Research progress on the treatment of diabetic nephropathy with leech and its active ingredients.

Diabetic nephropathy (DN) is a major microvascular complication of diabetes and a common cause of chronic kidney disease. There is currently a lack of effective treatments for DN, and the prognosis for patients remains poor. Hirudin, one of the primary active components derived from leeches, demonstrates anti-coagulant, anti-fibrotic, anti-thrombotic, and anti-inflammatory properties, exhibiting significant protective effects on the kidneys. In recent years, there has been a surge of interest in studying the potential benefits of hirudin, especially in its role in the management of DN. This article delves into the mechanisms by which hirudin contributes to the treatment of DN and its clinical efficacy.

18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.

A Chromosome-Level Genome Assembly of the Non-Hematophagous Leech Whitmania pigra (Whitman 1884): Identification and Expression Analysis of Antithrombotic Genes.

Despite being a non-hematophagous leech, Whitmania pigra is widely used in traditional Chinese medicine for the treatment of antithrombotic diseases. In this study, we provide a high quality genome of W. pigra and based on which, we performed a systematic identification of the potential antithrombotic genes and their corresponding proteins. We identified twenty antithrombotic gene families including thirteen coagulation inhibitors, three platelet aggregation inhibitors, three fibrinolysis enhancers, and one tissue penetration enhancer. Unexpectedly, a total of 79 antithrombotic genes were identified, more than a typical blood-feeding Hirudinaria manillensis, which had only 72 antithrombotic genes. In addition, combining with the RNA-seq data of W. pigra and H. manillensis, we calculated the expression levels of antithrombotic genes of the two species. Five and four gene families had significantly higher and lower expression levels in W. pigra than in H. manillensis, respectively. These results showed that the number and expression level of antithrombotic genes of a non-hematophagous leech are not always less than those of a hematophagous leech. Our study provides the most comprehensive collection of antithrombotic biomacromolecules from a non-hematophagous leech to date and will significantly enhance the investigation and utilization of leech derivatives in thrombosis therapy research and pharmaceutical applications.

Transcriptomic profiling and the first spatial expression analysis of candidate genes in the salivary gland of the East Asian medicinal leech, Hirudo nipponia.

Hirudo nipponia, a blood-sucking leech native to East Asia, possesses a rich repertoire of active ingredients in its saliva, showcasing significant medical potential due to its anticoagulant, anti-inflammatory, and antibacterial effects against human diseases. Despite previous studies on the transcriptomic and proteomic characteristics of leech saliva, which have identified medicinal compounds, our knowledge of tissue-specific transcriptomes and their spatial expression patterns remains incomplete. In this study, we conducted an extensive transcriptomic profiling of the salivary gland tissue in H. nipponia based on de novo assemblies of tissue-specific transcriptomes from the salivary gland, teeth, and general head region. Through gene ontology (GO) analysis and hierarchical clustering, we discovered a novel set of anti-coagulant factors-i.e., Hni-Antistasin, Hni-Ghilanten, Hni-Bdellin, Hni-Hirudin-as well as a previously unrecognized immune-related gene, Hni-GLIPR1 and uncharacterized salivary gland specific transcripts. By employing in situ hybridization, we provided the first visualization of gene expression sites within the salivary gland of H. nipponia. Our findings expand on our understanding of transcripts specifically expressed in the salivary gland of blood-sucking leeches, offering valuable resources for the exploration of previously unidentified substances with medicinal applications.

[Cloning and expression analysis of wpHSP90 gene from Whitmania pigra at different temperatures].

