Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation.

The extremely tight binding between biotin and avidin or streptavidin makes labeling proteins with biotin a useful tool for many applications. BirA is the Escherichia coli biotin ligase that site-specifically biotinylates a lysine side chain within a 15-amino acid acceptor peptide (also known as Avi-tag). As a complementary approach to in vivo biotinylation of Avi-tag-bearing proteins, we developed a protocol for producing recombinant BirA ligase for in vitro biotinylation. The target protein was expressed as both thioredoxin and MBP fusions, and was released from the corresponding fusion by TEV protease. The liberated ligase was separated from its carrier using HisTrap HP column. We obtained 24.7 and 27.6 mg BirA ligase per liter of culture from thioredoxin and MBP fusion constructs, respectively. The recombinant enzyme was shown to be highly active in catalyzing in vitro biotinylation. The described protocol provides an effective means for making BirA ligase that can be used for biotinylation of different Avi-tag-bearing substrates.

Characterization and chondrocyte differentiation stage-specific expression of KRAB zinc-finger protein gene ZNF470.

As part of a study to identify novel transcriptional regulators of chondrogenesis-related gene expression, we have cloned and characterized cDNA for zinc-finger protein 470 (ZNF470), the human ortholog of which encodes a 717 amino acid residue protein containing 17 Cys(2)His(2) zinc-finger domains, as well as KRAB-A and KRAB-B motifs. The cDNA library used to isolate the initial ZNF470 clone was prepared from human bone marrow-derived mesenchymal progenitor cells at an intermediate stage of chondrogenic differentiation. We have determined the intron-exon structure of the human ZNF470 gene, which has been mapped to a zinc-finger cluster in a known imprinted region of human chromosome 19q13.4. ZNF470 is expressed at high levels in human testis and is expressed at low or undetectible levels in other adult tissues. Human ZNF470 expressed in mammalian cells as an EGFP fusion protein localizes predominantly to the nucleus, consistent with a role in transcriptional regulation. ZNF470, analyzed by quantitative real time PCR, was transiently expressed before the maximal expression of COL2A1 during chondrogenic differentiation in vitro. We have also characterized the bovine ortholog of human ZNF470, which encodes a 508 amino acid residue protein having 10 zinc-finger domains. A bovine ZNF470 cDNA clone was used to examine expression of ZNF470 in bovine articular chondrocytes treated with retinoic acid to stimulate dedifferentiation. Bovine ZNF470 expression was undetectable in freshly isolated bovine articular chondrocytes, but was dramatically upregulated in dedifferentiated retinoic acid-treated chondrocytes. These results, in two model systems, suggest a possible role for ZNF470 in the regulation of chondrogenesis-specific gene expression.

Isolation of the carbon catabolite repressor (CREA) gene from the plant-pathogenic fungus Cochliobolus carbonum.

The CREA gene has been implicated in glucose repression in several fungi. The product of this gene, CreA, binds to the promoter region of several enzymes and down-regulates gene expression. An ortholog of CREA was isolated and characterized from the maize pathogenic fungus, Cochliobolus carbonum. The deduced amino acid sequence of the C. carbonum CREA gene is very similar to the CreA proteins of Aspergillus niger, Gibberella fujikuroi, Sclerotinia sclerotiorum and Trichoderma reesei, as well as the Mig1 protein of Saccharomyces cerevisiae. And like the other fungal proteins, C. carbonum CreA has two zinc finger regions and a nuclear localization signal. Putative CreA binding sequences were also identified in the 5' region of three C. carbonum cell wall degrading enzyme genes suggesting that the protein may play a role in the regulatory process that controls these enzymes expression.

Regulation of the human Fc epsilon RI alpha-chain distal promoter.

