Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 69
Filtrar
1.
AME Case Rep ; 8: 57, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-39091546

RESUMEN

Background: Epithelioid angiomyolipoma (EAML), a subtype of angiomyolipoma, is distinct. It has a biologic behavior of borderline tumor, a malignant tendency, and a risk of metastasis and recurrence. Adrenal EAML is very rare. It is true that only six cases of adrenal EAML have been documented in the English-language literature. Case Description: A 65-year-old man who underwent a laparoscopic left adrenalectomy in July 2022 has adrenal EAML and this is a case report about it. The mass was surrounded by abundant blood vessels and adherence with surround-tissue. Postoperative pathology of the tumor analysis revealed adrenal epithelioid vascular smooth muscle lipoma. The patient underwent left upper abdomen and lumbar pain in July 2022. The enhanced computed tomography (CT) scan of the abdomen showed markedly enhanced masses in and around the left adrenal gland. A second left laparoscopic adrenalectomy was performed under general anesthesia. Postoperative pathology showed two taupe nodules of left adrenal, maximum diameter 0.9 to 1.1 cm. The postoperative pathological diagnosis in combination with immunohistochemistry was EAML. The patient was discharged 10 days later with symptomatic treatment with low molecular heparin. Conclusions: Adrenal EAML has a biologic behavior of borderline tumor with malignant potential and a risk of distant metastasis and recurrence. Therefore, radical surgical resection should be considered as its necessary treatment. Long-term postoperative follow-up is an important part of the treatment.

2.
Front Cell Infect Microbiol ; 14: 1392491, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-39211792

RESUMEN

Objective: This retrospective cohort study aimed to assess the clinical features, treatment outcomes, and short-term prognosis in kidney transplant recipients (KTRs) with concurrent coronavirus disease 2019 (COVID-19) pneumonia. Methods: KTRs with COVID-19 pneumonia who were admitted to our hospital from December 28, 2022, to March 28, 2023 were included in the study. Their clinical symptoms, responses to antiviral medications, and short-term prognosis were analyzed. Results: A total of 64 KTRs with initial diagnosis of COVID-19 pneumonia were included in this study. The primary symptoms were fever, cough, and myalgia, with an incidence of 79.7%, 89.1%, and 46.9%, respectively. The administration of antiviral drugs (paxlovid or molnupiravir) within 1-5 days and for over 5 days demonstrated a statistically significant reduction in viral shedding time compared to the group without antiviral medication (P=0.002). Both the paxlovid and molnupiravir treatment groups exhibited a significantly shorter duration of viral shedding time in comparison to the group without antiviral drugs (P=0.002). After 6 months of recovery, there was no significantly negative impact on transplant kidney function (P=0.294). Conclusion: Fever, cough, and myalgia remain common initial symptoms of concurrent COVID-19 pneumonia in KTRs. Early use of antiviral drugs (paxlovid or molnupiravir) is associated with better therapeutic outcomes. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) had a limited impact on the short-term renal function of the KTRs with concurrent moderate or severe COVID-19 pneumonia.


Asunto(s)
Antivirales , COVID-19 , Trasplante de Riñón , SARS-CoV-2 , Receptores de Trasplantes , Humanos , Trasplante de Riñón/efectos adversos , Estudios Retrospectivos , Masculino , Persona de Mediana Edad , Femenino , Antivirales/uso terapéutico , COVID-19/complicaciones , SARS-CoV-2/aislamiento & purificación , Resultado del Tratamiento , Adulto , Esparcimiento de Virus/efectos de los fármacos , Anciano , Pronóstico , Tratamiento Farmacológico de COVID-19
3.
J Agric Food Chem ; 2024 Jun 07.
Artículo en Inglés | MEDLINE | ID: mdl-38847536