HSP90 is a widely distributed molecular chaperone that participates in a variety of cellular processes and plays an important role in the meiosis of germ cells. However, its role in the gonadal development of hermaphroditic Whitmania pigra is not yet clear. To explore the effect of HSP90 on the germ cell development of Wh. Pigra, this study cloned the wpHSP90 gene, performed bioinformatics analysis, and measured its expression levels. The results showed that the cloned wpHSP90 was 2 592 bp in length, with an open reading frame(ORF) of 2 373 bp, encoding 790 amino acids. Prediction analysis revealed 85 phosphorylation modification sites on serine, threonine, and tyrosine residues of the wpHSP90 protein. Structural domain prediction and multiple sequence alignment results showed that wpHSP90 contained two conserved domains of HSP90 and exhibited the highest homology with Helobdella robusta, with a sequence similarity of 80.72%. RT-qPCR results showed that the relative expression level of wpHSP90 in the gonads of 5-month-old Wh. pigra was positively correlated with temperature within the range of 12 ℃ to 28 ℃. The expression level in the female gonads was significantly higher than in the male gonads and correlated with the trend of germ cell development in the ovaries and testes. In conclusion, wpHSP90 may be involved in regulating the development of germ cells, particularly oocytes, in Wh. pigra. This study provides a reference for further research on the gonadal development mechanism in Wh. pigra.

Possible detection of physiological state disorders with the help of medicinal leeches Hirudo verbana Carena, 1820.

In the experiment, 160 medicinal leeches of the species Hirudo verbana Carena, 1820 were studied. Medicinal leeches were fed on the blood of animals and people (conditionally healthy and diseased). Four leeches were taken from each animal/person. The animals were studied for 3 weeks. Mortality was mostly observed in the first days after feeding on the blood of the host. We noted mortality, the appearance of constrictions on the leeches' body, the intensity of the host blood spitting from their body. The host's blood was taken from their stomach on the first day after feeding. Hematological and immunological indicators of blood were determined in the taken blood of the host. As a result of the study of the blood of the sick, significant changes were found, compared to conditionally healthy ones. It was manifested by an increase in erythrocytes and leukocytes. The leukocyte formula looked like in most pathological conditions of the inflammatory process. The obtained indicators of the experiment make it possible to quickly assess the presence of physiological disorders in the early stages of the disease.

The effect of blood human, domestic and small laboratory animals on the viability and behavior of the medicinal leech.

Medicinal leeches are used for therapeutic purposes in the prevention and treatment of many diseases. Because they have a large amount of biologically active substances in their body. Each of these substances has many therapeutic effects. In natural conditions, they are mostly are fed of blood by wild animals. In laboratory conditions, the blood of domestic animals is mostly used.  Currently, medicinal leeches are mostly bred in laboratory conditions. Because there are very few of them in nature. They are listed in the Red Book. Scientists of various specialties are looking  for optimal conditions for their life and breeding. That became our research goal. To identify the influence of blood human, domestic animals (pigs and chickens) and small laboratory animals (rats) on the viability and behavior of medicinal leeches Hirudo verbana Carena, 1820 and Hirudo orientalis Utevsky & Trontelj, 2005. According to this, 8 groups of sexually mature animals were formed: 1 and 2 - human blood; 3, 4 - blood of a domestic pig; 5, 6 - blood of domestic chickens; 7, 8 - blood of a non-linear laboratory rat. As a result of the study, it was found that the blood of pigs and chickens is the most suitable for feeding the medical leech for normal life and behavior. Mortality of leeches was observed when feeding on rat and human blood. It should be noted that at the beginning of feeding animals with blood human. The percentage of cannibalism in animals increased.

'Pearls' of the nineteenth-century: from therapeutic actors to global commodities medicinal leeches in the Ottoman Empire.

Nineteenth-century physicians increasingly favoured leeching - the placing of a live leech onto a patient's skin to stimulate or limit blood flow - as a cure for numerous ailments. As conviction in their therapeutic properties spread, leech therapy dominated European medicine; France imported over fifty million leeches in one year. Demand soon outpaced supply, spawning a lucrative global trade. Over-collection and farming eventually destroyed leech habitats, wreaked environmental havoc and forced European merchants to seek new supply sources. Vast colonies of leeches were found to inhabit the immense wetlands of the Ottoman Empire, which soon became a major exporter of medicinal leeches. Following the Treaty of Balta Liman (1838), the Ottoman state moved to exert control over the lucrative trade, imposing a tax on leech gathering and contracting with tax-farmers (mültezim) to collect the taxes. British diplomats, merchants and other stakeholders protested the imposition of the tax, as had previously happened with the commodification of wildlife; their pursuit of profit led collectors and farmers to over-gather leeches, with catastrophic consequences. By the end of the century, so great had their worth climbed that the leech population faced extinction. This paper situates medicinal leeches as therapeutic actors of history and adopts an interscale approach in formulating the human-leech interaction. It offers a substantive contribution to the history of medicine, in revealing the centrality of leeches to the rise of modern medicine and global trade, but also by making visible their role in shaping imperial diplomacy and worldwide economic markets.

