Beet Soil-Borne Virus Is a Helper Virus for the Novel Beta vulgaris Satellite Virus 1A.

Sugar beet (Beta vulgaris) is grown in temperate regions around the world as a source of sucrose used for natural sweetening. Sugar beet is susceptible to a number of viral diseases, but identification of the causal agent(s) under field conditions is often difficult due to mixtures of viruses that may be responsible for disease symptoms. In this study, the application of RNAseq to RNA extracted from diseased sugar beet roots obtained from the field and from greenhouse-reared plants grown in soil infested with the virus disease rhizomania (causal agent beet necrotic yellow vein virus; BNYVV) yielded genome-length sequences from BNYVV, as well as beet soil-borne virus (BSBV). The nucleotide identities of the derived consensus sequence of BSBV RNAs ranged from 99.4 to 96.7% (RNA1), 99.3 to 95.3% (RNA2), and 98.3 to 95.9% (RNA3) compared with published BSBV sequences. Based on the BSBV genome consensus sequence, clones of the genomic RNAs 1, 2, and 3 were obtained to produce RNA copies of the genome through in vitro transcription. Capped RNA produced from the clones was infectious when inoculated into leaves of Chenopodium quinoa and B. vulgaris, and extracts from transcript-infected C. quinoa leaves could infect sugar beet seedling roots through a vortex inoculation method. Subsequent exposure of these infected sugar beet seedling roots to aviruliferous Polymyxa betae, the protist vector of both BNYVV and BSBV, confirmed that BSBV derived from the infectious clones could be transmitted by the vector. Co-inoculation of BSBV synthetic transcripts with transcripts of a cloned putative satellite virus designated Beta vulgaris satellite virus 1A (BvSat1A) resulted in the production of lesions on leaves of C. quinoa similar to those produced by inoculation with BSBV alone. Nevertheless, accumulation of genomic RNA and the encoded protein of the satellite virus in co-inoculated leaves was readily detected on Northern and Western blots, respectively, whereas no accumulation of satellite virus products occurred when satellite virus RNA was inoculated alone. The predicted sequence of the detected protein encoded by BvSat1A bears hallmarks of coat proteins of other satellite viruses, and virions of a size consistent with a satellite virus were observed in samples testing positive for the virus. The results demonstrate that BSBV is a helper virus for the novel satellite virus BvSat1A.

Differential Seasonal Prevalence of Yellowing Viruses Infecting Melon Crops in Southern California and Arizona Determined by Multiplex RT-PCR and RT-qPCR.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California's Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Natural Infection Rate of Known Tomato chlorosis virus-Susceptible Hosts and the Influence of the Host Plant on the Virus Relationship With Bemisia tabaci MEAM1.

Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) was identified in tomato crops in São Paulo State, Brazil, in 2006. Management strategies to control external sources of inoculum are necessary, because chemical control of the whitefly vector Bemisia tabaci Middle East-Asia Minor 1 (MEAM1) has not efficiently prevented virus infections and no commercial tomato varieties or hybrids are resistant to this crinivirus. We first evaluated the natural infection rate of some known wild and cultivated ToCV-susceptible hosts and their attractiveness for B. tabaci MEAM1 oviposition. Physalis angulata was the most susceptible to natural infection in all six exposures in 2018 and 2019. No plants of Capsicum annuum 'Dahra' or Chenopodium album became infected. Solanum melongena 'Napoli' had only two infected plants of 60 exposed. Capsicum annuum and Chenopodium album were the least preferred, and Nicotiana tabacum and S. melongena were the most preferred for whitefly oviposition. In addition, from 2016 to 2019, we surveyed different tomato crops and the surrounding vegetation to identify ToCV in weeds and cultivated plants in the region of Sumaré, São Paulo State. Only S. americanum, vila vila (S. sisymbriifolium), and Chenopodium album were found naturally infected, with incidences of 18, 20, and 1.4%, respectively. Finally, we estimated the ToCV titer (U.S. and Brazilian isolates ToCV-FL and ToCV-SP, respectively) by quantitative reverse transcription PCR in different ToCV-susceptible host plants and evaluated the relationship between virus acquisition and transmission by B. tabaci MEAM1. The results clearly showed significant differences in ToCV concentrations in the tissues of ToCV-susceptible host plants, which appeared to be influenced by the virus isolate. The concentration of the virus in plant tissues, in turn, directly influenced the ToCV-B. tabaci MEAM1 relationship and subsequent transmission to tomato plants. To minimize or prevent damage from tomato yellowing disease through management of external sources of ToCV, it is necessary to correctly identify potentially important ToCV-susceptible hosts in the vicinity of new plantings.