RESUMEN

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

4.
Phys Chem Chem Phys ; 26(19): 14407-14419, 2024 May 15.
Artículo en Inglés | MEDLINE | ID: mdl-38712898

RESUMEN

The electrocatalytic carbon dioxide reduction reaction (CO2RR) presents a viable and cost-effective approach for the elimination of CO2 by transforming it into valuable products. Nevertheless, this process is impeded by the absence of exceptionally active and stable catalysts. Herein, a new type of electrocatalyst of transition metal (TM)-doped ß12-borophene (TM@ß12-BM) is investigated via density functional theory (DFT) calculations. Through comprehensive screening, two promising single-atom catalysts (SACs), Sc@ß12-BM and Y@ß12-BM, are successfully identified, exhibiting high stability, catalytic activity and selectivity for the CO2RR. The C1 products methane (CH4) and methanol (CH3OH) are synthesized with limiting potentials (UL) of -0.78 V and -0.56 V on Sc@ß12-BM and Y@ß12-BM, respectively. Meanwhile, CO2 is more favourable for reduction into the C2 product ethanol (CH3CH2OH) compared to ethylene (C2H4) via C-C coupling on these two SACs. More importantly, the dynamic barriers of the key C-C coupling step are 0.53 eV and 0.73 eV for the "slow-growth" sampling approach in the explicit water molecule model. Furthermore, Sc@ß12-BM and Y@ß12-BM exhibit higher selectivity for producing C1 compounds (CH4 and CH3OH) than C2 (CH3CH2OH) in the CO2RR. Compared with Sc@ß12-BM, Y@ß12-BM demonstrates superior inhibition of the competitive hydrogen evolution reaction (HER) in the liquid phase. These results not only demonstrate the great potential of SACs for direct reduction of CO2 to C1 and C2, but also help in rationally designing high-performance SACs.

5.
Materials (Basel) ; 17(7)2024 Mar 31.
Artículo en Inglés | MEDLINE | ID: mdl-38612118

RESUMEN

The matrix material used in this paper was low-density polyethene (LDPE), and the added particles selected were silicon oxide (SiO2) particles and montmorillonite (MMT) particles. The sizes of the SiO2 particles were 1 µm, 30 nm, and 100 nm, respectively; three kinds of SiO2/MMT/LDPE multi-component composites were prepared based on MMT/LDPE composites doped with MMT particles. The effect of the SiO2 particle size on the crystallization behavior and space charge properties of SiO2/MMT/LDPE composites was studied. The crystalline behaviors and crystallinity of the materials were analyzed. At the same time, the changes in the relative dielectric constant εr and loss factor tanδ for each material with the influence of frequency were studied, and the space charge accumulation, residual characteristics, and apparent charge mobility of each material were explored. The results show that the smaller the size of the added particles, the smaller the grain size and the clearer the grain outline for the multi-composite material. After adding 30 nm SiO2 particles, the crystallinity of the material increases significantly. The microstructure formed by the addition of 100 nm SiO2 particles effectively restricts molecular chain movement and makes it difficult to establish the polarization of the composite. The incorporation of large-size particles can reduce the proportion of the crystalline structure for the material as a whole, resulting in the formation of a new structure to promote charge transfer. Among the three kinds of SiO2 particles, the addition of 30 nm SiO2 particles can effectively suppress the space charge, and the composite material has the lowest residual space charge after depolarization. The addition of 100 nm SiO2 particles can cause the accumulation of many homopolar charges near the anode.

6.
Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi ; 38(4): 444-447, 2024 Apr 15.
Artículo en Chino | MEDLINE | ID: mdl-38632064

