Immunogenic and protective potential of mutans streptococcal glucosyltransferase peptide constructs selected by major histocompatibility complex class II allele binding.

Mutans streptococcal glucosyltransferases (GTF) have been demonstrated to be effective components of dental caries vaccines. We had previously selected peptide subunits of GTF for vaccine development based on putative functional significance and conservation of GTF primary structure among enzyme isoforms. In this study, 20 20-mer linear GTF peptides were synthesized, 17 identified on the basis of the highest potential major histocompatibility complex (MHC) class II-binding activity using computer-generated algorithms (Epimatrix and ProPred) and 3 with previously demonstrated functional significance. The immunoreactivities of these peptides were explored with rodent systems. Sera from GTF-immunized rats, assessed for binding to linear peptides by enzyme-linked immunosorbent assay, demonstrated immunoglobulin G antibody reactivity with peptides 6 and 11 and a T-cell proliferation response to peptides 6, 9, 11, and 16. Multiple antigenic peptide (MAP) constructs were synthesized from promising linear sequences. Rats that were immunized with MAP 7, 11, or 16, respectively, responded well to the immunizing MAP. Most importantly, a robust immune response (antibody and T-cell proliferation) was observed to native GTF following MAP 11 (amino acids 847 to 866; VVINNDKFVSWGITDFEM) immunization. This response inhibited GTF enzyme function. Two dental caries pathogenesis experiments were performed wherein rats were immunized with MAP constructs 11, 16, and/or 11 plus 16, followed by infection with cariogenic Streptococcus sobrinus. In both experiments cariogenic bacterial recoveries were reduced relative to total streptococci in the MAP 11- and MAP 11 plus 16-immunized groups, and the extent of dental caries was also significantly reduced in these groups. Thus, we have identified a peptide with projected avid MHC-binding activity that elicited immunoreactivity with native GTF and demonstrated protection against dental caries infection after immunization, implying that this peptide may be important in a subunit dental caries vaccine.

Effect of adoptive transfer of antigen-specific B cells on periodontal bone resorption.

BACKGROUND AND OBJECTIVES: Host immune responses to periodontal pathogens have been considered to contribute to the alveolar bone destruction in periodontitis. However, the role of B lymphocytes in the pathogenesis of periodontal bone loss is not clear. METHODS: We examined the effect of adoptive transfer of antigen-specific B cells from rat spleens on experimental periodontal bone resorption. Donor rats were immunized intraperitoneally (i.p.) with formalin-killed Actinobacillus actinomycetemcomitans. Antigen-specific B cells were prepared from splenocytes by first binding CD43(+) cells to Petri dishes coated with anti-CD43 antibody to remove T cells, and non-binding cells were passed through a nylon wool column to deplete accessory cells. The retained cells were then collected and bound to A. actinomycetemcomitans-coated Petri dishes for enrichment of A. actinomycetemcomitans-binding B cells (AAB). A. actinomycetemcomitans non-binding B cells (ANB) and B cells from non-immunized donor rats (NIB) were also collected from these procedures. Each type of B cell was injected into a group of recipient rats that were then orally infected with live A. actinomycetemcomitans. RESULTS: At termination, the antibody levels to A. actinomycetemcomitans in serum and gingival wash fluids were significantly higher in the recipients transferred with AAB when compared to the recipients transferred with ANB or NIB. A markedly elevated number of antibody-forming cells were observed in the spleens of the recipients transferred with AAB, and these recipient rats also exhibited significantly increased bone resorption when compared to the other groups. CONCLUSIONS: It is suggested that B cells can contribute to periodontal bone resorption and that antigen-triggering of B cells is required for the bone resorption.

