RESUMEN
Background: The discovery of driver genes such as EGFR, KRAS, and ALK, has dramatically shifted treatment patterns in patients harboring these oncogenes. However, dissemination into the central nervous system (CNS) is a severe complication. In addition, the particular anatomical structure of the CNS has made it difficult to obtain tissue specimens from brain metastases (BM) to generate a gene map, as such, potential predictive markers for survival in patients with non-small cell lung cancer (NSCLC) and BM (NSCLC-BM) remain unclear. Methods: Data from 28 patients diagnosed with NSCLC-BM between June 2019 and May 2021 at Guangdong Sanjiu Brain Hospital (Guangzhou, China), were reviewed. Targeted next-generation sequencing (NGS) of a 168 cancer-related gene panel was available for surgically resected brain tissues from all patients. In addition, molecular characteristics and overall survival (OS) were analyzed to determine potential predictive markers. Results: Among patients with NSCLC-BM, NGS revealed that TP53 was the most frequent mutation (61 %), with a detection rate of 39 %, closely by EGFR amplification. Additionally, CDKN2A, MYC, LRP1B, and RNF43 were frequently observed (18 %). The median OS was significantly shorter in the TP53 mutation group than in the wildtype group (14 versus undefined months, p = 0.014). Similar results were also found in the genetic alteration of EGFR amplification, suggesting that EGFR amplification was associated with worse OS (14 vs. 24 months, p = 0.039). Interestingly, NGS revealed that gene alternations such as TP53, EGFR amplification, and CDKN2A, tended to coexist and such a co-alteration panel indicated worse clinical outcomes (median OS, 5 months). In addition, the detection rate of negative survival genes, including TP53 or EGFR amplification, was much higher in tumor tissues than in plasma samples, indicating the limited predictive value of matched PLA samples. Conclusions: Gene signatures, such as TP53 or EGFR amplification, were associated with worse survival in patients diagnosed with NSCLC-BM. These valuable findings may shed light on new strategies for the prognostic assessment of specific patient groups.
RESUMEN
The presence of polyethylene terephthalate (PET) microplastics (MPs) in waters has posed considerable threats to the environment and humans. In this work, a heterogeneous electro-Fenton-activated persulfate oxidation system with the FeS2-modified carbon felt as the cathode (abbreviated as EF-SR) was proposed for the efficient degradation of PET MPs. The results showed that i) the EF-SR system removed 91.3 ± 0.9 % of 100 mg/L PET after 12 h at the expense of trace loss (< 0.07 %) of [Fe] and that ii) dissolved organics and nanoplastics were first formed and accumulated and then quickly consumed in the EF-SR system. In addition to the destruction of the surface morphology, considerable changes in the surface structure of PET were noted after EF-SR treatment. On top of the emergence of the O-H bond, the ratio of C-O/C=O to C-C increased from 0.25 to 0.35, proving the rupture of the backbone of PET and the formation of oxygen-containing groups on the PET surface. With the verified involvement and contributions of SO4â¢- and â¢OH, three possible paths were proposed to describe the degradation of PET towards complete mineralization through chain cleavage and oxidation in the EF-SR system.
RESUMEN
Modeling of Multi-Electrode Arrays used in neural stimulation can be computationally challenging since it may involve incredibly dense circuits with millions of interconnected resistors, representing current pathways in an electrolyte (resistance matrix), coupled to nonlinear circuits of the stimulating pixels themselves. Here, we present a method for accelerating the modeling of such circuits while minimizing the error of a simplified simulation by using a sparse plus low-rank approximation of the resistance matrix. Specifically, we prove that thresholding of the resistance matrix elements enables its sparsification with minimized error. This is accomplished with a sorting algorithm implying efficient O (N log (N)) complexity. The eigenvalue-based low-rank compensation then helps achieve greater accuracy without adding significantly to the problem size. Utilizing these matrix techniques, we accelerated the simulation of multi-electrode arrays by an order of magnitude, reducing the computation time by about 10-fold, while maintaining an average error of less than 0.3% in the current injected from each electrode. We also show a case where acceleration reaches at least 133 times with additional error in the range of 4%, demonstrating the ability of this algorithm to perform under extreme conditions. Although the techniques presented here are used for simulations of photovoltaic retinal prostheses, they are also immediately applicable to any circuit involving dense connections between nodes, and, with modifications, more generally to any systems involving non-sparse matrices. This approach promises significant improvements in the efficiency of modeling the next-generation retinal implants having thousands of pixels, enabling iterative design with broad applicability.
