[Identification of Cervi Cornu (Cervus elaphus) and its formula granules based on PCR-RFLP].

Cervi Cornu is the ossified antler, or the base antler that falls off in the spring of the following year after the pilose antler is sawn off from Cervus elaphus or C. nippon, as a precious traditional Chinese medicine, has been recognized for its medicinal value and widely used in clinical practice. However, the origins of Cervi Cornu are miscellaneous, and Cervi Cornu is even mixed with adulterants in the market. Currently, there is a shortage of ways to identify Cervi Cornu and no standard to control the quality of Cervi Cornu. So it is valuable to develop a way to effectively identify Cervi Cornu from the adulterants. In this study, the differences in the mitochondrial barcode cytochrome b(Cytb) gene sequences of C. elaphus, C. nippon and their related species were compared and the specific single nucleotide polymorphism(SNP) sites on the Cytb sequences of Cervi Cornu were screened out. According to the screened SNPs, Cervi Cornu-specific primers dishmy-F and dishmy-R were designed. The PCR system was established and optimized, and the tolerance and feasibility of Taq polymerases and PCR systems affecting the repeatability of the PCR method were investigated. The amplification products of C. elaphus and C. nippon were digested using the restriction enzyme MseⅠ. The results showed that after electrophoresis of the product from PCR with the annealing temperature of 56 ℃ and 35 cycles, a single specific band at about 100 bp was observed for C. elaphus samples, and the product of C. elaphus samples was 60 bp shorter than that of C. nippon samples. There was no band for adulterants from other similar species such as Alces alces, Rangifer tarandus, Odocoileus virginianus, O. hemionus, Cap-reolus pygargus, Przewalskium albirostis and negative controls. The polymerase chain reaction-restriction fragment length polymorphism(PCR-RFLP) method established in this study can quickly and accurately identify Cervi Cornu originated from C. elaphus in crude drugs, standard decoctions, and formula granules, and distinguish the origins of Cervi Cornu products, i.e., C. nippon and similar species. This study can be a reference for other studies on the quality standard of other formula granules of traditional Chinese medicines.

Development of a loop-mediated isothermal amplification assay for the rapid detection of Styphnolobium japonicum (L.) Schott as an adulterant of Ginkgo biloba (L.).

BACKGROUND: Species adulteration is a concern in herbal products, especially when plant substitutes of lower economic value replace valuable botanicals. Styphnolobium japonicum is well known as a potential adulterant of Ginkgo biloba, which is one of the most demanded medicinal plants due to its wide use in pharmaceuticals, food supplements, and traditional medicine. Despite bearing some resemblance to ginkgo's flavonol composition, S. japonicum lacks many of G. biloba's desired therapeutic properties. To prevent adulteration practices, it is crucial to implement rigorous quality control measures, including fast and simple diagnostic tools that can be used on-field. PURPOSE: This study aims to develop for the first time a species-specific loop-mediated isothermal amplification (LAMP) method for the fast identification of S. japonicum in ginkgo-containing products. METHODS: A set of four specific primers (SjF3, SjB3, SjFIP, and SjBIP) and loop primers (SjLF and SjLB) were designed for a LAMP based assay using the 5.8S partial sequence and the internal transcribed spacer 2 of nuclear ribosomal DNA of S. japonicum. RESULTS: The successful amplification of the LAMP assay was inspected through visual detection, with the highest intensity recorded at the optimal conditions set at 68 °C for 40 min. The primers showed high specificity and were able to accurately discriminate S. japonicum from G. biloba and 49 other species of medicinal plants. Furthermore, the proposed LAMP assay proved to be fast, selective, and highly sensitive, as demonstrated by the absolute and relative limits of detection, which were reached at 0.5 pg for S. japonicum DNA and 0.01 % S. japonicum in G. biloba, respectively. CONCLUSIONS: This novel approach allows easy identification and discrimination of S. japonicum as a potential adulterant of G. biloba, thus being a useful tool for quality control. Compared to chromatographic or PCR-based methods, the assay proved to be fast, sensitive and did not require expensive equipment, thus offering the possibly usage in field analysis.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

DNA Sensor for the Detection of Brucella spp. Based on Magnetic Nanoparticle Markers.