RESUMEN

Objective: To explore the effectiveness of transverse double "8"-shaped tension band technique in the treatment of Lawrence zoneⅠfracture of the 5th metatarsal base. Methods: Between February 2019 and October 2021, 15 patients with Lawrence zoneⅠfracture of the 5th metatarsal base were treated with transverse double "8"-shaped tension band technique. There were 8 males and 7 females, with a median age of 40 years (range, 23-59 years). The fractures were caused by sprains. The time from injury to operation was 3-7 days (mean, 4.1 days). X-ray films were taken to observe the fracture healing and the anchor looseness and detachment. The foot function was evaluated by American Orthopaedic Foot and Ankle Society (AOFAS) score, visual analogue scale (VAS) score, and the eversion angle of the calcaneal talus joint. Results: The incisions healed by first intention after operation in 14 cases and the incision healed poorly in 1 case. All patients were followed up 8-12 months (median, 10 months). The imaging examination showed that all fractures healed well, with a healing time of 10-14 weeks (mean, 11.7 weeks). At last follow-up, AOFAS score was 82-100 (median, 98); 13 cases were excellent and 2 cases were good, with an excellent and good rate of 100%. VAS score was 0-3 (median, 1). Three cases had mild limited ankle joint range of motion, while 12 cases had normal range of motion. The eversion angle of the calcaneal talus joint was 25°-32° (median, 30°). Conclusion: The application of transverse double "8"-shaped tension band technique for Lawrence zone Ⅰ fracture of the 5th metatarsal base has advantages such as simple operation, avoidance of secondary operation, and reduction of foreign body sensation, with definite effectiveness.


Asunto(s)
Fracturas Óseas , Huesos Metatarsianos , Herida Quirúrgica , Masculino , Femenino , Humanos , Adulto Joven , Adulto , Persona de Mediana Edad , Huesos Metatarsianos/cirugía , Fijación Interna de Fracturas/métodos , Resultado del Tratamiento , Fracturas Óseas/cirugía , Articulación del Tobillo/cirugía
7.
Anal Chem ; 96(18): 6947-6957, 2024 05 07.
Artículo en Inglés | MEDLINE | ID: mdl-38656889

RESUMEN

Life-threatening allergic reactions to food allergens, particularly peanut protein Ara h1, are a growing public health concern affecting millions of people worldwide. Thus, accurate and rapid detection is necessary for allergen labeling and dietary guidance and ultimately preventing allergic incidents. Herein, we present a novel ratiometric fluorescence aptasensor based on multivalent aptamer-encoded DNA flowers (Mul-DNFs) for the high-stability and sensitive detection of allergen Ara h1. The flower-shaped Mul-DNFs were spontaneously packaged using ultralong polymeric DNA amplicons driven by a rolling circle amplification reaction, which contains a large number of Ara h1 specific recognition units and has excellent binding properties. Furthermore, dual-color fluorescence-labeled Mul-DNFs probes were developed by hybridizing them with Cy3- and Cy5-labeled complementary DNA (cDNA) to serve as a ratiometric fluorescence aptasensor platform based on fluorescence resonance energy transfer. Benefiting from the combined merits of the extraordinary synergistic multivalent binding ability of Mul-DNFs, the excellent specificity of the aptamer, and the sensitivity of the ratiometric sensor to avoid exogenous interference. The developed ratiometric aptasensor showed excellent linearity (0.05-2000 ng mL-1) with a limit of detection of 0.02 ng mL-1. Additionally, the developed ratiometric fluorescence aptasensor was utilized for quantifying the presence of Ara h1 in milk, infant milk powder, cookies, bread, and chocolate with recoveries of 95.7-106.3%. The proposed ratiometric aptasensor is expected to be a prospective universal aptasensor platform for the rapid, sensitive, and accurate determination of food and environmental hazards.


Asunto(s)
Alérgenos , Antígenos de Plantas , Aptámeros de Nucleótidos , Transferencia Resonante de Energía de Fluorescencia , Proteínas de la Membrana , Aptámeros de Nucleótidos/química , Alérgenos/análisis , Antígenos de Plantas/análisis , Técnicas Biosensibles/métodos , ADN/química , Animales , Límite de Detección , Glicoproteínas/análisis , Glicoproteínas/química , Colorantes Fluorescentes/química , Proteínas de Plantas/análisis , Proteínas de Plantas/química
8.
Environ Res ; 251(Pt 2): 118689, 2024 Jun 15.
Artículo en Inglés | MEDLINE | ID: mdl-38493847