RESUMEN
Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.
RESUMEN
The exploitation of hierarchical carbon nanocages with superior light-to-heat conversion efficiency, together with their distinct structural, morphological, and electronic properties, in photothermal applications could provide effective solutions to long-standing challenges in diverse areas. Here, we demonstrate the discovery of pristine and nitrogen-doped hierarchical carbon nanocages as superior supports for highly loaded, small-sized Ru particles toward enhanced photothermal CO2 catalysis. A record CO production rate of 3.1 mol·gRu-1·h-1 with above 90% selectivity in flow reactors was reached for hierarchical nitrogen-doped carbon-nanocage-supported Ru clusters under 2.4 W·cm-2 illumination without external heating. Detailed studies reveal that the enhanced performance originates from the strong broadband sunlight absorption and efficient light-to-heat conversion of nanocage supports as well as the excellent intrinsic catalytic reactivity of sub-2 nm Ru particles. Our study reveals the great potential of hierarchical carbon nanocages in photothermal catalysis to reduce the fossil fuel consumption of various industrial chemical processes and stimulates interest in their exploitation for other demanding photothermal applications.
RESUMEN
The tumor suppressor p53, primarily functioning as a transcription factor, has exhibited antiviral capabilities against various viruses in chickens, including infectious bursal disease virus (IBDV), avian leukosis virus subgroup J (ALV-J), and avian infectious laryngotracheitis virus (ILTV). Nevertheless, the existence of a universal antiviral mechanism employed by chicken p53 (chp53) against these viruses remains uncertain. This study conducted a comprehensive comparison of molecular networks involved in chp53's antiviral function against IBDV, ALV-J, and ILTV. This was achieved through an integrated analysis of ChIP-seq data, examining chp53's genome-wide chromatin occupancy, and RNA-seq data from chicken cells infected with these viruses. The consistent observation of chp53 target gene enrichment in metabolic pathways, confirmed via ChIP-qPCR, suggests a ubiquitous regulation of host cellular metabolism by chp53 across different viruses. Further genome binding motif conservation analysis and transcriptional co-factor prediction suggest conserved transcriptional regulation mechanism by which chp53 regulates host cellular metabolism during viral infection. These findings offer novel insights into the antiviral role of chp53 and propose that targeting the virus-host metabolic interaction through regulating p53 could serve as a universal strategy for antiviral therapies in chickens.IMPORTANCEThe current study conducted a comprehensive analysis, comparing molecular networks underlying chp53's antiviral role against infectious bursal disease virus (IBDV), avian leukosis virus subgroup J (ALV-J), and avian infectious laryngotracheitis virus (ILTV). This was achieved through a combined assessment of ChIP-seq and RNA-seq data obtained from infected chicken cells. Notably, enrichment of chp53 target genes in metabolic pathways was consistently observed across viral infections, indicating a universal role of chp53 in regulating cellular metabolism during diverse viral infections. These findings offer novel insights into the antiviral capabilities of chicken p53, laying a foundation for the potential development of broad-spectrum antiviral therapies in chickens.