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of male Rowett rats (n=5-6/group) received colloidal aluminium hydroxide (Al(OH)3) either alone, or with Tt bound to the Al(OH)3, or with Tt bound to Al(OH)3 with the addition of the CpG oligonucleotide. Antigens were administered subcutaneously in the salivary gland vicinity once, or by gastric intubation on 3 consecutive days. On day 124 all animals were given a boost with the same material by the same route. Serum IgG and saliva IgA antibody to Tt was determined by ELISA. Serum antibody levels were significantly higher in ODN+Tt treated rats than in Tt-alone rats immunized by either route after primary or booster immunizations. Thus, administration of an ODN containing unmethylated CpG motifs along with an immunogen bound to Al(OH)3 can result in enhanced specific antibody when administered by intragastric as well as subcutaneous routes.

T(h)1 transmigration anergy: a new concept of endothelial cell-T cell regulatory interaction.

Stimulation of endothelial cells (EC) with IFN-gamma generates selective enhancement of T(h)1 cell transmigration and induction of MHC class II expression on EC. In the present study, we tested whether antigen presentation by EC could influence transmigrating T cells in an in vitro system. Bacterial antigen presentation by EC from primary culture and after cloning induced antigen-specific anergy of transmigrating T(h)1 clone cells in a MHC class II-dependent manner as characterized by non-responsiveness to subsequent antigen presentation and inability to produce IL-2. This T cell transmigration anergy induced by EC was abrogated by anti-rat CD28 mAb, suggesting that lack of B7 co-stimulatory signals by EC might be related to the induction of anergy. While MHC class II expression on primary and cloned EC was observed after IFN-gamma stimulation, these cells never expressed B7. B7-1 gene-transfected endothelial clone cells (ECC/B7-1) were developed to elucidate the influence of B7 co-stimulation by EC. ECC/B7-1 induced proliferation of T(h)1 clone cells, whereas ECC did not induce proliferation in co-culture of T(h)1 clone cells and EC stimulated with IFN-gamma and antigen. In the transmigration assay, ECC/B7-1 did not induce transmigration anergy of T(h)1 clones or T(h)1 lines unless anti-rat B7-1 blocking mAb was added. Therefore, in rats, the T cell anergy induced during transmigration across a layer of EC seemed to be due to antigen presentation in the absence of B7 on the EC. We introduce the concept of transmigration anergy in this manuscript. Thus, EC can play a critical immune regulatory role in the context of antigen presentation by MHC class II to transmigrating T cells.

Coimmunization with complementary glucosyltransferase peptides results in enhanced immunogenicity and protection against dental caries.

Peptide constructs from the catalytic (CAT) and glucan-binding (GLU) regions of the mutans streptococcal glucosyltransferase enzymes (GTF) can provide immunity to dental caries infection. A strategy of coimmunization was tested to determine whether protection could be enhanced. Rats were immunized with one of the previously described peptide constructs from the CAT or GLU region of the GTF of mutans streptococci or coimmunized with a combination of these constructs (CAT-GLU). Coimmunized animals demonstrated significantly higher serum immunoglobulin G (IgG) and salivary IgA antibody levels to CAT or GTF than rats immunized with either construct alone. To assess the functional significance of coimmunization with these constructs, animals were immunized as above or with Streptococcus sobrinus GTF and then infected with S. sobrinus to explore the effects of immunization on immunological, microbiological, and disease (dental caries) parameters. Serum antibody from the communized group inhibited S. sobrinus GTF-mediated insoluble glucan synthesis in vitro above that of the individual-construct-immunized groups. Immunization with CAT or GLU constructs resulted in significantly reduced dental caries after infection with S. sobrinus compared with sham-immunized animals. Coimmunization produced greater reductions in caries than after immunization with either CAT or GLU. Also, significant elevations in lymphocyte proliferative responses to CAT, GLU, and GTF were observed after coimmunization with CAT-GLU compared with the responses after immunization with the individual constructs. The results suggested that increased numbers of memory T cells, which could proliferate to CAT, were generated by coimmunization. The experiments support the functional significance of these GTF domains in dental caries pathogenesis and present coimmunization as a simple alternative to intact GTF to enhance protective immunity against cariogenic microorganisms.