The three-dimensional conformation and activity of mitochondria in syncytial male germ line-cysts of medicinal leeches.

We studied the spatial conformation and activity of mitochondria in the developing syncytial male germline cysts during spermatogenesis of the medicinal leeches using light, fluorescent, transmission electron microscopy, and serial block-face scanning electron microscopy. In cysts with spermatogonia and spermatocytes, mitochondria form networks and are in a dynamic hyperfusion state, while in cysts with spermatids, a single huge mitochondrion is observed. As spermiogenesis progresses, this huge mitochondrion is finally located in the future midpiece. The highest activity, in terms of membrane potential, of the mitochondria in H. medicinalis germline cysts was observed in cysts with spermatocytes; the lowest was in cysts with late elongated spermatids.

Dysbiosis of intestinal homeostasis contribute to Whitmania pigra edema disease.

Whitmania pigra is widely used in traditional Chinese medicine. However, W. pigra is being threatened by an edema disease with unknown causes (WPE). In this study, a comprehensive exploration of virome, microbiome, and metabolome aberrations in the intestine of W. pigra was performed to address the aetiology of WPE. Virome analysis indicated that eukaryotic viruses did not contribute to WPE, whereas an expansion of Caudovirales was observed in WPE. Compared to the control, the microbial richness and diversity in diseased W. pigra decreased remarkably. Nine genera, including Aeromonas, Anaerotruncus, Vibrio, Proteocatella, Acinetobacter, and Brachyspira were overrepresented in WPE, whereas eleven genera, including Bifidobacterium, Phascolarctobacterium, Lactobacillus, Bacillus and AF12, were enriched in healthy individuals. Furthermore, certain metabolites, especially amino acids, short-chain fatty acids, and bile acids, were found to be linked to intestinal microbiota alterations in WPE. An integration of the microbiome and metabolome in WPE found that dysbiosis of the gut microbiota or metabolites caused WPE. Notably, W. pigra accepted intestinal microbiota transplantation from WPE donors developed WPE clinical signs eventually, and the dysbiotic intestinal microbiota can be recharacterized in this recipient W. pigra. Strikingly, pathological features of metanephridium and uraemic toxin enrichment in the gut indicated a putative interconnection between the gut and metanephridium in WPE, which represents the prototype of the gut-kidney axis in mammals. These finding exemplify the conservation of "microecological Koch's postulates" from annelids to insects and other vertebrates, which provides a direction of prevention and treatment for WPE and opens a new insight into the pathogenesis of aquatic animal diseases from an ecological perspective.

Characterization of the natural peptidome of four leeches by integrated proteogenomics and pseudotargeted peptidomics.

Animal-derived drugs are an indispensable part of folk medicine worldwide. However, their chemical constituents are poorly approached, which leads to the low level of the quality standard system of animal-derived drugs and further causes a chaotic market. Natural peptides are ubiquitous throughout the organism, especially in animal-derived drugs. Thus, in this study, we used multi-source leeches, including Hirudo nipponica (HN), Whitmania pigra (WP), Whitmania acranulata (WA), and Poecilobdella manillensis (PM), as a model. A strategy integrating proteogenomics and novel pseudotargeted peptidomics was developed to characterize the natural peptide phenotype and screen for signature peptides of four leech species. First, natural peptides were sequenced against an in-house annotated protein database of closely related species constructed from RNA-seq data from the Sequence Read Archive (SRA) website, which is an open-sourced public archive resource. Second, a novel pseudotargeted peptidomics integrating peptide ion pair extraction and retention time transfer was established to achieve high coverage and quantitative accuracy of the natural peptides and to screen for signature peptides for species authentication. In all, 2323 natural peptides were identified from four leech species whose databases were poorly annotated. The strategy was shown to significantly improve peptide identification. In addition, 36 of 167 differential peptides screened by pseudotargeted proteomics were identified, and about one-third of them came from the leucine-rich repeat domain (LRR) proteins, which are widely distributed in organisms. Furthermore, six signature peptides were screened with good specificity and stability, and four of them were validated by synthetic standards. Finally, a dynamic multiple reaction monitoring (dMRM) method based on these signature peptides was established and revealed that one-half of the commercial samples and all of the Tongxinluo capsules were derived from WP. All in all, the strategy developed in this study was effective for natural peptide characterization and signature peptide screening, which could also be applied to other animal-derived drugs, especially for modelless species that are less studied in protein database annotation.

