Thymine-Modified Silicones: A Bioinspired Approach to Cross-Linked, Recyclable Silicone Polymers.

In DNA, thymine typically forms hydrogen bonds with adenine to hold two complementary strands together and to preserve the genetic code. While thymine is typically absent in RNA, a thymine-thymine hydrogen bonding structure is reminiscent of the wobble region in tRNA recognition, where noncanonical base pairing can occur. This noncanonical base pairing can be applied to synthetic polymer systems, where thymine is free to hydrogen bond with itself. In this work, the natural hydrogen bonding capacity of thymine was used to produce silicone polymer systems designed to be cross-linked by hydrogen bonds. Backbone and end-group-modified silicones were synthesized with differing concentrations of thymine, which facilitated the cross-linking of the polymeric strands. Removing the hydrogen on N3─which is typically involved in hydrogen bonding─resulted in systems with similar viscosities to the starting material and that were devoid of any apparent cross-links. Differential scanning calorimetry (DSC) studies of the thymine-modified polymers displayed thermal absorptions and releases, indicative of bond breaking and reformation, around 100 and 60 °C, respectively. The cycle of bond breaking and formation could be repeated without any noticeable degradation of the chemical structure of the polymers. These polymeric materials could be readily recycled and remolded by heating them at 110 °C for 5 min, followed by cooling to room temperature, confirming their thermoplastic nature.

N/O→B dative bonds supplemented by N-HN/HC hydrogen bonds make BN-cages an attractive candidate for DNA-nucleobase adsorption - an MP2 prediction.

The response of B12N12-nanocages towards DNA-nucleobases (adenine, guanine, cytosine, and thymine) is investigated using MP2 and DFT (M06-2X) levels of theory with the 6-311+G** basis set. Multiple BN-cage-nucleobase structures for each nucleobase emerged depending on the number of Lewis base centers of nucleobases. The main source of stability of these complexes is the N/O→B dative bond, where the N or O atom of nucleobases donates the lone-pair electron to one of the boron atoms of the nanocage. Nitrogen atoms of the BN-cage, adjacent to the B-site forming dative bond, act as a proton acceptor to form multiple (N-HN and N-HC) hydrogen bonds, where proton-donors NH and CH are part of nucleobases. MP2/6-311+G** adsorption energies are -43.1, -43.4 and -45.3 kcal mol-1 (B12N12-adenine), -37.1, -41.9 and -43.3 kcal mol-1 (B12N12-guanine), -41.3 and -43.4 (B12N12-cytosine), and -29.3 and -31.3 (B12N12-thymine). Similar adsorption energies were recorded for larger BN-fullerenes-nucleobases, namely B16N16 and B24N24. Changes in adsorption energies and structures of these nano-bio-hybrid materials in aqueous media are also discussed. Computationally cost-effective MP2 single point calculations at the M06-2X optimized geometries were found to be reliable in predicting adsorption energies. The effect of the BN-network and H-bonds on the adsorption process is assessed by comparing the results with simple BH3-nucleobase models. BSSE correction to the adsorption energy is not recommended.

Selenium-atom-modified thymidine enhances the specificity and sensitivity of DNA polymerization and detection.

Nucleobase mismatches can jeopardize DNA polymerization specificity, causing mutations and errors in DNA replication and detection. Herein we report the first synthesis of novel 2-Se-thymidine triphosphate (SeTTP), describe the single-selenium atom-specific modification strategy (SAM) against T/G mismatches, and demonstrate SAM-assisted polymerization and detection with much higher specificity and sensitivity. SAM can effectively suppress the formation of non-specific products in DNA polymerization and detection. Thus, SAM enhances the specificity of DNA synthesis by approximately 10 000 fold, and in turn, it allows the detection of clinical COVID-19 viral RNA in low copy numbers (single-digit copies), while the conventional RT-qPCR does not.

Functional Systems Derived from Nucleobase Self-assembly.