Requirement of B7 costimulation for Th1-mediated inflammatory bone resorption in experimental periodontal disease.

The CD28 costimulation at TCR signaling plays a pivotal role in the regulation of the T cell response. To elucidate the role of T cells in periodontal disease, a system of cell transfer with TCR/CD28-dependent Th1 or Th2 clones was developed in rats. Gingival injection of specific Ag, Actinobacillus actinomycetemcomitans 29-kDa outer membrane protein, and LPS could induce local bone resorption 10 days after the transfer of Ag-specific Th1 clone cells, but not after transfer of Th2 clone cells. Interestingly, the presence of LPS was required not only for the induction of bone resorption but also for Ag-specific IgG2a production. LPS injection elicited the induction of expression of both B7-1 and B7-2 expression on gingival macrophages, which otherwise expressed only MHC class II when animals were injected with Ag alone. The expression of B7 molecules was observed for up to 3 days, which corresponded to the duration of retention of T clone cells in gingival tissues. Either local or systemic administration of CTLA4Ig, a functional antagonist of CD28 binding to B7, could abrogate the bone resorption induced by Th1 clone cells combined with gingival challenge with both Ag and LPS. These results suggest that local Ag-specific activation of Th1-type T cells by B7 costimulation appeared to trigger inflammatory bone resorption, whereas inhibition of B7 expression by CTLA4Ig might be a therapeutic approach for intervention with inflammatory bone resorption.

Selective diapedesis of Th1 cells induced by endothelial cell RANTES.

Differentiated CD4 T cells can be divided into Th1 and Th2 types based on the cytokines they produce. Differential expression of chemokine receptors on either the Th1-type or the Th2-type cell suggests that Th1-type and Th2-type cells differ not only in cytokine production but also in their migratory capacity. Stimulation of endothelial cells with IFN-gamma selectively enhanced transmigration of Th1-type cells, but not Th2-type cells, in a transendothelial migration assay. Enhanced transmigration of Th1-type cells was dependent on the chemokine RANTES produced by endothelial cells, as indicated by the findings that Ab neutralizing RANTES, or Ab to its receptor CCR5, inhibited transmigration. Neutralizing Ab to chemokines macrophage-inflammatory protein-1alpha or monocyte chemotactic protein-1 did not inhibit Th1 selective migration. Whereas anti-CD18 and anti-CD54 blocked basal levels of Th1-type cell adherence to endothelial cells and also inhibited transmigration, anti-RANTES blocked only transmigration, indicating that RANTES appeared to induce transmigration of adherent T cells. RANTES seemed to promote diapedesis of adherent Th1-type cells by augmenting pseudopod formation in conjunction with actin rearrangement by a pathway that was sensitive to the phosphoinositol 3-kinase inhibitor wortmannin and to the Rho GTP-binding protein inhibitor, epidermal cell differentiation inhibitor. Thus, enhancement of Th1-type selective migration appeared to be responsible for the diapedesis induced by interaction between CCR5 on Th1-type cells and RANTES produced by endothelial cells. Further evidence that CCR5 and RANTES play a modulatory role in Th1-type selective migration derives from the abrogation of this migration by anti-RANTES and anti-CCR5 Abs.

Antigen direction of specific T-cell clones into gingival tissues.

