresholds and spatio-temporal scales to effectively mitigate pond water pollution.

Exploring the accumulation capacity of dominant plants based on soil heavy metals forms and assessing heavy metals contamination characteristics near gold tailings ponds.

Heavy metal contamination of soil commonly accompanies problems around gold mine tailings ponds. Fully investigating the distribution characteristics of heavy metals and the survival strategies of dominant plants in contaminated soils is crucial for effective pollution management and remediation. This study aims to investigate the contamination characteristics, sources of heavy metals (As, Cd, Pb, Hg, Cu, Zn, Cr, and Ni) in soils around gold mine tailings ponds areas (JHH and WZ) and to clarify the form distribution of heavy metals (As, Cd, Pb, Hg) in contaminated plots as well as their accumulation and translocation in native dominant plants. The results of the study showed that the concentrations of As, Pb, Cd, Cu, and Zn in soil exceeded the national limits at parts of the sampling sites in both study areas. The Nemerow pollution index showed that both study areas reached extreme high pollution levels. Spatial analysis showed that the main areas of contamination were concentrated around metallurgical plants and tailings ponds, with Cd exhibiting the most extensive area of contamination. In the JHH, As (74%), Cd (66%), Pb (77%), Zn (47%) were mainly from tailings releases, and Cu (52%) and Hg (51%) were mainly from gold ore smelting. In the WZ, As (42%), Cd (41%), Pb (73%), Cu (47%), and Zn (41%) were mainly from tailings releases. As, Cd, Pb, and Hg were mostly present in the residue state, and the proportion of water-soluble, ion-exchangeable, and carbonate-bound forms of Cd (19.93%) was significantly higher than that of other heavy metals. Artemisia L. and Amaranthus L. are the primary dominating plants, which exhibited superior accumulation of Cd compared to As, Pb, and Hg, and Artemisia L. demonstrated a robust translocation capacity for As, Pb, and Hg. Compared to the concentrations of other forms of soil heavy metals, the heavy metal content in Artemisia L correlates significantly better with the total soil heavy metal concentration. These results offer additional systematic data support and a deeper theoretical foundation to bolster pollution-control and ecological remediation efforts in mining areas.

Extraction of eutrophic and green ponds from segmentation of high-resolution imagery based on the EAF-Unet algorithm.

Inland ponds exhibit remarkable ubiquity across the globe, playing a vital role in the sustainability of global continental freshwater resources and contributing significantly to their biodiversity. Numerous ponds are eutrophic and experience recurrent seasonal or year-round algal blooms or persistent duckweed cover, conferring a characteristic green hue. Here, we denote these eutrophic and green ponds as EGPs. The excessive proliferation of algal blooms and duckweed within these EGPs poses a significant threat to the ecological functioning of these aquatic systems, which can lead to hypoxia or the release of microcystins. To identify these EGPs automatically, we constructed an Efficient Attention Fusion Unet (EAF-Unet) algorithm using Gaofen-2 (GF2) panchromatic and multispectral imagery. The attention mechanism was incorporated in Unet to help better detect EGPs. Using the first EGP labeled dataset, we determined the best input feature combination (RGB, NIR, NDVI, and Bright) and the most effective encoding (Rasnet50) for EAF-Unet for distinguishing EGPs from other ground cover types. The evaluation indices - Precision (0.81), Recall (0.79), F1-Score (0.80), and Intersection over Union (IoU, 0.67) - indicate that EAF-Unet can accurately and robustly extract EGPs from GF2 images without relying on pond water masks. Remote-sensing EGP products can assist in identifying ponds with severe eutrophication. Moreover, these products can serve as references for identifying high-risk areas prone to improper sewage discharge or inadequate sewer construction.

Evaluation of water quality in fee-fishing ponds located in Guarapirangas sub basin, Upper Tietê River basin, São Paulo State / Avaliação da qualidade da água de pesqueiros localizados na Sub-Bacia Guarapiranga, Alto Tietê, SP

Abstract This study intended to characterize the fee-fishing ponds located in Guarapiranga's sub-basin both in terms of structure and environmental conditions. The studied region was mapped and 15 out of 24 georeferenced fee-fishing ponds had their owners interviewed through semi-structured questionnaires. In addition to that, samples were collected from the seven fee-fishing ponds closest to the reservoir throughout a seasonal cycle divided in four sample collections carried out between November 2013 and August 2014, aiming at measuring the following variables in situ: water flow rates, pH, turbidity, electrical conductivity and dissolved oxygen concentration in affluents and effluents. Other samples were taken in order to assess total phosphorus (TP) and total nitrogen (TN) concentrations. Our results show a decrease in dissolved oxygen concentration along with an increase in TP and TN concentration in effluents, as compared to affluents. TP e TN concentrations exceeded the permitted values established by CONAMA 357/2005 - Class II resolution in all effluents at least during part of the year. High nutrient levels were observed in affluents, condition with which basins that have been affected by population growth are commonly met. It was verified, by interviewing the owners regarding venture management and by analyzing the collected samples, that there is significant correlation between the daily feeding and the TP and TN levels (p=0.021 and p=0.045, respectively), with the ponds where feeding is more intense having showed the highest nutrient levels in their effluents. The results highlight the importance of mitigation measures such as educating the owners on proper water management, the installation of pond aerators in conjunction with tanks the filters of which shall be composed of aquatic macrophytes in their effluents, as well as awareness campaigns aiming to reduce the usage of dough by fishermen in order to minimize detrimental impacts on Guarapiranga's sub-basin.