Due to the limitations of conventional Brucella detection methods, including safety concerns, long incubation times, and limited specificity, the development of a rapid, selective, and accurate technique for the early detection of Brucella in livestock animals is crucial to prevent the spread of the associated disease. In the present study, we introduce a magnetic nanoparticle marker-based biosensor using frequency mixing magnetic detection for point-of-care testing and quantification of Brucella DNA. Superparamagnetic nanoparticles were used as magnetically measured markers to selectively detect the target DNA hybridized with its complementary capture probes immobilized on a porous polyethylene filter. Experimental conditions like density and length of the probes, hybridization time and temperature, and magnetic binding specificity, sensitivity, and detection limit were investigated and optimized. Our sensor demonstrated a relatively fast detection time of approximately 10 min, with a detection limit of 55 copies (0.09 fM) when tested using DNA amplified from Brucella genetic material. In addition, the detection specificity was examined using gDNA from Brucella and other zoonotic bacteria that may coexist in the same niche, confirming the method's selectivity for Brucella DNA. Our proposed biosensor has the potential to be used for the early detection of Brucella bacteria in the field and can contribute to disease control measures.

Isolation and identification of two pathogens causing leaf spot of Fritillaria taipaiensis P. Y. Li. in China.

Fritillaria taipaiensis P. Y. Li is one of the biological sources for Fritillariae Cirrhosae Bulbus. Its bulbs are widely used for treating respiratory diseases such as pneumonia, bronchitis and influenza. Cultivated F. taipaiensis suffers from many diseases during its growing season. Leaf spot is a destructive disease that is increasingly affecting F. taipaiensis and can cause an incidence of up to 30% in severe cases. Leaf spot inhibits the growth of F. taipaiensis by causing disease spots on the surface of leaves. In severe cases, these spots can result in leaf desiccation and blackspot formation at the lesion site, leading to a decrease in photosynthesis. Leaf spot has shown little benefit, and it can even result in a reduced yield of bulbs and the death of plants. According to previous studies, Alternaria alternata has been identified as the pathogen of leaf spot in many medicinal plants, but the main pathogens of the leaf spot of F. taipeiensis remains uncertain. In this paper, five isolates from diseased leaves of F. taipaiensis were isolated and purified and the pathogenicity test showed that isolates B-5 and B-7 induced leaf spot symptoms on healthy F. taipaiensis leaves. Integrating multiple phylogenetic analyses of rDNA using Internal transcribed spacer region (ITS), Beta-tubulin (TUB2), RNA polymerase II second largest subunit (RPB2) and Translation elongation factor 1-alpha (TEF1-a) primers, strain B-5 and strain B-7 were eventually identified as Didymella segeticola and A. alternata. This is also the first report on the pathogens that cause leaf spot in F. taipaiensis in China.

Digital PCR: A Tool to Authenticate Herbal Products and Spices.

Authentication of herbal products and spices is experiencing a resurgence using DNA-based molecular tools, mainly species-specific assays and DNA barcoding. However, poor DNA quality and quantity are the major demerits of conventional PCR and real-time quantitative PCR (qPCR), as herbal products and spices are highly enriched in secondary metabolites such as polyphenolic compounds. The third-generation digital PCR (dPCR) technology is a highly sensitive, accurate, and reliable method to detect target DNA molecules as it is less affected by PCR inhibiting secondary metabolites due to nanopartitions. Therefore, it can be certainly used for the detection of adulteration in herbal formulations. In dPCR, extracted DNA is subjected to get amplification in nanopartitions using target gene primers, the EvaGreen master mix, or fluorescently labeled targeted gene-specific probes. Here, we describe the detection of Carica papaya (CP) adulteration in Piper nigrum (PN) products using species-specific primers. We observed an increase in fluorescence signal as the concentration of target DNA increased in PN-CP blended formulations (mock controls). Using species-specific primers, we successfully demonstrated the use of dPCR in the authentication of medicinal botanicals.

Genetic Authentication of the Medicinal Plant Portulaca oleracea Using a Quick, Precise, and Sensitive Isothermal DNA Amplification Assay.