This study was performed to investigate T-cell traffic to periodontal tissues during infection with a periodontal pathogen Actinobacillus actinomycetemcomitans (Aa). Rowett rat T-cell clones, A3 (CD4+ CD8-, alpha beta TCR+, NKRP-1-, specific to Aa) and G2 (CD4- CD8-, alpha beta TCR+, NKRP-1+, which reacts to Aa, Gram-negative and -positive bacteria), both expressed the same prominent adhesion molecules (LFA-1, VLA-4) to the same extent. Binding of both T-cell clones to rat endothelial cells in vitro was blocked by antibody to VLA-4. Rowett rats were infected with Aa and infused with Aa-stimulated, isogenic T-clone lymphocytes that had been labelled in vitro with 125IUdR. Radioactivity associated with recovery of clone A3, but not G2, was significantly elevated in the gingivae of infected rats, suggesting migration to infected animals' gingival tissues. Migration of radioactive Aa-specific A3 clone cells traced by autoradiography reached a maximum at 24 hr (1.2% of total lymphocytes as radiolabelled cells in infected gingiva versus 0.6% in noninfected), indicating an apparent antigen-directed retention in infected rats' gingival tissues. The G2 clone was not retained in the gingival tissues (0.20% of total lymphocytes as radiolabelled cells in infected gingiva versus 0.26% in non-infected). However, the possibility of A3 retention directed by inflammation or tissue-selective homing could not be excluded. In further experiments, other adoptively transferred T-clone lymphocytes [clones G23 (Th1) and F13 (Th2)] with specificity for the 29,000 MW outer membrane protein of Aa with the same prominent adhesion molecules could be recovered from rat gingivae previously challenged with this antigen. However, transferred T-clone lymphocytes [clone G26 (Th1)] with specificity for a different Aa antigen were not recovered. Therefore, the dynamics of cell entry into periodontal lesions vary for activated T lymphocytes with different antigenic specificities, indicating the significance of antigen in lymphocyte traffic to periodontal tissues.

CD29 expression on CD4+ gingival lymphocytes supports migration of activated memory T lymphocytes to diseased periodontal tissue.

The cell surface phenotypes of CD+ cells extracted from inflammatory periodontal disease tissues were analyzed using two- and three-color immunofluorescence and flow cytometry. Cells extracted from both adult periodontal and localized juvenile periodontitis lesions showed a depressed CD4/CD8 ratio (1.0 +/- 0.1 adult periodontitis and 1.1 +/- 0.1 localized juvenile periodontitis) compared with cells recovered from normal/marginal gingivitis tissue (1.8 +/- 0.2) or with normal peripheral blood cells (2.1 +/- 0.1) or periodontal disease blood cells (2.1 +/- 0.1 and 1.7 +/- 0.1 for adult periodontitis and juvenile periodontitis, respectively). The monoclonal antibodies anti-2H4 and anti-4B4 were used to identify the CD45RA and CD29 antigens respectively on CD4+ T cells from the periodontal disease lesions. In peripheral blood. CD29+ cells accounted for 66-77% of the CD4+ population, and CD45RA+ cells accounted for 22-27% of the CD4+ subset. No differences in expression were found between peripheral blood lymphocytes from normal subjects and from periodontal disease patients. Two-color analyses of lymphocytes from periodontal diseased tissues showed that 87-89% of the CD4+ population were CD29+ and that 70-79% of the CD4+ cells were CD45RA+. Normal tissues contained significantly fewer CD4+CD29+ cells (56 +/- 4%) and CD4+CD45RA+ cells (40 +/- 4%) on average, and few, if any double-labelled cells could be accounted for. These data implied that a significant percentage of the CD4+ cells from the diseased tissues were both CD29+ and CD45RA+ and that these populations are found in quite different proportions in diseased periodontal tissue than in peripheral blood or nondiseased tissue. In further analyses using three-color cytometry the mean percentage of CD4+ CD29+ CD45RA+ lymphocytes extracted from periodontal disease lesions was 43 +/- 9% of the CD4+ population. These results suggest that CD4+ T lymphocytes in periodontal disease not only demonstrate varying levels of maturity but also that the accumulation of CD4+ T cells within the periodontal tissues may be a result of increased adhesion and transendothelial migration.

Adoptive transfer of cloned T helper cells ameliorates periodontal disease in nude rats.