Asunto(s)
Virus de la Leucosis Aviar , Pollos , Herpesvirus Gallináceo 1 , Virus de la Enfermedad Infecciosa de la Bolsa , RNA-Seq , Proteína p53 Supresora de Tumor , Animales , Pollos/virología , Proteína p53 Supresora de Tumor/metabolismo , Proteína p53 Supresora de Tumor/genética , Virus de la Leucosis Aviar/genética , Virus de la Leucosis Aviar/fisiología , Virus de la Enfermedad Infecciosa de la Bolsa/genética , Virus de la Enfermedad Infecciosa de la Bolsa/fisiología , Herpesvirus Gallináceo 1/genética , Secuenciación de Inmunoprecipitación de Cromatina , Antivirales/farmacología , Enfermedades de las Aves de Corral/virología , Enfermedades de las Aves de Corral/genética , Regulación de la Expresión GénicaRESUMEN
Corrosion-resistant coatings with self-healing capabilities are still a great challenge for metal protection. In this study, a corrosion-resistant coating with intrinsic self-healing capabilities was developed by compounding hydroxy-terminated silicone oil (HTSO) with 2-ureido-4[1H]-pyrimidone (UPy) derivatives. The smooth surface of the coating was shown by scanning electron microscopy (SEM), and good smoothness was also exhibited in the cross-section, which indicated that the coating is very homogeneous from the top to the bottom. Thermogravimetric analysis (TG) was employed to illustrate the temperature-resistant characteristics of the coating, revealing its significant chemical stability up to 360 °C. The corrosion resistance of the coating is assessed through electrochemical impedance spectroscopy (EIS), the typical impedance at 0.01 Hz is 1.70 × 109 and 2.44 × 108 Ω·cm2 before and after exposure to a 3.5 wt % NaCl solution for 70 days. There was no significant change in the water contact angle of the coatings before and after immersion; however, the adhesion strength was reduced. Notably, the coating demonstrates immediate and multiple self-healing properties. The tensile stress of the associated healing sample experiences an augmentation within the temperature range of 30-120 °C, with the critical fracture strain of the healed sample reaching 235% at 120 °C. The self-healing mechanism of the coating is systematically investigated using in situ Raman spectroscopy.
RESUMEN
Clinical results with photovoltaic subretinal prosthesis (PRIMA) demonstrated restoration of sight via electrical stimulation of the interneurons in degenerated retina, with resolution matching the 100 µm pixel size. Since scaling the pixels below 75 µm in the current bipolar planar geometry will significantly limit the penetration depth of the electric field and increase stimulation threshold, we explore the possibility of using smaller pixels based on a novel 3-dimensional honeycomb-shaped design. We assessed the long-term biocompatibility and stability of these arrays in rats by investigating the anatomical integration of the retina with flat and 3D implants and response to electrical stimulation over lifetime - up to 32-36 weeks post-implantation in aged rats. With both flat and 3D implants, signals elicited in the visual cortex decreased after the day of implantation by more than 3-fold, and gradually recovered over the next 12-16 weeks. With 25 µm high honeycomb walls, the majority of bipolar cells migrate into the wells, while amacrine and ganglion cells remain above the cavities, which is essential for selective network-mediated stimulation of the retina. Retinal thickness and full-field stimulation threshold with 40 µm-wide honeycomb pixels were comparable to those with planar devices - 0.05 mW/mm2 with 10 ms pulses. However, fewer cells from the inner nuclear layer migrated into the 20 µm-wide wells, and stimulation threshold increased over 12-16 weeks, before stabilizing at about 0.08 mW/mm2. Such threshold is still significantly lower than 1.8 mW/mm2 with a previous design of flat bipolar pixels, confirming the promise of the 3D honeycomb-based approach to high resolution subretinal prosthesis.
Asunto(s)
Retina , Prótesis Visuales , Animales , Retina/fisiología , Ratas , Estimulación Eléctrica , Ratas Long-Evans , Estudios de Seguimiento , Electrodos ImplantadosRESUMEN
In recent years, thanks to the development of integrated circuits, clinical medicine has witnessed significant advancements, enabling more efficient and intelligent treatment approaches. Particularly in the field of neuromedical, the utilization of brain-machine interfaces (BMI) has revolutionized the treatment of neurological diseases such as amyotrophic lateral sclerosis, cerebral palsy, stroke, or spinal cord injury. The BMI acquires neural signals via recording circuits and analyze them to regulate neural stimulator circuits for effective neurological treatment. However, traditional BMI designs, which are often isolated, have given way to closed-loop brain-machine interfaces (CL-BMI) as a contemporary development trend. CL-BMI offers increased integration and accelerated response speed, marking a significant leap forward in neuromedicine. Nonetheless, this advancement comes with its challenges, notably the stimulation artifacts (SA) problem inherent to the structural characteristics of CL-BMI, which poses significant challenges on the neural recording front-ends (NRFE) site. This paper aims to provide a comprehensive overview of technologies addressing artifacts in the NRFE site within CL-BMI. Topics covered will include: (1) understanding and assessing artifacts; (2) exploring the impact of artifacts on traditional neural recording front-ends; (3) reviewing recent technological advancements aimed at addressing artifact-related issues; (4) summarizing and classifying the aforementioned technologies, along with an analysis of future trends.