Dynamic and reversible non-covalent interactions endow synthetic systems and materials with smart adaptive functions that allow them to response to diverse stimuli, interact with external agents, or repair structural defects. Inspired by the outstanding performance and selectivity of DNA in living systems, scientists are increasingly employing Watson-Crick nucleobase pairing to control the structure and properties of self-assembled materials. Two sets of complementary purine-pyrimidine pairs (guanine:cytosine and adenine:thymine(uracil)) are available that provide selective and directional H-bonding interactions, present multiple metal-coordination sites, and exhibit rich redox chemistry. In this review, we highlight several recent examples that profit from these features and employ nucleobase interactions in functional systems and materials, covering the fields of energy/electron transfer, charge transport, adaptive nanoparticles, porous materials, macromolecule self-assembly, or polymeric materials with adhesive or self-healing ability.

Modulating Morphologies and Surface Properties of Nanoparticles from Cellulose-Grafted Bottlebrush Copolymers Using Complementary Hydrogen-Bonding between Nucleobases.

Herein we report the synthesis of a cellulose-grafted bottlebrush copolymer with nucleobases as hydrophobic moieties. Well-defined spherical micelles from this bottlebrush copolymer were fabricated via a solvent switch method. A morphological transition from spheres to worms was only observed to occur when a diblock copolymer with a complementary nucleobase functionality was introduced. Hydrophobic interaction is not capable of triggering the morphological transformation, and the diblock copolymer with the heterogeneous acrylamide nucleobase monomer can induce the morphological transition at higher A:T molar ratios, which might be caused by the weak H-bonding interaction. This supramolecular "grafting to" method enables the preparation of a series of nanoparticles with similar shapes and dimensions but distinct surface properties such as zeta potentials. Moreover, reversible morphological transitions between worm-like micelles and spheres can be achieved using a reversible collapsing and swelling of a thermoresponsive polymer. This work highlights that a supramolecular "grafting to" approach between complementary nucleobases can be utilized to tune morphologies and surface properties of nanoparticles.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Microfluidic-Based Genosensor To Detect Human Papillomavirus (HPV16) for Head and Neck Cancer.

High-risk human papillomavirus (HPV) infection, mainly with HPV16 type, has been increasingly considered as an important etiologic factor in head and neck cancers. Detection of HPV16 is therefore crucial for these types of cancer, but clinical tests are not performed routinely in public health systems owing to the high cost and limitations of the existing tests. In this article, we report on a potentially low-cost genosensor capable of detecting low concentrations of HPV16 in buffer samples and distinguishing, with high accuracy, head and neck cancer cell lines according to their HPV16 status. The genosensor consisted of a microfluidic device that had an active layer of a HPV16 capture DNA probe (cpHPV16) deposited onto a layer-by-layer film of chitosan and chondroitin sulfate. Impedance spectroscopy was the principle of detection utilized, leading to a limit of detection of 10.5 pM for complementary ssDNA HPV16 oligos (ssHPV16). The genosensor was also able to distinguish among HPV16+ and HPV16- cell lines, using the multidimensional projection technique interactive document mapping. Hybridization between the ssHPV16 oligos and cpHPV16 probe was confirmed with polarization-modulated infrared reflection-absorption spectroscopy, where PO2 and amide I and amide II bands from adenine and thymine were monitored. The electrical response could be modeled as resulting from an adsorption process represented in a Freundlich model. Because the fabrication procedures of the microfluidic devices and genosensors and the data collection and analysis can be implemented at low cost, the results presented here amount to a demonstration of possible routine screening for HPV infections.

Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA.

Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.

The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing.

A label-free assay for T4 polynucleotide kinase/phosphatase activity and its inhibitors based on poly(thymine)-templated copper nanoparticles.

