Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript.

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.

p38 MAPK signalling cascades in inflammatory disease.

Inflammatory mediators released during acute and chronic diseases activate multiple intracellular signalling cascades including the mitogen-activated protein kinase (MAPK) signal transduction pathway, which plays a significant role in the recruitment of leukocytes to sites of inflammation. Stimulation of leukocytes by pro-inflammatory cytokines is known to result in the activation of the MAPK isoform p38. However, the functional consequences of p38 MAPK activation during leukocyte recruitment, including adhesion, migration and effector functions such as oxidative burst and degranulation, are only just beginning to be elucidated. Specific p38 inhibitors aimed at reducing the production of inflammatory mediators are now being developed, and might in the future provide more effective treatment for inflammatory diseases.

MK: a pluripotential embryonic stem-cell-derived neuroregulatory factor.

MK is a gene encoding a secreted heparin-binding polypeptide originally isolated by differential screening for genes induced by retinoic acid (RA) in HM-1 embryonal carcinoma cells. Here we report that MK is expressed at high levels in both embryonal carcinoma and pluripotential embryonic stem cells and their differentiated derivatives. MK expression in these cell types is unaffected by the presence or absence of RA. Recombinant MK protein (rMK) was produced by transient expression in COS cells and purified by heparin affinity chromatography. rMK is a weak mitogen for 10T1/2 fibroblast cells but inactive as a mitogen for Swiss 3T3 fibroblasts. rMK is a potent mitogen for neurectodermal precursor cell types generated by treatment of 1009 EC cells with RA but has no mitogenic or neurotrophic effects on more mature 1009-derived neuronal cell types. rMK is active as an in vitro neurotrophic factor for E12 chick sympathetic neurons and its activity is markedly potentiated by binding the factor to tissue-culture plastic in the presence of heparin. Stable 10T1/2 cells lines have been established which express MK. These cells do not exhibit any overt evidence of cell transformation but extracellular matrix preparations derived from these cells are a potent source of MK biological activity. It is concluded that MK is a multifunctional neuroregulatory molecule whose biological activity depends upon association with components of the extracellular matrix.