RESUMEN
BACKGROUND: Parkinson's disease (PD) is a progressive neurodegenerative disease with increasing prevalence. Effective diagnostic markers and therapeutic methods are still lacking. Exploring key molecular markers and mechanisms for PD can help with early diagnosis and treatment improvement. METHODS: Three datasets GSE174052, GSE77668, and GSE168496 were obtained from the GEO database to search differentially expressed circRNA (DECs), miRNAs (DEMis), and mRNAs (DEMs). GO and KEGG enrichment analyses, and protein-protein interaction (PPI) network construction were implemented to explore possible actions of DEMs. Hub genes were selected to establish circRNA-related competing endogenous RNA (ceRNA) networks. RESULTS: There were 1005 downregulated DECs, 21 upregulated and 21 downregulated DEMis, and 266 upregulated and 234 downregulated DEMs identified. The DEMs were significantly enriched in various PD-associated functions and pathways such as extracellular matrix organization, dopamine synthesis, PI3K-Akt, and calcium signaling pathways. Twenty-one hub genes were screened out, and a PD-related ceRNA regulatory network was constructed containing 31 circRNAs, one miRNA (miR-371a-3p), and one hub gene (KCNJ6). CONCLUSION: We identified PD-related molecular markers and ceRNA regulatory networks, providing new directions for PD diagnosis and treatment.
Asunto(s)
Biomarcadores , Biología Computacional , Progresión de la Enfermedad , Redes Reguladoras de Genes , Enfermedad de Parkinson , Enfermedad de Parkinson/genética , Humanos , Biología Computacional/métodos , Biomarcadores/metabolismo , MicroARNs/genética , Mapas de Interacción de Proteínas , ARN Mensajero/genética , ARN Mensajero/metabolismo , Perfilación de la Expresión Génica , ARN Circular/genéticaRESUMEN
[This corrects the article DOI: 10.1016/j.heliyon.2024.e24778.].
RESUMEN
Microbial fuel cells (MFCs), known for their low energy consumption, high efficiency, and environmental friendliness, have been widely utilized for removing antibiotics from wastewater. Compared to conventional wastewater treatment methods, MFCs produce less sludge while exhibiting superior antibiotic removal capacity, effectively reducing the spread of antibiotic resistance genes (ARGs). This study investigates 1) the mechanisms of ARGs generation and proliferation in MFCs; 2) the influencing factors on the fate and removal of antibiotics and ARGs; and 3) the fate and mitigation of ARGs in MFC and MFC-coupled systems. It is indicated that high removal efficiency of antibiotics and minimal amount of sludge production contribute the mitigation of ARGs in MFCs. Influencing factors, such as cathode potential, electrode materials, salinity, initial antibiotic concentration, and additional additives, can lead to the selection of tolerant microbial communities, thereby affecting the abundance of ARGs carried by various microbial hosts. Integrating MFCs with other wastewater treatment systems can synergistically enhance their performance, thereby improving the overall removal efficiency of ARGs. Moreover, challenges and future directions for mitigating the spread of ARGs using MFCs are suggested.