DNA 3'-phosphatase takes an important role in DNA damage repair, replication and recombination. Here, we present a novel label-free fluorescent assay for T4 polynucleotide kinase/phosphatase (T4 PNKP) activity and its inhibitor screening by using poly(thymine)-templated fluorescent copper nanoparticles (CuNPs) as a fluorescent indicator. In this assay, we designed a simple T-rich hairpin primer with a 3'-phosphoryl end, which can serve as both the substrate for T4 PNKP and DNA template for the formation of fluorescent CuNPs. Once the phosphorylated hairpin primer was hydrolyzed by T4 PNKP, the resulting hairpin primer with a 3'-hydroxyl end was immediately elongated to form a long double-strand product by DNA polymerase, which prohibited the formation of fluorescent CuNPs due to the lack of poly T single-stranded DNA template. This new strategy provides a sensitive, selective, and cost-effective manner for T4 PNKP analysis, which holds a great potential in the study of DNA damage repair mechanisms.

Insight into the Mechanism of the Initial Reaction of an OH Radical with DNA/RNA Nucleobases: A Computational Investigation of Radiation Damage.

Earlier theoretical investigations of the mechanism of radiation damage to DNA/RNA nucleobases have claimed OH radical addition as the dominating pathway based solely on energetics. In this study we supplement calculations of energies with the kinetics of all possible reactions with the OH radical through hydrogen abstraction and OH radical addition onto carbon sites, using DFT at the ωB97X-D/6-311++G(2df,2pd) level with the Eckart tunneling correction. The overall rate constants for the reaction with adenine, guanine, thymine, and uracil are found to be 2.17×10(-12) , 5.64×10(-11) , 2.01×10(-11) , and 5.03×10(-12)  cm(3) molecules(-1) s(-1) , respectively, which agree exceptionally well with experimental values. We conclude that abstraction of the amine group hydrogen atoms competes with addition onto C8 as the most important reaction pathway for the purine nucleobases, while for the pyrimidine nucleobases addition onto C5 and C6 competes with the abstraction of H1 . Thymine shows favourability against abstraction of methyl hydrogens as the dominating pathway based on rate constants. These mechanistic conclusions are partly explained by an analysis of the electrostatic potential together with HOMO and LUMO orbitals of the nucleobases.

N-Branched acyclic nucleoside phosphonates as monomers for the synthesis of modified oligonucleotides.

Protected N-branched nucleoside phosphonates containing adenine and thymine bases were prepared as the monomers for the introduction of aza-acyclic nucleotide units into modified oligonucleotides. The phosphotriester and phosphoramidite methods were used for the incorporation of modified and natural units, respectively. The solid phase synthesis of a series of nonamers containing one central modified unit was successfully performed in both 3'→5' and 5'→3' directions. Hybridization properties of the prepared oligoribonucleotides and oligodeoxyribonucleotides were evaluated. The measurement of thermal characteristics of the complexes of modified nonamers with the complementary strand revealed a considerable destabilizing effect of the introduced units. We also examined the substrate/inhibitory properties of aza-acyclic nucleoside phosphono-diphosphate derivatives (analogues of nucleoside triphosphates) but neither inhibition of human and bacterial DNA polymerases nor polymerase-mediated incorporation of these triphosphate analogues into short DNA was observed.

Kinetics of DNA duplex formation: A-tracts versus AT-tracts.

The hybridisation and melting of DNA strands are critical steps in many biological processes, but still a deeper understanding of the kinetics is lacking. This is evident from the absence of a clear correlation between rate constants for duplex formation and the number of bases in the strand or the sequence. Here we have probed differences between formation times of A-tracts and AT-tracts by studying complementary model strands mainly comprised of adenine (A) and thymine (T) in stopped-flow (SF) experiments. These strands are relevant as DNA replication begins in regions with a large number of AT base pairs. Interpretation of our results is aided by secondary-structure modelling where both the fractions of the different types of structures and the number of paired bases in the lowest-energy ones are determined. The model is based on calculation of free energies using fixed values for enthalpies and entropies associated with base pairing and a stochastic sampling of the possible structures. We find that the strand length affects rates: the activation energy for the formation of short (16-base pairs) A-tracts is larger than that for longer ones (20-base pairs). Activation energies for the formation of AT-tracts are an order of magnitude larger, and larger for shorter strands than for long ones. These higher activation energies are in agreement with the fact that the fraction of unpaired bases in the constituent AT-tract strands is less than in those which comprise the A-tracts. That the pre-structures of the single strands significantly affect rates is also used to rationalise the results obtained for two pairs of complementary 12-mer strands that have the same bases but in a different sequence; we report here similar activation energies as reported earlier and that these are strongly sequence dependent. Finally, we demonstrate that SF can be coupled with the measurement of circular dichroism (CD) in the vacuum ultraviolet (VUV) region, taking advantage of a synchrotron radiation facility, and that CD is useful to probe geometrical structures in the VUV where the absorption by DNA is high. Though this work is preliminary, our initial results suggest that the strands align prior to the formation of base pairs.