Portulaca oleracea (PO) is a commonly known medicinal crop that is an important ingredient for traditional Chinese medicine (TCM) due to its use as a vegetable in the diet. PO has been recorded to be frequently adulterated by other related species in the market of herbal plants, distorting the PO plant identity. Thus, identification of the botanical origin of PO is a crucial step before pharmaceutical or functional food application. In this research, a quick assay named "loop-mediated isothermal amplification (LAMP)" was built for the specific and sensitive authentication of PO DNA. On the basis of the divergences in the internal transcribed spacer 2 (ITS2) sequence between PO and its adulterant species, the LAMP primers were designed and verified their specificity, sensitivity, and application for the PO DNA authentication. The detection limit of the LAMP assay for PO DNA identification specifically was 100 fg under isothermal conditions at 63 °C for 30 min. In addition, different heat-processed PO samples can be applied for use in PO authentication in the LAMP assay. These samples of PO were more susceptible to the effect of steaming in authentication by PCR than boiling and drying treatment. Furthermore, commercial PO samples pursued from herbal markets were used to display their applicability of the developed LAMP analysis for PO postharvest authentication, and the investigation found that approximately 68.4% of PO specimens in the marketplace of herbal remedies were adulterated. In summary, the specific, sensitive, and rapid LAMP assay for PO authentication was first successfully developed herein, and its practical application for the inspection of adulteration in PO samples from the herbal market was shown. This LAMP assay created in this study will be useful to authenticate the botanical origin of PO and its commercial products.

Molecular quantification for differentiation of fresh and dried Jinqian Baihua She.

Freshly-used crude drugs have unique functions and advantages in TCM practice of treating diseases. Jinlong Capsule is a patent traditional Chinese medicine product effective for treatment of hepatocarcinoma, and fresh Jinqian Baihua She (JBS, the body of juvenile Bungarus multicinctus) is one of its important ingredients. The emergence of counterfeit fresh JBS, often identified as dried JBS with almost identical appearance, poses a difficult problem in the quality control of the product. Herein we report a molecular quantification-based method for differentiation of fresh and dried JBS by determining the copy number of a specific DNA marker in the samples. Using species-specific primers and TaqMan probes, we established a real-time quantitative PCR system for amplification of a fragment in the 658-bp cytochrome oxidase subunit I (COI) region from JBS specimens. The amplicon copy number in the muscle tissues ranged from 1.14 × 107 to 4.83 × 107 copies/mg in fresh JBS samples, as compared with 1.13 × 105-8.91 × 106 copies/mg in dried JBS samples. Based upon Fisher discriminant analysis, we used 1.27 × 107 copies/mg as the cut-off value for differentiating fresh and dried JBS, which was validated in the single-blinded validation test of fresh and dried JBS samples. This qPCR system may provide an efficient means for accurate identification of fresh JBS to improve the quality control of the medicinal product.

Herbal species authentication by melting fingerprint coupled with high resolution melting analysis (MF-HRM).

BACKGROUND: Herbal medicines have recently attracted increasing attention for use as food supplements with health benefits; however, species authentication can be difficult due to incomplete morphological characters. Here, a molecular tool was developed for the identification of species in the National List of Essential Medicinal Plants in Thailand. METHODS: The identification process used DNA fingerprints including start codon targeted (SCoT) and inter simple sequence repeat (ISSR) polymorphisms, coupled with high resolution melting (HRM), to produce melting fingerprint (MF)-HRM. RESULTS: Results indicated that MF-HRM, SCoT-HRM and ISSR-HRM could be used for DNA fingerprints as S34, S36, S9 and S8 of SCoT and UBC873, S25 and UBC841 of ISSR. The melting fingerprints obtained from S34 of SCoT exhibited the best primers for identification of herbal species with 87.5% accuracy and relatively high repeatability. The presence of intraspecific variation in a few species affected the shift of melting fingerprints within species. MF-HRM using S34 showed improved species prediction compared to DNA fingerprints. The concentration of DNA with 10 ng/µl was recommended to perform MF-HRM. MF-HRM enabled species authentication of herbal commercialized products at only 20% resulting from the low quality of DNA isolated, while admixture of multiple product species interfered with the MF process. CONCLUSION: Findings suggested that MF-HRM showed promise as a molecular tool for the authentication of species in commercial herbal products with high specificity, moderate repeatability and rapidity without prior sequence information. This information will greatly improve quality control and traceability during the manufacturing process.

Prevalence and molecular characterization of important potato viruses in the Tokat province of Turkey.