RESUMEN

The urban competitiveness (UC) evaluation system is multidimensional and complex. This paper takes the simulated annealing (SA) model as the projection pursuit (PP) optimization to achieve a comprehensive assessment of competitiveness of 277 Chinese cities from 2011 to 2019, accompanied by energy saving and carbon-emission reduction (ESCER) as environmental measurements, to explore whether the two can meet the Porter hypothesis through coupling coordination degree (CCD). Further using spatiotemporal autocorrelation and obstacle degree model to uncover spatiotemporal features and interfering factors of coordinated development. Key findings include: (1) UC and ESCER show a slightly fluctuating upward trend during the research period, with apparent spatial variations. The eastern coastal region has a robust UC, while the less competitive central and western regions benefit from natural conditions, excelling in ESCER. (2) 87% of cities have achieved coordinated development between competitiveness and ESCER. Some coastal areas, often with a high CCD, are improving resource use efficiency and environmental benefits through economic agglomeration. From the perspective of the CCD collaboration network, the positive correlation accounts for about 85%, which reveals that most adjacent regions can cooperate on the road of coordinated development. (3) While differences exist in the coordinated development of UC-ESCER across various regions, social factors predominantly influence the obstacles affecting coordinated development. Specifically, a substantial barrier to the concordant progression of most cities is the number of patent applications, underscoring the pivotal role of innovation in aligning UC with ESCER.


Asunto(s)
Ciudades , China , Carbono/análisis , Monitoreo del Ambiente/métodos , Modelos Teóricos
9.
Oncol Lett ; 27(4): 144, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38385107

RESUMEN

Clinically, programmed death-1 (PD-1) blockades have demonstrated promising therapeutic outcomes for patients with advanced non-small cell lung cancer (NSCLC). The present study aimed to examine the impact of programmed death-ligand 1 (PD-L1) polymorphism on clinical outcomes of patients with advanced NSCLC who were treated with PD-1 blockades therapy. The present study was designed as a retrospective analysis, where a consecutive screening of 89 patients with advanced NSCLC who received PD-1 blockades monotherapy were screened. Biological specimens were collected to determine the presence of polymorphism and PD-L1 mRNA expression through genotyping. The analysis focused on examining the relationship between the genotype status of PD-L1 polymorphism and clinical outcomes. Among the 89 patients with advanced NSCLC, the use of PD-1 blockades monotherapy resulted in objective response rate (ORR) of 22.5%, a median progression-free survival (PFS) of 3.4 months [95% Confidence Interval (CI): 1.80-5.00) and a median overall survival (OS) of 11.3 months (95% CI: 7.93-14.67). The analysis of polymorphism indicated that only rs2297136 had clinical significance. Among the 89 patients with NSCLC, the prevalence of rs2297136 was as follows: A total of 58 cases (65.2%) had the AA genotype, 28 cases (31.5%) had the AG genotype and 3 cases (3.4%) had the GG genotype. This resulted in a minor allele frequency of 0.19, which was in consistent with Hardy-Weinberg Equilibrium (P=0.865). The correlation analysis between genotype status of rs2297136 and clinical outcomes indicated that patients with the AA genotype had an ORR of 19.0%, while those with the AG/GG genotype had an ORR of 29.0% (P=0.278). Additionally, the median PFS for the AA genotype was 2.95 months, compared with 5.30 months for the AG/GG genotype (P=0.038). Accordingly, median OS of the AA and AG/GG genotypes was 8.8 and 18.4 months, respectively (P=0.011). The mRNA expression of PD-L1 was significantly higher in patients with AG/GG genotype compared with those with AA genotype (P<0.001). In clinical practice, PD-1 blockades demonstrated promising effectiveness in treating patients with advanced NSCLC. The presence of the rs2297136 variant in PD-L1 gene could potentially be used as a biomarker to predict the clinical outcomes of PD-1 blockades.