Nucleobase-functionalized ABC triblock copolymers: self-assembly of supramolecular architectures.

RAFT polymerization afforded acrylic ABC triblock copolymers with self-complementary nucleobase-functionalized external blocks and a low-Tg soft central block. ABC triblock copolymers self-assembled into well-defined lamellar microphase-separated morphologies for potential applications as thermoplastic elastomers. Complementary hydrogen bonding within the hard phase facilitated self-assembly and enhanced mechanical performance.

Two new thyminenol derivatives from the marine sponge Haliclona sp.

Investigation of the marine sponge Haliclona sp. led to the isolation of two new thyminenol derivatives, named cis-thyminenol (1) and trans-thyminenol (2). The structures of the new isolates were elucidated on the basis of extensive spectroscopic analysis.

Cd hyperfine interactions in DNA bases and DNA of mouse strains infected with Trypanosoma cruzi investigated by perturbed angular correlation spectroscopy and ab initio calculations.

In this work, perturbed angular correlation (PAC) spectroscopy is used to study differences in the nuclear quadrupole interactions of Cd probes in DNA molecules of mice infected with the Y-strain of Trypanosoma cruzi. The possibility of investigating the local genetic alterations in DNA, which occur along generations of mice infected with T. cruzi, using hyperfine interactions obtained from PAC measurements and density functional theory (DFT) calculations in DNA bases is discussed. A comparison of DFT calculations with PAC measurements could determine the type of Cd coordination in the studied molecules. To the best of our knowledge, this is the first attempt to use DFT calculations and PAC measurements to investigate the local environment of Cd ions bound to DNA bases in mice infected with Chagas disease. The obtained results also allowed the detection of local changes occurring in the DNA molecules of different generations of mice infected with T. cruzi, opening the possibility of using this technique as a complementary tool in the characterization of complicated biological systems.

Insight into the interaction between DNA bases and defective graphenes: covalent or non-covalent.

Although some metal clusters and molecules were found to more significantly bind to defective graphenes than to pristine graphenes, exhibiting chemisorptions on defective graphenes, the present investigation shows that the adsorption of DNA bases on mono- and di-vacant defective graphenes does not show much difference from that on pristine graphene, and is still dominantly driven by noncovalent interactions. In the present study the adsorptions of the nucleobases, adenine (A), cytosine (C), guanine, (G), and thymine (T) on pristine and defective graphenes, are fully optimized using a hybrid-meta GGA density functional theory (DFT), M06-2X/6-31G*, and the adsorption energies are then refined with both M06-2X and B97-D/6-311++G**. Graphene is modeled as nano-clusters of C72H24, C71H24, and C70H24 for pristine, mono- and di-vacant defective graphenes, respectively, supplemented by a few larger ones. The result shows that guanine has the maximum adsorption energy in all of the three adsorption systems; and the sequence of the adsorption strength is G>A>T>C on the pristine and di-vacant graphene and G>T>A>C on the mono-vacant graphene. In addition, the binding energies of the DNA bases with the pristine graphene are less than the corresponding ones with di-vacant defective graphene; however, they are greater than those of mono-vacant graphene with guanine and adenine, while it is dramatic that the binding energies of mono-vacant graphene with thymine and cytosine appear larger than those of pristine graphene.