BACKGROUND: It is believed that viruses affect potato yield more than any other pathogens worldwide. METHOD AND RESULTS: We report here on a survey of the four most common potato viruses in the Tokat Province of northern Turkey. Leaf samples were collected from potato plants showing signs of viral diseases in five districts of the province. Over 400 leaf samples were tested using RT-PCR with virus-specific primers. Among the one or more viruses detected in 218 (52%) leaf samples, Potato virus Y (PVY) was the most common (47.1%), followed by potato virus S (PVS; 16.7%), potato virus X (PVX; 6.0%) and potato leaf roll virus (PLRV; 5.3%). The most common mixed infections were PVY + PVS (6.9%). A phylogenetic analysis of the gene sequences showed all Turkish PVS isolates to be clustered with the PVSO group, two PVY isolates with the PVYN-WI group and one isolate with the PVYNTN group. Turkish PVX isolates are in the Type X group of the two major PVX isolate groups. The Turkish PLRV isolates were separated into two major groups depending on the results of the phylogenetic analysis, with six cases in Group 1 and one in Group 2. CONCLUSIONS: PVY, PVX, PVS and PLRV were detected in potato production areas in Tokat. A phylogenetic comparison of the gene sequences revealed all Turkish isolates to be immigrant members of the world populations of these viruses. Our results emphasize the importance of the strict quarantine control of plant materials entering Turkey.

Rapid varietal authentication of oolong tea products by microfluidic-based SNP genotyping.

Oolong tea is one of the most popular Chinese teas, and its quality is significantly affected by the variety of tea plant. The growing demands lead to the adulteration of premium oolong tea products, e.g., Tieguanyin oolong tea. In this study, microfluidic technology and single-nucleotide polymorphism (SNP) biomarkers were used to authenticate the varieties of oolong tea products. Forty-eight pairs of primers were screened, and they can be used to authenticate Tieguanyin oolong tea via high-throughput microfluidic SNP chips. Through the combination of the NJ tree and PCoA plot methods, the study found that the most frequent adulterant of Tieguanyin oolong tea on the market is Benshan. For the first time, the commercial behavior of using Fuyun6 and Jinguanyin as adulterants or contamination in the production of Tieguanyin oolong tea was reported. This research has proposed rapid authentication technology for oolong tea to provide food quality supervision and promote consumer trust.

Rapid and precise detection of cryptic tea pathogen Exobasidium vexans: RealAmp validation of LAMP approach.

This work embodies the development of a real time loop mediated isothermal amplification (RealAmp) assay for the rapid detection of the cryptic tea phytopathogen, Exobasidium vexans, the causal organism of blister blight disease. Due to the widespread popularity of tea as a beverage and the associated agro-economy, the rapid detection and management of the fast-spreading blister blight disease have been a longstanding necessity. Loop-mediated isothermal amplification (LAMP) primers were designed targeting the E. vexans ITS rDNA region and the reaction temperature was optimized at 62 °C with a 60 min reaction time. Amplification of the E. vexans isolates in the initial LAMP reactions was confirmed by both agarose gel electrophoresis and SYBR Green I dye based colour change visualization. The specificity of the LAMP primers for E. vexans was validated by negative testing of seven different phytopathogenic test fungi using LAMP and RealAmp assay. The positive findings in RealAmp assay for E. vexans strain were corroborated via detecting fluorescence signals in real-time. Further, the LAMP assays performed with gDNA isolated from infected tea leaves revealed positive amplification for the presence of E. vexans. The results demonstrate that this rapid and precise RealAmp assay has the potential to be applied for field-based detection of E. vexans in real-time.

Detection of Highly Poisonous Nerium oleander Using Quantitative Real-Time PCR with Specific Primers.

Nerium oleander is one of the most poisonous plants, and its accidental ingestion has frequently occurred in humans and livestock. It is vital to develop a rapid and accurate identification method for the timely rescue of oleander-poisoned patients and the investigation of poisoning cases. In this study, a specific and highly sensitive quantitative real-time PCR (qPCR)-based method was developed to identify oleander in mixture systems and simulated forensic specimens (SFS). First, a new pair of oleander-specific primers, JZT-BF/BR, was designed and validated. Then, a qPCR method was developed using the primers, and its detective sensitivity was examined. The results showed that JZT-BF/BR could specifically identify oleander in forage and food mixtures, and qPCR was capable of accurate authentication even at a low DNA concentration of 0.001 ng/µL. This method was further applied to the analysis of SFS containing different ratios of N. oleander. The method was confirmed to be applicable to digested samples, and the detection limit reached 0.1% (w/w) oleander in mixture systems. Thus, this study undoubtedly provides strong support for the detection of highly toxic oleander and the diagnosis of food poisoning in humans and animals.