10.
BMC Endocr Disord ; 24(1): 23, 2024 Feb 20.
Artículo en Inglés | MEDLINE | ID: mdl-38374102

RESUMEN

BACKGROUND: Diabetic foot ulcers (DFUs) have become a global health concern, which can lead to diabetic foot infection (DFI), lower leg amputation, and even mortality. Though the standard of care (SOC) practices have been recognized as the "gold standard" for DFU care, SOC alone may not be adequate to heal all DFUs and prevent their recurrence. The use of dermal matrix has emerged as an adjuvant treatment to enhance DFU healing. The current study aimed to evaluate the effectiveness and safety of dermal matrix application as an adjuvant treatment to the SOC. METHODS: The databases of PubMed, Embase and CENTRAL were independently searched by two authors, with the following key terms: "diabetic foot ulcer", "acellular dermal matrix", "wound healing", and so on. Randomized controlled trials (RCTs) evaluated the efficacy and safety of dermal matrix in the treatment of DFUs were eligible for inclusion. The primary outcomes analyzed included time to complete healing and complete healing rate at the final follow-up, while secondary outcomes included wound area, ulcer recurrence rate, amputation risk and complication risk. Meta-analyses were performed using random-effect or fixed-effect models, based on the heterogeneity test. RESULTS: This study included a total of 15 RCTs with a total of 1524 subjects. Of these, 689 patients were treated with SOC alone, while 835 patients received SOC plus dermal matrix. Compared to the SOC group, significantly shorter time (MD = 2.84, 95%CI: 1.37 ~ 4.32, p < 0.001***) was required to achieve complete healing in dermal matrix group. Significantly higher complete healing rate (OR = 0.40, 95%CI: 0.33 ~ 0.49, p < 0.001***) and lower overall (RR = 1.83, 95%CI: 1.15 ~ 2.93, p = 0.011*) and major (RR = 2.64, 95%CI: 1.30 ~ 5.36, p = 0.007**) amputation risks were achieved in dermal matrix group compared to SOC group. No significant difference was found in the wound area, ulcer recurrence rate, and complication risk between the two groups. CONCLUSIONS: The application of dermal matrix as an adjuvant therapy in conjunction with SOC effectively improved the healing process of DFUs and reduced the amputation risk when compared to SOC alone. Furthermore, dermal matrix application was well tolerated by the subjects with no added complication risk.


Asunto(s)
Pie Diabético , Cicatrización de Heridas , Humanos , Dermis Acelular , Amputación Quirúrgica , Pie Diabético/terapia , Ensayos Clínicos Controlados Aleatorios como Asunto , Resultado del Tratamiento
11.
Xenotransplantation ; 31(2): e12818, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-37529830

RESUMEN

BACKGROUND: Xenoantigens other than Gal, Neu5Gc, and Sda may be playing a role in pig graft rejection. We investigated the incidence of antibodies to unknown pig xenoantigen in different human groups. METHODS: We collected blood from TKO/hCD55 pigs (n = 3), and isolated PBMCs and RBCs. Serum samples were collected from (i) healthy human volunteers (n = 43), (ii) patients with end-stage renal disease (ESRD) (n = 87), (iii) the same patients after kidney allotransplantation (n = 50), and (iv) renal allotransplant recipients experiencing T cell-mediated rejection (allo-TCMR, n = 10). The sera were initially incubated with TKO/hCD55 pRBCs (1 × 108 cells) for 1 h to absorb anti-pig antibodies (except against SLA and possibly other antigens not expressed on pRBCs) and then the serum (absorbed or unabsorbed) was tested for antibody binding and complement-dependent cytotoxicity (CDC) to TKO/hCD55 pig PBMCs. RESULTS: A significant reduction in IgM/IgG binding and CDC was observed in the absorbed sera. Serum obtained before and after renal allotransplantation showed no significant difference in IgM or IgG binding to, or in CDC of, TKO/hCD55 pig cells. IgM antibodies (but rarely IgG) against unknown xenoantigens expressed on TKO/hCD55 PBMCs, possibly against swine leukocyte antigens, were documented in healthy humans, patients with ESRD, and those with renal allografts undergoing acute T cell rejection. IgM (but not CDC) was higher in patients experiencing allo-TCMR. CONCLUSION: Human sera contain IgM antibodies against unknown pig xenoantigens expressed on TKO/hCD55 pPBMCs. Although not confirmed in the present study, the targets for these antibodies may include swine leukocyte antigens.