Excited state properties of naphtho-homologated xxDNA bases and effect of methanol solution, deoxyribose, and base pairing.

Design and synthesis of fluorescent nucleobase analogues for studying structures and dynamics of nucleic acids have attracted much attention in recent years. In the present work, a comprehensive theoretical study of electronic transitions of naphtho-homologated base analogues, namely, xxC, xxT, xxA, and xxG, was performed. The nature of the low-lying excited states was discussed, and the results were compared with those of x-bases. Geometrical characteristics of the lowest excited singlet ππ* states were explored using the CIS method. The calculated excitation maxima are 423, 397, 383, and 357 nm for xxA, xxG, xxC, and xxT, respectively, and they are greatly red-shifted compared with x-bases and natural bases, allowing them to be selectively excited in the presence of the natural bases. In the gas phase, the fluorescence from them would be expected to occur around 497, 461, 457, and 417 nm, respectively. The effects of methanol solution, deoxyribose, and base paring with their complementary natural bases on the relevant absorption and emission spectra of these modified bases were also examined.

Thymine/adenine diblock-oligonucleotide monolayers and hybrid brushes on gold: a spectroscopic study.

BACKGROUND: The establishment of spectroscopic analysis techniques for complex, surface-bound biological systems is an important step toward the further application of these powerful experimental tools to new questions in biology and medicine. METHODS: We use a combination of the complementary spectroscopic techniques of X-ray photoelectron spectroscopy, Infrared reflection-absorption spectroscopy, and near-edge x-ray absorption fine structure spectroscopy to monitor the composition and molecular orientation in adenine/thymine diblock oligonucleotide films and their hybridized brushes on gold. RESULTS: We demonstrate that the surface-bound probe molecules, consisting of a binding adenine block, d(A), and a sensing thymine block, d(T), deviate from the ideal L-shape model due to the internal intra- and intermolecular hybridization. This effect becomes more pronounced with increasing length of the d(A) block. Nevertheless, these films were found to hybridize well with the complementary target d(A) strands, especially if they were treated in advance to reduce internal interaction between the molecules. In spite of the structural complexity of these films, the hybridization efficiency correlated well with the potential accessibility of the sensing d(T) blocks, defined by their lateral spacing. CONCLUSIONS: These findings are a good demonstration of the strength of multi-technique spectroscopic analysis when applied to assemblies of biological molecules intrinsically prone to complex interactions.

Self-assembly and molecular recognition of adenine- and thymine-functionalized nucleolipids in the mixed monolayers and thymine-functionalized nucleolipids on aqueous melamine at the air-water interface.

Self-assembly and molecular recognition of the monolayers composed of an equimolar mixture of adenine- and thymine-functionalized nucleolipids at the air-water interface have been investigated in detail using surface pressure-molecular area isotherms and in situ infrared reflection absorption spectroscopy (IRRAS). Prior to molecular recognition, the adenine moieties in the monolayer were almost oriented on an end-on mode through π-stacking and hydrogen bonding interactions, and the C-C-C planes of the alkyl chains were preferentially oriented perpendicular to the water surface, while the thymine moieties in the monolayer were involved in hydrogen bonding almost with a flat-on orientation. On aqueous subphases containing complementary bases, no significant molecular recognition was observed for the monolayers of individual nucleolipids. In the monolayer of equimolar mixture, molecular recognition occurred between the adenine and thymine moieties through hydrogen bonding probably with the development of cyclic structures of adenine-thymine-adenine-thymine quartets. Although molecular recognition between the monolayer of thymine-functionalized nucleolipids and aqueous melamine took place through triple hydrogen bonds, no melamine binding to the monolayer of equimolar mixture was observed, which reflects the formation of the quartets in the mixed monolayers at the air-water interface. FTIR and small-angle X-ray diffraction (XRD) results of the corresponding Langmuir-Blodgett films support the hydrogen bonding recognition and molecular orientation.