We have previously described a T helper cell 2-type clone, A3, of rat T cells that provides help for antibody production to Actinobacillus actinomycetemcomitans in vitro and in vivo in normal (euthymic) isogeneic Rowett strain recipient rats. Adoptive transfer of this T helper cell clone to euthymic rats also protects them from periodontal bone loss induced by oral infection with A. actinomycetemcomitans. In the present study, to assess the cell requirement for protection, A3 clone T lymphocytes (10(6)) or naive lymph node (6 x 10(4)) T cells, or A3 plus naive lymph node T cells (6 x 10(4)) were adoptively transferred to groups (n = 7-9) of 30-day-old Rowett athymic nude (rnu/rnu) rats. All recipients were also immunized (intraperitoneally) with 10(7) killed A. actinomycetemcomitans on the day of T cell transfer and orally infected with these bacteria on each of the next 5 days. Recipients of the combined A3+lymph node T cell transfer showed significantly increased serum immunoglobulin G (IgG) and IgM antibody to A. actinomycetemcomitans and in vitro proliferation of spleen lymphocytes to A. actinomycetemcomitans as antigen compared with nude animals receiving lymph node T cells only. Although other possibilities are discussed, we inferred that these differences might be due to successful population of the congenitally athymic rats by A3 clone cells given with a small number of normal autologous naive lymph node T cells. The result of this co-transfer of naive T cells with the A3 clone cells seemed to be greatly increased antibody production and protection from periodontal bone loss.

Effect of adoptive transfer of cloned Actinobacillus actinomycetemcomitans-specific T helper cells on periodontal disease.

Previously we isolated several Actinobacillus actinomycetemcomitans-specific T-cell clones from the spleens and lymph nodes of immunized Rowett rats. These clones were characterized as W3/13+, W3/25+, OX8-, and OX22-, suggesting a T helper (Th) phenotype. In the current experiments, 10(6) cells from a single A. actinomycetemcomitans-specific clone (A3) were adoptively transferred to a group (AaTh; n = 13) of normal heterozygous rats (rnu/+) at 28 days of age. A second group received no T cells (AaNT; n = 15), and a third group also received no T cells (NAaNT, n = 11). Beginning 1 day after transfer, the first and second groups were infected orally with A. actinomycetemcomitans for 5 consecutive days. The presence of infection was confirmed immediately after challenge and after 5 months, when the experiments were ended. Significantly higher numbers of lymphocytes were recovered from the gingival tissues of the first group than from those of either of the other groups. Also, this group showed significantly elevated (P less than 0.01) serum immunoglobulin G and immunoglobulin M antibody to A. actinomycetemcomitans in an enzyme-linked immunosorbent assay when compared with both other groups. Bone loss was significantly lower (P less than 0.01) in recipients of A. actinomycetemcomitans-specific cloned cells when compared with the other infected group and was approximately equal to the bone loss of the uninfected group. These results are consistent with the hypothesis that T-cell regulation can affect periodontal disease. In this regulation, T helper cells appear to interfere with periodontal bone loss.

Characterization of rat T-cell clones with bacterial specificity.

We have isolated 10 rat T-cell clones from the spleen or lymph nodes of seven different donors. These rats were immunized with 2-5 x 10(8) killed Actinobacillus actinomycetemcomitans (Aa) bacteria, injected either subcutaneously (s.c.) in complete Freund's adjuvant or intraperitoneally (i.p.) in saline. Clones studied to date have demonstrated a T-helper (Th) phenotype W3/13+, W3/25+, OX8- and OX22-. Clones were not stimulated in vitro by purified Aa-lipopolysaccharide (LPS) or heterologous Gram-negative bacteria, but proliferated when stimulated by bacteria representative of each of the three serological groups of Actinobacillus, indicating specificity for an Actinobacillus-common antigen other than LPS. One clone (A4) proliferated vigorously when stimulated with concanavalin A (Con A) in vitro, produced interleukin-2 (IL-2) and was provisionally classified as a Th1 type. This appears to be one of the few Th1-type rat clones reported. All other clones tested did not produce IL-2, exhibited B-cell help to some extent, did not induce delayed-type hypersensitivity (DTH) when injected into the footpads of naive rats along with the specific antigen, and were classified as Th2 type. Adoptive transfer of 10(6) cells of one Th2-type Aa-specific clone into syngeneic recipients resulted in a specific splenocyte in vitro response to Aa 12-14 weeks after cell transfer, indicating survival of cloned cells in recipient animals. The use of such clones in studies of experimental periodontal disease is discussed.