Structural insights into thrombolytic activity of destabilase from medicinal leech.

Destabilase from the medical leech Hirudo medicinalis belongs to the family of i-type lysozymes. It has two different enzymatic activities: microbial cell walls destruction (muramidase activity), and dissolution of the stabilized fibrin (isopeptidase activity). Both activities are known to be inhibited by sodium chloride at near physiological concentrations, but the structural basis remains unknown. Here we present two crystal structures of destabilase, including a 1.1 Å-resolution structure in complex with sodium ion. Our structures reveal the location of sodium ion between Glu34/Asp46 residues, which were previously recognized as a glycosidase active site. While sodium coordination with these amino acids may explain inhibition of the muramidase activity, its influence on previously suggested Ser49/Lys58 isopeptidase activity dyad is unclear. We revise the Ser49/Lys58 hypothesis and compare sequences of i-type lysozymes with confirmed destabilase activity. We suggest that the general base for the isopeptidase activity is His112 rather than Lys58. pKa calculations of these amino acids, assessed through the 1 µs molecular dynamics simulation, confirm the hypothesis. Our findings highlight the ambiguity of destabilase catalytic residues identification and build foundations for further research of structure-activity relationship of isopeptidase activity as well as structure-based protein design for potential anticoagulant drug development.

[Network Meta-analysis of single Hirudo prescriptions in treatment of ischemic cerebrovascular disease].

This study intended to evaluate the efficacy and safety of single Hirudo prescriptions in the treatment of ischemic cerebrovascular disease(ICVD) by frequency network Meta-analysis and traditional Meta-analysis. CNKI, Wanfang, VIP, SinoMed, PubMed, EMbase, and Cochrane Library databases were searched to collect the randomized controlled trial(RCT) of single Hirudo prescriptions for ICVD from the inception of the databases to May 2022. The quality of the included literature was evaluated by Cochrane risk of bias tool. Finally, 54 RCTs and 3 single Hirudo prescriptions were included. Statistical analysis was conducted by RevMan 5.3 and Stata SE 15. Network Meta-analysis showed that in terms of the clinical effective rate, the surface under the cumulative ranking curve(SUCRA) of intervention measures was as follows: Huoxue Tongmai Capsules+conventional treatment>Maixuekang Capsules+conventional treatment>Naoxuekang Capsules+conventional treatment>conventional treatment. Traditional Meta-analysis revealed that in terms of the safety of ICVD treatment, Maixuekang Capsules+conventional treatment had higher safety than conventional treatment alone. According to the network Meta-analysis and traditional Meta-analysis, it was found that conventional treatment combined with single Hirudo prescriptions improved the clinical efficacy of ICVD patients, and compared with that of conventional treatment alone, the incidence of adverse reactions of combined treatment was low and the safety was high. However, the methodological quality of the articles included in this study was generally low and there were large differences in the number of articles on the three combined medication. Therefore, the conclusion of this study needed to be confirmed by subsequent RCT.

Molecular cloning and functional analysis of HnSaratin from Hirudo nipponia.