Asunto(s)
Antibacterianos , Fuentes de Energía Bioeléctrica , Farmacorresistencia Microbiana , Eliminación de Residuos Líquidos , Aguas Residuales , Eliminación de Residuos Líquidos/métodos , Farmacorresistencia Microbiana/genética , Aguas Residuales/microbiología , Contaminantes Químicos del AguaRESUMEN
Background: The differentiation between benign and malignant breast tumors extends beyond morphological structures to encompass functional alterations within the nodules. The combination of photoacoustic (PA) imaging and radiomics unveils functional insights and intricate details that are imperceptible to the naked eye. Purpose: This study aims to assess the efficacy of PA imaging in breast cancer radiomics, focusing on the impact of peritumoral region size on radiomic model accuracy. Materials and methods: From January 2022 to November 2023, data were collected from 358 patients with breast nodules, diagnosed via PA/US examination and classified as BI-RADS 3-5. The study used the largest lesion dimension in PA images to define the region of interest, expanded by 2â¯mm, 5â¯mm, and 8â¯mm, for extracting radiomic features. Techniques from statistics and machine learning were applied for feature selection, and logistic regression classifiers were used to build radiomic models. These models integrated both intratumoral and peritumoral data, with logistic regressions identifying key predictive features. Results: The developed nomogram, combining 5â¯mm peritumoral data with intratumoral and clinical features, showed superior diagnostic performance, achieving an AUC of 0.950 in the training cohort and 0.899 in validation. This model outperformed those based solely on clinical features or other radiomic methods, with the 5â¯mm peritumoral region proving most effective in identifying malignant nodules. Conclusion: This research demonstrates the significant potential of PA imaging in breast cancer radiomics, especially the advantage of integrating 5â¯mm peritumoral with intratumoral features. This approach not only surpasses models based on clinical data but also underscores the importance of comprehensive radiomic analysis in accurately characterizing breast nodules.
RESUMEN
Creating structural defects in a controlled manner within metal-organic frameworks (MOFs) poses a significant challenge for synthesis, and concurrently, identifying the types and distributions of these defects is also a formidable task for characterization. In this study, we demonstrate that by employing 2-sulfonylterephthalic acid as the ligand for synthesizing Zr (or Hf)-based MOFs, a crystal phase transformation from the common fcu topology to the rare jmt topology can be easily facilitated using a straightforward mixed-solvent strategy. The jmt phase, characterized by an extensively open framework, can be considered a derivative of the fcu phase, generated through the introduction of missing-cluster defects. We have explicitly identified both MOF phases, their intermediate states, and the novel core-shell structures they form using ultralow-dose high-resolution transmission electron microscopy. In addition to facilitating phase engineering, the incorporation of sulfonic groups in MOFs imparts ionic selectivity, making them applicable for osmotic energy harvesting through mixed matrix membrane fabrication. The membrane containing the jmt-phase MOF exhibits an exceptionally high peak power density of 10.08 W m-2 under a 50-fold salinity gradient (NaCl: 0.5 M|0.01 M), which surpasses the threshold of 5 W m-2 for commercial applications and can be attributed to the combination of large pore size, extensive porosity, and abundant sulfonic groups in this novel MOF material.