Actinobacillus actinomycetemcomitans mitogenicity for B cells can be attributed to lipopolysaccharide.

The purpose of this investigation was to determine the component(s) of whole Actinobacillus actinomycetemcomitans bacteria responsible for B cell mitogenic activity. Congenitally athymic "nude" rats were used as a source of B cells devoid of T lymphocyte activity. Spleen cells were cultured with, or without, whole formalin-killed A. actinomycetemcomitans bacteria or with purified LPS from A. actinomycetemcomitans. Dose-response curves to A. actinomycetemcomitans cells or to A. actinomycetemcomitans-LPS showed that responses were dose dependent. If optimal quantities of both A. actinomycetemcomitans and A. actinomycetemcomitans-LPS were added in combination, the proliferative responses were the same as if either was added alone, i.e., the responses were not additive. Polymyxin B at 2 micrograms/well completely abrogated the proliferative response of athymic rat splenocytes to 10(7) A. actinomycetemcomitans cells or to 1.25 micrograms A. actinomycetemcomitans-LPS/well. Therefore, the in vitro early proliferative response of B cells to A. actinomycetemcomitans can be attributed to the presence of LPS on A. actinomycetemcomitans cells. A considerable portion of the in situ lymphocytic gingival response to A. actinomycetemcomitans infection seen in periodontal disease patients may be a B cell mitogenic response to the LPS of this bacterium.

Immune properties of glucosyltransferases from S. sobrinus.

GTF activity was separated into water-insoluble (GTF-I) and water-soluble (GTF-S) polyglucan-synthesizing enzymes. Each preparation demonstrated a single band on 6% SDS PAGE. Only water-insoluble or water-soluble polyglucan was synthesized by the respective enzyme preparation. Rats were immunized, on Days 1 and 14, with either GTF-I or GTF-S in adjuvant. Animals were bled 13, 35 and 54 days after the initial immunization. Individual antisera were tested against either the GTF-I or the GTF-S for inhibition of radioactive glucose incorporation into glucan, and in gel diffusion, and by Western transfer analyses. The respective antisera reacted with the homologous, but not the heterologous enzyme in gel diffusion and Western transfer. GTF-I activity was not inhibited by antibody to GTF-S, but antibody to GTF-I inhibited GTF-I by 68%. GTF-S was inhibited by more than 60% by each of 3 anti-GTF-S sera. Only one anti-GTF-I serum inhibited GTF-S at as much as a modest 30% level. These data support the antigenic and functional distinctiveness of the GTF enzymes of S. sobrinus 6715.

Lupus prone (SWR x NZB)F1 mice produce potentially nephritogenic autoantibodies inherited from the normal SWR parent.

The incidence of nephritis in autoimmune NZB mice is low, but when they are crossed with normal SWR mice, almost 100% of the female F1 hybrids (SNF1) develop lethal glomerulonephritis. To define the contribution of the normal SWR strain to the development of nephritis, we analyzed 65 monoclonal anti-DNA autoantibodies derived from SNF1 mice and compared them with those obtained from the NZB parent. The majority of the SNF1-derived anti-DNA antibodies were IgG and cationic in charge. By contrast, 77% of the NZB-derived antibodies were IgM. Moreover, all three NZB-derived IgG anti-DNA antibodies were anionic. The cationic property of the SNF1-derived IgG autoantibodies was not restricted to any particular antigenic specificity pattern or IgG subclass, nor was there a preference for the allotype of either parent. However, we identified a set of highly cationic (pI at 8.2 to 8.8 pH) IgG2b anti-DNA antibodies from SNF1 hybrids that had the SWR allotype. Isoelectric focusing of intact antibodies and isolated heavy and light chains showed that the highly cationic charge of these antibodies was determined by the variable regions of their heavy chains. Because IgG anti-DNA antibodies with cationic charge are especially pathogenic, those antibodies bearing the allotype of the normal SWR parent may account for the high incidence of severe nephritis in the F1 hybrids. The results indicate that pathogenic autoantibodies, which are encoded by genes of the nonautoimmune SWR parent, are expressed in the SNF1 mice due to some cellular and genetic regulatory influence of the NZB parent.