In order to finish a bloodmeal successfully, hematophagous organisms often stored a variety of anticoagulant proteins in their salivary glands, such as proteins that inhibit platelet aggregation. When they ingest a bloodmeal, these proteins are injected into the host to prevent the blood from clotting. As one of the origins of leeches used in traditional Chinese medicine, H. nipponia was proved to be clinically effective in treatment of cardiovascular and cerebrovascular diseases. This study cloned the sequence of HnSaratin cDNA derived from salivary glands of H. nipponia. The sequence contains an open reading frame of 387 bp, encoding a protein of 128 amino acids containing a signal peptide of 21 amino acids. After removal of the signal peptide, the molecular mass of mature HnSaratin was 12.37 kDa, with a theoretical isoelectric point (pI) of 3.89. The N-terminal of mature HnSaratin was folded into a globular structure, in which 3 disulfide bonds, a ßßαßßß topology and 2 Glu residues that binds collagenous Lys2 were located, and the C-terminal formed a flexible region. The fusion HnSaratin protein was obtained by a prokaryotic expression system. The protein showed anti-platelet aggregation activity, and was observed to prevent blood clotting in rats. The significant high expression of HnSaratin mRNA in salivary glands was induced by bloodmeal ingestion of H. nipponia. Briefly, our work provides theoretical basis for further development and utilization of H. nipponia.

Keratitis following leech therapy for periocular eczematous dermatitis: a case report.

BACKGROUND: The medicinal leech therapy (MLT) is a kind of complementary treatment method used for various diseases. The leeches (Hirudo medicinalis) have been used for more than 2500 years by surgeons. The substances presenting in the saliva of leeches have anti-inflammatory, anticoagulant, platelet inhibitory, thrombin regulatory, analgesic, extracellular matrix degradative and antimicrobial effects. The method is cheap, easy to apply, effective and its mechanisms of action have been clarified for specific diseases. Infection particularly Aeromonas infection is the most common complication of MLT. CASE PRESENTATION: In this case report, a keratitis case developing after leech therapy applied for the periocular and facial eczematous dermatitis lesions will be presented. The patient referred to our hospital with decreased vision, ocular pain, stinging, redness and lacrimation complaints. A large corneal epithelial defect with irregular margins, dying by fluorescein, involving more than inferior half of cornea and conjunctival hyperemia were seen in the right eye. No agent was determined in microbiological investigation, as the patient had used topical moxifloxacin eye drop which was commenced in another clinic before applying to us. The patient was treated with fortified vancomycin and ceftazidime, before using besifloxacin with the diagnosis of bacterial keratitis. Three weeks later epithelial defect improved completely leaving an opacity and neovascularization. CONCLUSIONS: MLT should be performed by certified physicians with sterile medicinal leeches and precautious antibiotics should be used before MLT for prevention against potential infections.

Improvement of patient care through hirudotherapy and the management of leeches from their reception to their disposal in France.

OBJECTIVE: Medicinal leech therapy - known as hirudotherapy (HT) - is an empirical medical technique that has become popular again in reconstructive surgery. However, at each step of leech management there are risks for blood contamination of the caregivers and severe infections for patients. This reduces the success of the treatment. The aim of this study was to improve the management of leeches from ordering to disposal to improve patient care. METHODS: First, a review of the literature was performed. Second, we conducted a retrospective study of patients' antibiotic prophylaxis from January 2018 to December 2019. The data we collected were patient characteristics, the specific care unit at the hospital, indication, contra-indication, posology, duration of HT, number of leeches delivered, antibiotic prophylaxis prescribed and microbial organism, if identified. Third, an interdisciplinary meeting was organised to review the entire leech circuit: ordering, maintenance, prescription, dispensing, application and disposal. RESULTS: At the end of the literature review, six articles based on practices implemented in France were selected for inclusion. These articles discussed antibiotic prophylaxis, iron supplementation, and leech storage, application and disposal. On the retrospective study performed, antibiotic prophylaxis for HT was performed for 60% (30/50) of patients, 77% (23/30) of the prescriptions followed the recommendations for antibiotic prophylaxis, and 20 patients did not receive antibiotic prophylaxis. The interdisciplinary meeting made it possible to define a collegially validated protocol, containing a computerised antibiotic prophylaxis prescription, including per os ciprofloxacin antibiotic prophylaxis, intravenous iron supplementation and biological monitoring. A leech application protocol was created, and the method of leech disposal was revised. CONCLUSION: Despite the absence of clear guidelines and heterogeneous practices, this study reveals the importance of a standard procedure including leech management practices before use, antibiotic prophylaxis and application and disposal guides. The interdisciplinary protocol allows improved patient care management and makes leech management safer for caregivers.