The alpha-chain of the high affinity receptor for IgE (Fc epsilon RI) is essential for cell surface expression of Fc epsilon RI and binding of the IgE Ab. The human alpha-chain gene possesses two promoters: the proximal promoter, which is highly conserved with that of rodent; and the distal promoter, the structure and role of which are largely unknown. Transcriptional regulation of the alpha-chain distal promoter was investigated in this study. Transient reporter assay revealed critical region for transcription activity located within -27/-17. EMSA identified Elf-1, YY1, and PU.1 as transcription factors binding to this region. In contrast to the proximal promoter, which was trans-activated by YY1 and PU.1, these transcription factors exhibited repressive function on this promoter. Addition of IL-4 caused a marked increase in transcription from the distal promoter and subsequently increased the intracellular production of the alpha-chain. These results indicate that IL-4-dependent up-regulation of the human alpha-chain was due to enhancement of distal promoter activity and suggests that the two promoters have different regulatory mechanisms for alpha-chain expression.

Roles of metal ions and hydrogen peroxide in modulating the interaction of the Bacillus subtilis PerR peroxide regulon repressor with operator DNA.

The inducible response to H(2)O(2) stress in Bacillus subtilis is under the control of PerR, one of three Fur homologues in this organism. PerR was purified in both an inactive, metal-dependent form and an active, metal-containing form as determined using DNA-binding assays. Active PerR contains both zinc and iron and is designated PerR:Zn,Fe. Added manganous ion competes for binding to the iron site and can restore DNA-binding activity to the metal-dependent form of PerR, presumably generating PerR:Zn,Mn. The DNA-binding activity of PerR:Zn,Fe is eliminated by exposure to H(2)O(2) whereas PerR:Zn,Mn is comparatively resistant. DNA-binding activity can be restored by a thiol-reducing agent, suggesting that redox-active cysteines are involved in peroxide sensing. Experiments using reporter fusions demonstrate that elevated levels of manganese repress PerR regulon genes and prevent their full induction by H(2)O(2). In contrast, in cells grown with iron supplementation, a PerR-repressed gene is completely derepressed by H(2)O(2). These results are consistent with the idea that the intracellular form of the PerR metalloprotein, and therefore its hydrogen peroxide sensitivity, can be altered by growth conditions.

The methyl-CpG binding transcriptional repressor MeCP2 stably associates with nucleosomal DNA.

We have investigated the interactions of the methyl-CpG binding transcriptional repressor MeCP2 with nucleosomal DNA. We find that MeCP2 forms discrete complexes with nucleosomal DNA associating with methyl-CpGs exposed in the major groove via the methyl-CpG-binding domain (MBD). In addition to the MBD, the carboxyl-terminal segment of MeCP2 facilitates binding both to naked DNA and to the nucleosome core. These observations provide a molecular mechanism by which MeCP2 can gain access to chromatin in order to target corepressor complexes that further modify chromatin structure.

Isolation and characterization of a novel zinc-finger protein with transcription repressor activity.

To identify genes that can repress the expression of growth regulatory molecules, a human fetal cDNA library was screened with a degenerate oligonucleotide that corresponds to the conserved stretch of 6 amino acids connecting successive zinc-finger regions in the Wilms' tumor suppressor/Egr-1 family of DNA-binding proteins. One clone, designated zinc-finger protein 174 (ZNF174), corresponds to a putative transcription factor with three zinc fingers and a novel finger-associated domain, designated the SCAN box. The three Cys2-His2-type zinc fingers are positioned at the carboxyl terminus, while the 65-amino acid finger-associated SCAN box is located near the amino terminus. Chromosomal localization using somatic cell hybrid analysis and fluorescent in situ hybridization mapped the gene for ZNF174 to human chromosome 16p13.3. The 2.5-kilobase transcript from this gene is expressed in a variety of human organs, but most strongly in adult testis and ovary. Fusion of the upstream regulatory region of ZNF174 to the DNA-binding domain of GAL4 revealed that the gene could confer a repression function on the heterologous DNA-binding domain. ZNF174 selectively repressed reporter activity driven by the platelet-derived growth factor-B chain and transforming growth factor-beta 1 promoters and bound to DNA in a specific manner. This member of the C2H2-type zinc-finger family is a novel transcriptional repressor.

Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi.

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2-keto-3-deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi kdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62 kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.