Asunto(s)
Antígenos Heterófilos , Fallo Renal Crónico , Animales , Humanos , Porcinos , Animales Modificados Genéticamente , Incidencia , Trasplante Heterólogo , Inmunoglobulina M , Inmunoglobulina G , Antígenos HLA , Rechazo de Injerto
12.
Immunobiology ; 228(6): 152764, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-38043261

RESUMEN

Basic fibroblast growth factor (bFGF) stimulates angiogenesis, influencing the proliferation, migration, and survival of tumour cells, which have pivotal roles in tumour progression. This study investigated the prognostic significance of bFGF expression in lung adenocarcinoma treated with bevacizumab. The expression levels of bFGF were assessed in bevacizumab-treated patients with lung adenocarcinoma using immunohistochemistry. Propensity score matching (PSM) analysis was performed to evaluate prognostic potential. bFGF expression was also investigated in another independent cohort of patients with lung adenocarcinoma treated with routinechemotherapy. We also compared the PSM value of bFGF expression levels independently and in combination with epidermal growth factor receptor and vascularendothelial growth factor expression levels. A high bFGF expression level was found to be an independent prognostic factor for disease-free survival in patients receiving bevacizumab-based chemotherapy. Similar results were not observed in patients who underwent routinechemotherapy. In conclusion, the bFGF expression level may be a clinically feasible prognostic marker and bFGF is a potential therapeutic target for patients with lung adenocarcinoma receiving routinechemotherapy.


Asunto(s)
Adenocarcinoma del Pulmón , Neoplasias Pulmonares , Humanos , Bevacizumab/uso terapéutico , Neoplasias Pulmonares/diagnóstico , Neoplasias Pulmonares/tratamiento farmacológico , Neoplasias Pulmonares/metabolismo , Pronóstico , Factor 2 de Crecimiento de Fibroblastos , Adenocarcinoma del Pulmón/tratamiento farmacológico , Biomarcadores
13.
Environ Sci Pollut Res Int ; 30(57): 120188-120206, 2023 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-37936039

RESUMEN

It is an important way for mining the characteristics of regional carbon emission efficiency and exploring regional similarity to learn from intergovernmental learning mechanisms and regional industrial low-carbon development experiences. This study proposes a regional learning mechanism of industrial carbon emission efficiency (ICEE) prediction and regional similarity analysis to explore strategies for carbon emission reduction. We first calculated the industrial carbon emission efficiency of 30 provinces in China from 2000 to 2021 using the super-SBM model. Secondly, the spatiotemporal characteristics of industrial carbon emission efficiency were explored through the space-time cube model, time series clustering method, and local outlier analysis. Finally, the screening of regions with low efficiency levels and the search for learning objects were realized by forest regression prediction and regional similarity calculation. The results of the study were as follows: (1) There were significant differences in industrial carbon emission efficiency among different provinces. (2) Based on the time series clustering results, we found that there were similar change characteristics of industrial carbon emission efficiency in different provinces. (3) The industrial carbon emission efficiency of most provinces had significant correlation in space and time, mainly in high-high clustering. (4) The industrial carbon emission efficiency of most regions will maintain a high efficiency level in the next 10 years, but the six provinces of Xinjiang, Qinghai, Gansu, Ningxia, Liaoning, and Heilongjiang will always be at a low efficiency level. It is possible to set appropriate learning targets for each region and to find lessons to be learned from the regions with high similarity by calculating the similarity between each province and the six provinces.