Genome-wide analysis of milk vetch dwarf virus and related alphasatellites from garlic and aphids in Shandong Province, China.

In 2019 and 2020, symptoms of dwarfing, yellowing, and reddening were observed in garlic in open fields in Shandong Province, China. Milk vetch dwarf virus (MDV) was detected in aphids and symptomatic garlic plants using polymerase chain reaction analysis. Furthermore, it was demonstrated using an aphid transmission test that garlic is a natural host of MDV. Rolling-circle amplification was combined with the use of specific primers to amplify the complete genomes of MDV and its related alphasatellites. This is the first report of complete genome sequences of MDV and related alphasatellites from garlic and aphid samples.

Intraspecific Identification of Lingzhi Medicinal Mushroom, Ganoderma lingzhi (Agaricomycetes), Using ISSR Markers.

This study aimed to obtain a set of specific inter simple sequence repeat (ISSR) primers and establish a stable and accurate intraspecific identification method for Ganoderma lingzhi. A total of 117 G. lingzhi strains were identified using internal transcribed spacer sequences from 147 strains determined as G. lingzhi via simple morphological identification. Based on the sequences obtained, specific ISSR primers for G. lingzhi were screened and validated, and 15 specific ISSR primers showed polymorphic banding pattern with clear band resolution. Subsequently, ISSR PCRs of the 15 specific primers were performed for the 117 G. lingzhi strains. As expected, DNA analysis of the ISSR markers could distinguish G. lingzhi strains, with similarity coefficients ranging from 0.11 to 0.89. Thus, the 15 specific ISSR primers can be used for intraspecific identification and polymorphism analysis of G. lingzhi.

Identification of Andrographis Herba and its common products using mini-barcode.

Andrographis Herba, the aerial part of Andrographis paniculata (Burm. f.) Wall. ex Nees (Acanthaceae), has a wide geographic distribution and has been used for the treatment of fever, cold, inflammation, and other infectious diseases. In markets, sellers and buyers commonly inadvertently confuse with related species. In addition, most Chinese medicinal herbs are subjected to traditional processing procedures, such as steaming and boiling, before they are sold at dispensaries; therefore, it is very difficult to identify Andrographis Herba when it is processed into Chinese medicines. The identification of species and processed medicinal materials is a growing issue in the marketplace. However, conventional methods of identification have limitations, while DNA barcoding has received considerable attention as a new potential means to identify species and processed medicinal materials. In this study, 17 standard reference materials of A. paniculata, 2 standard decoctions, 27 commercial products and two adulterants were collected. Based on the ITS2 sequence, it could successfully identify A. paniculata and adulterants. Moreover, a nucleotide signature consisting of 71 bp was designed, this sequence is highly conserved and specific within A. paniculata while divergent among other species. Then, we used these new primers to amplify the nucleotide signature region from processed materials. In conclusion, the DNA barcoding method developed in the present study for authenticating A. paniculata is rapid and cost-effective. It can be used in the future to guarantee the quality of Andrographis Herba of each regulatory link for clinical use.

The genetic authentication of Panax ginseng and Panax quinquefolius based on using single nucleotide polymorphism (SNP) conducted in a nucleic acid test chip.

Panax ginseng and Panax quinquefolius, which are commonly called Chinese ginseng and American ginseng respectively, have different medicinal properties and market values; however, these samples can be difficult to differentiate from one another based on physical appearances of the samples especially when they are in powdery or granular forms. A molecular technique is thus needed to overcome this difficulty; this technique is based on the nucleic acid test (NAT) conducted on the microfluidic chip surface. Three single nucleotide polymorphism (SNP) sites (i.e. N1, N2, N3) on the Panax genome that differ between P. ginseng (G) and P. quinquefolius (Q) have been selected to design probes for the NAT. Primers were designed to amplify the antisense strands by asymmetric PCR. We have developed three different NAT methodologies involving surface immobilization and subsequent (stop flow or dynamic) hybridization of probes (i.e. N1G, N1Q, N2G, N2Q, N3Q) to the antisense strands. These NAT methods consist of two steps, namely immobilization and hybridization, and each method is distinguished by what is immobilized on the microfluidic chip surface in the first step (i.e. probe, target or capture strand). These three NATs developed are called probe-target method 1, target-probe method 2 and three-strand complex method 3. Out of the three methods, it was found that the capture strand-target-probe method 3 provided the best differentiation of the ginseng species, in which a 3' NH2 capture strand is first immobilized and the antisense PCR strand is then bound, while N2G and N3Q probes are used for detection of P. ginseng (G) and P. quinquefolius (Q) respectively.