Resumo Este estudo objetivou caracterizar, em termos estruturais e ambientais pesqueiros localizados na sub-bacia da Guarapiranga. A região de estudo foi mapeada, e do total de 24 pesque-pague georreferenciados, 15 foram entrevistados com os proprietários através de questionários semi-estruturados e, nos sete pesque-pagues com tributários mais próximos da represa, foram coletadas amostras de água em um ciclo sazonal divididas em quatro coletas entre novembro de 2013 a agosto de 2014. Foram medidos in situ: vazão, pH, turbidez, condutividade elétrica e oxigênio dissolvido nos afluentes e efluentes, e também foram coletadas amostras de água para determinação da concentração de fósforo total (PT) e nitrogênio total (NT). Os resultados mostraram que há uma diminuição nas concentrações de oxigênio dissolvido e aumento nas concentrações de PT e NT nos efluentes em relação aos afluentes. Os efluentes apresentaram valores de PT e NT acima dos limites permitidos pela resolução CONAMA 357/2005 - Classe II, ao menos em um período do ano. Também foram identificados afluentes com cargas elevadas de nutrientes, característica de bacias impactadas pelo adensamento populacional. Através do questionário aplicado aos proprietários sobre o manejo dos empreendimentos e pelas análises de água verificou-se que houve correlação significativa entre o arraçoamento diário e as cargas de PT e de NT (p=0,021 e p=0,045, respectivamente), sendo que nos locais onde o arraçoamento foi mais intenso, a carga de nutrientes nos efluentes foi maior. Os resultados evidenciam a importância de medidas mitigadoras como orientações aos proprietários para o manejo adequado dos lagos, projetos de educação ambiental com os usuários para diminuir do uso de ceva para a captura dos peixes, além da instalação de aeradores artificiais nos lagos e tanques com filtros compostos de macrófitas aquáticas nos seus efluentes, minimizando os impactos na sub-bacia do Guarapiranga.

Effects of season on ecological processes in extensive earthen tilapia ponds in Southeastern Brazil / Efeitos da época sobre os processos ecológicos em viveiros escavados para criação extensiva de tilápias no Sudeste do Brasil

Abstract In Southeastern Brazil tilapia culture is conducted in extensive and semi-intensive flow-through earthen ponds, being water availability and flow management different in the rainy and dry seasons. In this region lettuce wastes are a potential cheap input for tilapia culture. This study examined the ecological processes developing during the rainy and dry seasons in three extensive flow-through earthen tilapia ponds fertilized with lettuce wastes. Water quality, plankton and sediment parameters were sampled monthly during a year. Factor analysis was used to identify the ecological processes occurring within the ponds and to construct a conceptual graphic model of the pond ecosystem functioning during the rainy and dry seasons. Processes related to nitrogen cycling presented differences between both seasons while processes related to phosphorus cycling did not. Ecological differences among ponds were due to effects of wind protection by surrounding vegetation, organic loading entering, tilapia density and its grazing pressure on zooplankton. Differences in tilapia growth among ponds were related to stocking density and ecological process affecting tilapia food availability and intraspecific competition. Lettuce wastes addition into the ponds did not produce negative effects, thus this practice may be considered a disposal option and a low-cost input source for tilapia, at least at the amounts applied in this study.

Resumo No sudeste do Brasil, a criação extensiva e semi-intensiva de tilápias é realizada em viveiros escavados com fluxo contínuo, com a disponibilidade e manejo do fluxo de água diferentes nas épocas chuvosa e seca. Na região, os resíduos de alface são um recurso potencialmente de baixo custo para a tilapicultura. Este estudo examinou os processos ecológicos ocorrendo em três viveiros escavados com fluxo contínuo fertilizados com restos de alface para criação extensiva de tilápias durante as épocas chuvosa e seca. Parâmetros de qualidade de água, plâncton e sedimento foram amostrados mensalmente durante um ano. A análise de fator foi utilizada para identificar os processos ecológicos nos viveiros e elaborar um modelo gráfico do funcionamento do ecossistema dos viveiros durante as duas épocas. Os processos relacionados ao ciclo do nitrogênio mostraram diferenças entre as duas épocas, enquanto que os processos relacionados com o ciclo do fósforo não foram influenciados pela época. As diferenças ecológicas entre os viveiros foram principalmente devido aos efeitos do vento, adição de material orgânico e densidade de estocagem. Diferenças no crescimento das tilápias entre os viveiros relacionaram-se com a densidade de estocagem e os processos ecológicos afetando a disponibilidade de alimento e a competição intraespecífica. A adição dos restos de alface nos viveiros não resultou em efeitos negativos, assim esta prática pode ser considerada um destino alternativo e um recurso de baixo custo para a criação extensiva de tilápias, pelo menos nas quantidades investigadas neste estudo.