Genetic analysis of the inheritance of B cell hyperactivity in relation to the development of autoantibodies and glomerulonephritis in NZB x SWR crosses.

Autoimmune NZB mice have a primary B cell abnormality manifested by spontaneous hypersecretion of IgM in short-term cultures. The purpose of this study was to characterize the genes that specify this intrinsic B cell defect and determine their relationship to "autoimmunity" genes. The increase in IgM secretion was shown to result from two independently segregating genetic traits: a) an increased number of IgM-containing cells, and b) an increased rate of secretion of IgM per cell. In this study, approximately 600 NZB, SWR, F1, F2, and reciprocal back-cross mice were hemisplenectomized at 5 to 6 months of age to determine the number of IgM-containing cells and the secretion of IgM in 4-hr cultures. These animals were followed prospectively for the development of anti-DNA (native and denatured) and anti-red blood cell autoantibodies, and proteinuria, and studied at autopsy for the development of glomerulonephritis. The severity and incidence of renal lesions was influenced to some extent by the presence of B cell hyperactivity. However, a proportion of F2 and backcross progeny mice that did not show B cell hyperactivity eventually developed autoantibodies and autoimmune disease.

Preservation of T-lymphocyte activity in autoimmune MRL-lpr mice treated with prostaglandin.

MRL-lpr mice display immunoregulatory disturbances which are related to an early massive T-lymphocyte hyperplasia. Features of autoimmunity are rapidly progressive and these animals die from immune complex-mediated glomerulonephritis. Previous studies show that 15 methyl prostaglandin E1 (PGE) treatment in MRL-lpr mice prolongs survival by preventing lymphoproliferation and the subsequent renal disease. The present study indicates that a major activity of this therapy stabilizes several T-cell functions. Both the age-related loss of the autologous mixed-lymphocyte reaction (AMLR) (Ly1+ 2,3- dependent) and the concanavalin A-induced suppressor cell activity (Ly1- 2,3+ dependent) remain intact. It is suggested that PGE preserves these T-cell functions by maintaining a more normal balance of T-cell subsets.

Mechanism of genetic resistance to Friend virus leukemia in mice. V. Relevance of Fv-3 gene in the regulation of in vivo immunosuppression.

Infection with the Friend murine leukemia virus complex (F-MuLV) suppressed humoral antibody synthesis in vivo and lymphocyte mitogenesis in vitro. Both these effects of F-MuLV were under host genetic control. In vitro suppression of lymphocyte mitogenesis was regulated by a single autosomal gene called Fv-3 that is dominant for susceptibility. Genetic analyses, with the use of the susceptible DBA/2 and resistant B10.D2/n parents, their F1, intercross, and backcross progeny, indicated that a single autosomal gene dominant for susceptibility regulated the in vivo susceptibility to immunosuppression by F-MuLV. Individual [(DBA/2xB10.D2)F1xB10.D2] mice were typed both for susceptibility to F-MuLV-induced suppression of lymphocyte mitogenesis in vitro (an Fv-3 function) and susceptibility to immunosuppression by F-MuLV in vivo. Such an analysis indicated that the same mice that were susceptible or resistant to immunosuppression in vivo were susceptible or resistant to suppression of lymphocyte mitogenesis in vitro. Spearman's rank analysis of the data also indicated that the in vivo and in vitro immunosuppressive effects of F-MuLV were correlated with and not independent of each other. Thus Fv-3, which regulates the effect of F-MuLV on lymphocytes in vitro, also appears to regulate the effect of F-MuLV on antibody-forming cells in vivo.