Network Meta-analysis of single Hirudo prescriptions in treatment of ischemic cerebrovascular disease / 中国中药杂志

This study intended to evaluate the efficacy and safety of single Hirudo prescriptions in the treatment of ischemic cerebrovascular disease(ICVD) by frequency network Meta-analysis and traditional Meta-analysis. CNKI, Wanfang, VIP, SinoMed, PubMed, EMbase, and Cochrane Library databases were searched to collect the randomized controlled trial(RCT) of single Hirudo prescriptions for ICVD from the inception of the databases to May 2022. The quality of the included literature was evaluated by Cochrane risk of bias tool. Finally, 54 RCTs and 3 single Hirudo prescriptions were included. Statistical analysis was conducted by RevMan 5.3 and Stata SE 15. Network Meta-analysis showed that in terms of the clinical effective rate, the surface under the cumulative ranking curve(SUCRA) of intervention measures was as follows: Huoxue Tongmai Capsules+conventional treatment>Maixuekang Capsules+conventional treatment>Naoxuekang Capsules+conventional treatment>conventional treatment. Traditional Meta-analysis revealed that in terms of the safety of ICVD treatment, Maixuekang Capsules+conventional treatment had higher safety than conventional treatment alone. According to the network Meta-analysis and traditional Meta-analysis, it was found that conventional treatment combined with single Hirudo prescriptions improved the clinical efficacy of ICVD patients, and compared with that of conventional treatment alone, the incidence of adverse reactions of combined treatment was low and the safety was high. However, the methodological quality of the articles included in this study was generally low and there were large differences in the number of articles on the three combined medication. Therefore, the conclusion of this study needed to be confirmed by subsequent RCT.

Evolution of deep vein thrombosis treatment from leeches to mechanical thrombectomy.

Deep vein thrombosis (DVT) is one of the most common diseases in developed countries with significant socioeconomic consequences. The severity of DVT lies in the potential for life-threatening pulmonary embolism and the development of chronic venous insufficiency, referred to as post-thrombotic syndrome. Virchow contributed to the understanding of the pathophysiological events that lead to thrombosis by describing three basic risk mechanisms. The first therapeutic attempts in the 17th century included venepuncture and the application of leeches. The first anticoagulant drug was heparin, which entered clinical practice after 1935. Subsequent commercialization of oral vitamin K antagonists (warfarin) and the advent of low molecular weight heparin along with compression therapy allowed the expansion of outpatient treatment of DVT. Recently, new oral anticoagulants have been introduced, leading to improved safety due to lower risk of bleeding complications and simplification of the treatment process. The next step in the development of therapeutic options are invasive methods of early thrombus removal, which significantly shorten the process and aim to reduce the occurrence of late complications. These methods include local catheter-directed thrombolysis using tissue plasminogen activator, mechanical thrombectomy and their combination called pharmaco-mechanical thrombectomy. The latter is currently used in patients with acute ilio-femoral DVT.

[Research progress on processing history evolution, chemical constituents, and pharmacological effects of Hirudo].

As a traditional animal drug, Hirudo is slightly toxic and has the effects of breaking blood stasis, dredging meridians, expelling stasis, and resolving mass. It has a long history of processing, and the early boiling records can be traced back to the Han Dynasty. More than ten processing methods such as frying, roasting, and lime processing appeared later. After processing, Hirudo is deodorized and modified in taste and becomes crispy, which is conducive to crushing and clinical application. At present, the reported components in Hirudo mainly include protein polypeptides, pteridines, and lipids, which have anti-coagulant, anti-thrombotic, anti-atherosclerotic, anti-tumor, and other pharmacological effects. This study reviewed the processing history evolution, chemical consti-tuents, and pharmacological effects of Hirudo to provide a reference for the related research on Hirudo.