Mechanistic Study of Macranthoside B Effects on Apoptotic Cell Death in Human Cervical Adenocarcinoma Cells.

Macranthoside B (MB) is a triterpenoid saponin extracted from Lonicera macranthoides, a traditional Chinese medicine. In the current study, we investigated the anticancer potential of MB in various cancer cells and elucidated its underlying mechanisms. MB exposure inhibited cell proliferation, induced mitochondrial membrane potential (MMP) loss, increased sub-G1 accumulation, and resulted in cleavage of caspase-3 and PARP, which are reflective of apoptosis. In HeLa cells, MB induced down-regulation of SOD2 and GPx1, phosphorylation of Akt and PDK1, and thus promoted ROS-mediated apoptosis. This was further supported by the protection of sub-G1 accumulation, MMP loss, cleavage of caspase-3 and PARP in the presence of N-acetylcysteine (NAC). Additionally, MB induced cell death via down-regulation of ubiquitin-like with PHD and ringfinger domains 1 (UHRF1) and Bcl-xL. Taken together, this study provides a new insight into the apoptosis- inducing potential of MB, and its molecular mechanisms are associated with an increase in oxidative stress and inhibition of the PDK1/Akt pathway.

Soy isoflavones affect sterol regulatory element binding proteins (SREBPs) and SREBP-regulated genes in HepG2 cells.

Soy intake reduces cholesterol levels. However, both the identity of the soy component or components that contribute to this reduction and the cellular mechanism producing this reduction are unknown. Soy consists of protein, lipids, fiber, and phytochemicals including isoflavones. We propose that the isoflavone component of soy mediates this effect, at least in part, by affecting cellular sterol homeostasis. We investigated the effects of an isoflavone-containing soy extract and the individual isoflavones on the maturation of the sterol regulatory element binding proteins (SREBP) and the expression of SRE-regulated genes controlling lipid metabolism. We found a corresponding increase in the mature form of SREBP-2 in both soy extract- and isoflavone-treated HepG2 cells, whereas there was no significant change in the levels of SREBP-1. 3-Hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase protein and HMG CoA synthase mRNA levels also increased. When HepG2 cells were transiently transfected with HMG CoA synthase and LDL receptor reporter plasmids there was an increase in expression in response to soy extract or isoflavone treatment from both of these promoters, but this induction was blunted in the presence of sterols (P < 0.05). The mechanism responsible for this effect may be via a statin-like inhibition of HMG CoA reductase enzyme activity or by enhanced SREBP processing via the SREBP cleavage activating protein. We hypothesize that maturation of SREBP and induction of SRE-regulated genes produce an increase in surface LDL receptor expression that increases the clearance of plasma cholesterol, thus decreasing plasma cholesterol levels.

Metal-responsive transcription factor-1 (MTF-1) selects different types of metal response elements at low vs. high zinc concentration.

Metal-responsive transcription factor-1 (MTF-1) is a zinc finger protein with a central role in heavy metal homeostasis/detoxification. MTF-1 binds to DNA sequence motifs known as metal response elements (MREs) with a core consensus TGCRCNC. Since MTF-1 is also involved in other stress responses, we tested whether it is able to recognize different types of DNA sequence motifs. To this end we selected MTF-1-binding oligonucleotides from a collection of random sequences. Since MTF-1 binds to known target sequences at relatively high zinc concentrations, oligonucleotide selection was performed in a mammalian cell nuclear extract both at high and low zinc concentrations. Irrespective of zinc concentration, we find a robust representation of MRE consensus sequences, however with specific features. Selection was most efficient at 100 microM zinc, yielding many oligonucleotides with two MRE motifs in divergent orientation of the sequence GTGTGCATCACTTTGCGCAC (core consensus underlined). Oligonucleotides selected without zinc supplement contain a single high-affinity MRE with an extended flanking sequence of consensus TTTTGCGCACGGCACTAAAT (core consensus underlined). This low-zinc MRE motif can bind MTF-1 and induce transcription in vivo, and is less dependent on zinc than the classical MREd motif from the mouse metallothionein-I promoter. At low zinc, we also found evidence for a negative role of nuclear factor-I (NF-I/CTF-I) in MTF-1-dependent transcription. Finally, a selection in the presence of cadmium yielded no specific binding site for MTF-1, strongly supporting the concept of an indirect activation of MTF-1 by cadmium within a living cell.