RESUMEN
OBJECTIVE: There is a growing body of evidence indicating that pyroptosis, a programmed cell death mechanism, plays a crucial role in the exacerbation of inflammation and fibrosis in the pathogenesis of non-alcoholic fatty liver disease (NAFLD). Circular RNAs (circRNAs), functioning as vital regulators within NAFLD, have been shown to mediate the process of cell pyroptosis. This study aims to elucidate the roles and mechanisms of circRNAs in NAFLD. METHODS: Utilizing a high-fat diet (HFD)-induced rat model for in vivo experimentation and hepatocytes treated with palmitic acid (PA) for in vitro models, we identified circular RNA SOD2 (circSOD2) as our circRNA of interest through analysis with the circMine database. The expression levels of associated genes and pyroptosis-related proteins were determined using quantitative real-time polymerase chain reaction and Western blotting, alongside immunohistochemistry. Serum liver function markers, cellular inflammatory cytokines, malondialdehyde, lactate dehydrogenase levels, and mitochondrial membrane potential, were assessed using enzyme-linked immunosorbent assay, standard assay kits, or JC-1 staining. Flow cytometry was employed to detect pyroptotic cells, and lipid deposition in liver tissues was observed via Oil Red O staining. The interactions between miR-532-3p/circSOD2 and miR-532-3p/Thioredoxin Interacting Protein (TXNIP) were validated through dual-luciferase reporter assays and RNA immunoprecipitation experiments. RESULTS: Our findings demonstrate that, in both in vivo and in vitro NAFLD models, there was an upregulation of circSOD2 and TXNIP, alongside a downregulation of miR-532-3p. Mechanistically, miR-532-3p directly bound to the 3'-UTR of TXNIP, thereby mediating inflammation and cell pyroptosis through targeting the TXNIP/NLR family pyrin domain containing 3 (NLRP3) inflammasome signaling pathway. circSOD2 directly interacted with miR-532-3p, relieving the suppression on the TXNIP/NLRP3 signaling pathway. Functionally, the knockdown of circSOD2 or TXNIP improved hepatocyte pyroptosis; the deletion of miR-532-3p reversed the effects of circSOD2 knockdown, and the deletion of TXNIP reversed the effects of circSOD2 overexpression. Furthermore, the knockdown of circSOD2 significantly mitigated the progression of NAFLD in vivo. CONCLUSION: circSOD2 competitively sponges miR-532-3p to activate the TXNIP/NLRP3 inflammasome signaling pathway, promoting pyroptosis in NAFLD.
Asunto(s)
Proteínas de Ciclo Celular , Hepatocitos , MicroARNs , Proteína con Dominio Pirina 3 de la Familia NLR , Enfermedad del Hígado Graso no Alcohólico , Piroptosis , ARN Circular , Animales , Humanos , Masculino , Ratas , Proteínas Portadoras/metabolismo , Proteínas Portadoras/genética , Dieta Alta en Grasa/efectos adversos , Modelos Animales de Enfermedad , Hepatocitos/metabolismo , MicroARNs/genética , MicroARNs/metabolismo , Proteína con Dominio Pirina 3 de la Familia NLR/metabolismo , Proteína con Dominio Pirina 3 de la Familia NLR/genética , Enfermedad del Hígado Graso no Alcohólico/metabolismo , Enfermedad del Hígado Graso no Alcohólico/genética , Enfermedad del Hígado Graso no Alcohólico/patología , Piroptosis/genética , Ratas Sprague-Dawley , ARN Circular/genética , ARN Circular/metabolismo , Transducción de Señal , Superóxido Dismutasa/metabolismo , Superóxido Dismutasa/genética , Tiorredoxinas/metabolismo , Tiorredoxinas/genéticaRESUMEN
The development of high-performance electrocatalysts for energy conversion reactions is crucial for advancing global energy sustainability. The design of catalysts based on their electronic properties (e.g., work function) has gained significant attention recently. Although numerous reviews on electrocatalysis have been provided, no such reports on work function-guided electrocatalyst design are available. Herein, a comprehensive summary of the latest advancements in work function-guided electrocatalyst design for diverse electrochemical energy applications is provided. This includes the development of work function-based catalytic activity descriptors, and the design of both monolithic and heterostructural catalysts. The measurement of work function is first discussed and the applications of work function-based catalytic activity descriptors for various reactions are fully analyzed. Subsequently, the work function-regulated material-electrolyte interfacial electron transfer (IET) is employed for monolithic catalyst design, and methods for regulating the work function and optimizing the catalytic performance of catalysts are discussed. In addition, key strategies for tuning the work function-governed material-material IET in heterostructural catalyst design are examined. Finally, perspectives on work function determination, work function-based activity descriptors, and catalyst design are put forward to guide future research. This work paves the way to the work function-guided rational design of efficient electrocatalysts for sustainable energy applications.