[DNA methylation diversity analysis of Lycium barbarum samples from different cultivation areas based on MSAP].

Obvious epigenetic differentiation occurred on Lycium barbarum in different cultivation areas in China. To investigate the difference and change rule of DNA methylation level and pattern of L. barbarum from different cultivation areas in China, the present study employed fluorescence-assisted methylation-sensitive amplified polymorphism(MSAP) to analyze the methylation level and polymorphism of 53 genomic DNA samples from Yinchuan Plain in Ningxia, Bayannur city in Inner Mongolia, Jingyuan county and Yumen city in Gansu, Delingha city in Qinghai, and Jinghe county in Xinjiang. The MSAP technical system suitable for the methylation analysis of L. barbarum genomic DNA was established and ten pairs of selective primers were selected. Among amplified 5'-CCGG-3' methylated sites, there were 35.85% full-methylated sites and 39.88% hemi-methylated sites, showing a high degree of epigenetic differentiation. Stoichiometric analysis showed that the ecological environment was the main factor affecting the epigenetic characteristics of L. barbarum, followed by cultivated varieties. Precipitation, air temperature, and soil pH were the main ecological factors affecting DNA methylation in different areas. This study provided a theoretical basis for the analysis of the epigenetic mechanism of L. barbarum to adapt to the diffe-rent ecological environments and research ideas for the introduction, cultivation, and germplasm traceability of L. barbarum.

Development of a protocol for the elimination of Cyrtanthus elatus virus-A from Narcissus tazetta by in vitro chemotherapy in combination with electrotherapy.

Narcissus (Narcissus tazetta) is a bulbous ornamental plant propagated vegetatively from bulbs. The Cyrtanthus elatus virus-A (CyEV-A) had been reported to cause a severe mosaic and yellow stripe disease in narcissus. Therefore, this study aimed to develop a protocol for the elimination of CyEV-A from infected bulblets by in vitro chemotherapy (30-50 mg/L ribavirin for 30 days) and electrotherapy (10-30 mA for 20 min), individually and in combination, to produce virus-free plants. The regenerated plants obtained from these treatments were screened for the absence of the CyEV-A by reverse-transcription polymerase chain reaction assays using a set of degenerate primers specific for a potyvirus coat protein gene. The results showed that in vitro chemotherapy (30 mg/L ribavirin for 30 days) alone produced 46.0 % (14/30) of virus-free plants, while electrotherapy (20 mA for 20 min) alone produced 40.0 % (12/30) of virus-free plants. In comparison, a combination of chemotherapy (30 mg/L ribavirin for 30 days) and electrotherapy (20 mA for 20 min) produced 50.0 % (15/30) of virus-free plants. The virus-free plants obtained from this combination treatment exhibited better growth and produced more bulbs compared to the other treatments and control. The protocol may be used for the control of the virus disease in narcissus.

Identification of Andrographis Herba and its common products using mini-barcode / 中国天然药物

Andrographis Herba, the aerial part of Andrographis paniculata (Burm. f.) Wall. ex Nees (Acanthaceae), has a wide geographic distribution and has been used for the treatment of fever, cold, inflammation, and other infectious diseases. In markets, sellers and buyers commonly inadvertently confuse with related species. In addition, most Chinese medicinal herbs are subjected to traditional processing procedures, such as steaming and boiling, before they are sold at dispensaries; therefore, it is very difficult to identify Andrographis Herba when it is processed into Chinese medicines. The identification of species and processed medicinal materials is a growing issue in the marketplace. However, conventional methods of identification have limitations, while DNA barcoding has received considerable attention as a new potential means to identify species and processed medicinal materials. In this study, 17 standard reference materials of A. paniculata, 2 standard decoctions, 27 commercial products and two adulterants were collected. Based on the ITS2 sequence, it could successfully identify A. paniculata and adulterants. Moreover, a nucleotide signature consisting of 71 bp was designed, this sequence is highly conserved and specific within A. paniculata while divergent among other species. Then, we used these new primers to amplify the nucleotide signature region from processed materials. In conclusion, the DNA barcoding method developed in the present study for authenticating A. paniculata is rapid and cost-effective. It can be used in the future to guarantee the quality of Andrographis Herba of each regulatory link for clinical use.