RESUMEN
Adsorption, which is a quick and effective method for phosphate management, can effectively address the crisis of phosphorus mineral resources and control eutrophication. Phosphate management systems typically use iron-containing nanominerals (ICNs) with large surface areas and high activity, as well as modified ICNs (mICNs). This paper comprehensively reviews phosphate management by ICNs and mICNs in different water environments. mICNs have a higher affinity for phosphates than ICNs. Phosphate adsorption on ICNs and mICNs occurs through mechanisms such as surface complexation, surface precipitation, electrostatic ligand exchange, and electrostatic attraction. Ionic strength influences phosphate adsorption by changing the surface potential and isoelectric point of ICNs and mICNs. Anions exhibit inhibitory effects on ICNs and mICNs in phosphate adsorption, while cations display a promoting effect. More importantly, high concentrations and molecular weights of natural organic matter can inhibit phosphate adsorption by ICNs and mICNs. Sodium hydroxide has high regeneration capability for ICNs and mICNs. Compared to ICNs with high crystallinity, those with low crystallinity are less likely to desorb. ICNs and mICNs can effectively manage municipal wastewater, eutrophic seawater, and eutrophic lakes. Adsorption of ICNs and mICNs saturated with phosphate can be used as fertilizers in agricultural production. Notably, mICNs and ICNs have positive and negative effects on microorganisms and aquatic organisms in soil. Finally, this study introduces the following: trends and prospects of machine learning-guided mICN design, novel methods for modified ICNs, mICN regeneration, development of mICNs with high adsorption capacity and selectivity for phosphate, investigation of competing ions in different water environments by mICNs, and trends and prospects of in-depth research on the adsorption mechanism of phosphate by weakly crystalline ferrihydrite. This comprehensive review can provide novel insights into the research on high-performance mICNs for phosphate management in the future.
RESUMEN
Glioblastoma (GBM) is the most common primary intracranial malignancy with a very low survival rate. Exploring key molecular markers for GBM can help with early diagnosis, prognostic prediction, and recurrence monitoring. This study aims to explore novel biomarkers for GBM via bioinformatics analysis and experimental verification. Dataset GSE103229 was obtained from the GEO database to search differentially expressed lncRNA (DELs), mRNAs (DEMs), and miRNAs (DEMis). Hub genes were selected to establish competing endogenous RNA (ceRNA) networks. The GEPIA database was employed for the survival analysis and expression detection of hub genes. Hub gene expression in GBM tissue samples and cell lines was validated using RT-qPCR. Western blotting was employed for protein expression evaluation. SYT1 overexpression vector was transfected in GBM cells. CCK-8 assay and flow cytometry were performed to detect the malignant phenotypes of GBM cells. There were 901 upregulated and 1086 downregulated DEMs identified, which were prominently enriched in various malignancy-related functions and pathways. Twenty-two hub genes were selected from PPI networks. Survival analysis and experimental validation revealed that four hub genes were tightly associated with GBM prognosis and progression, including SYT1, GRIN2A, KCNA1, and SYNPR. The four genes were significantly downregulated in GBM tissues and cell lines. Overexpressing SYT1 alleviated the proliferation and promoted the apoptosis of GBM cells in vitro. We identify four genes that may be potential molecular markers of GBM, which may provide new ideas for improving early diagnosis and prediction of the disease.
RESUMEN
COVID-19 is a global pandemic that has caused significant global, social, and economic disruption. To effectively assist in screening and monitoring diagnosed cases, it is crucial to accurately segment lesions from Computer Tomography (CT) scans. Due to the lack of labeled data and the presence of redundant parameters in 3D CT, there are still significant challenges in diagnosing COVID-19 in related fields. To address the problem, we have developed a new model called the Cascaded 3D Dilated convolutional neural network (CD-Net) for directly processing CT volume data. To reduce memory consumption when cutting volume data into small patches, we initially design a cascade architecture in CD-Net to preserve global information. Then, we construct a Multi-scale Parallel Dilated Convolution (MPDC) block to aggregate features of different sizes and simultaneously reduce the parameters. Moreover, to alleviate the shortage of labeled data, we employ classical transfer learning, which requires only a small amount of data while achieving better performance. Experimental results conducted on the different public-available datasets verify that the proposed CD-Net has reduced the negative-positive ratio and outperformed other existing segmentation methods while requiring less data.