Asunto(s)
Carbono , Industrias , Carbono/análisis , China , Desarrollo Industrial , Eficiencia , Desarrollo Económico
14.
Environ Sci Pollut Res Int ; 30(53): 114201-114221, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37853222

RESUMEN

Exploring the coupling coordination between China's digital economy (DE) and industrial carbon emission efficiency (ICEE) is of great significance for achieving sustainable development goals. In the study, a multidimensional indicator system was established to evaluate DE, and spatiotemporal analysis and network analysis methods were used to reveal the dynamic evolution characteristics of DE and ICEE. The coupling coordination model and convergence model were adopted to explore the development trend of coupling coordination between DE and ICEE. The results show that the ICEE and DE in various provinces of China exhibit obvious spatial heterogeneity and spillover effects. Currently, the coupling coordination degree between the development of China's DE and ICEE has reached the level of primary coordination or above. The coupling coordination degree between DE and ICEE in the eastern, central, and northeastern regions has reached an intermediate level or above, with the highest degree in the eastern region. The fluctuation of China's ICEE has consistent σ-convergence and ß-convergence, and the convergence effect is higher with the introduction of the DE than without it. The condition ß-convergence result indicates that underdeveloped regions can narrow the gap between their ICEE and that of developed regions by utilizing their resource endowments, industrial structure, human capital, and other conditions, improving emission reduction measures and policies. This study provides a certain reference for the green and low-carbon development of industry in China and other developing countries in the digital economy era.


Asunto(s)
Carbono , Industrias , Humanos , China , Políticas , Análisis Espacio-Temporal , Desarrollo Económico
15.
J Environ Manage ; 348: 119374, 2023 Dec 15.
Artículo en Inglés | MEDLINE | ID: mdl-37871547

RESUMEN

As carbon emission continue to rise and climate issues grow increasingly severe, countries worldwide have taken measures to reduce carbon emission. However, carbon dioxide is continuously flowing in the atmosphere and is easily influenced by neighboring cities' policies. Therefore, how to solve the problem of carbon emission spillover effect has become the key to improve policy efficiency. Cross-regional carbon governance provides a perspective on solving the carbon emission problem by regulating and guiding the cooperative behavior of cross-regional governance actors. Taking Chengdu-Chongqing area as an example, this study used the SDM to analyze the influencing factors and spatial spillover effects of emission. Then we used the system dynamics method to construct a dual-core carbon emission system, and simulated the spillover effect and emission reduction potential of Chengdu and Chongqing emission reduction policies under different policy schemes. The results reveal that the mobility of population and enterprises have a significant impact on carbon emission prediction. Carbon reduction policies exhibit the phenomena of "carbon transfer" and "free-riding." When Chengdu lowers its economic growth rate, it leads to the transfer of high energy-consuming enterprises to Chongqing, increasing carbon emission in Chongqing. The implementation of comprehensive carbon reduction policies in Chongqing has a positive effect on Chengdu. Emission reduction policies exhibit issues related to their temporal efficacy, as the effects of industrial structural policies in Chengdu yield opposite outcomes in the short and long term. Each city's unique circumstances necessitate tailored carbon reduction policies. In order to reduce carbon emissions, Chengdu and Chongqing require opposite population policies.


Asunto(s)
Atmósfera , Política Pública , Dióxido de Carbono , Ciudades , Clima , Desarrollo Económico , China
16.
Environ Sci Pollut Res Int ; 30(46): 102402-102417, 2023 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-37665440

RESUMEN

Global climate continues to warm; by reducing carbon emission (CE) to cope with climate warming has become a global consensus. The influencing factors of CE exhibit diversification and spatial characteristics, and the complexity of the CE system poses challenges to green and low-carbon development and the realization of China's dual-carbon goals. Taking the Pearl River Delta urban agglomeration as an example, this study explored the influencing factors of CE and designed emission reduction schemes with the help of multi-scale geographically weighted regression (MGWR). Based on this, the system dynamics model was used to construct a CE system framework considering multi-dimensional driving factors, so as to combine the complex CE system with the emission reduction countermeasures considering spatial heterogeneity, and realize the dynamic simulation of CE reduction policies. The results showed that the urban agglomeration as a whole will reach carbon peak by 2025. Shenzhen, Zhuhai, and Dongguan have achieved carbon peak before 2020, while other cities will reach carbon peak by 2025-2030. The government policy constraints can effectively curb CE, but if government constraints were relaxed, CE will rise and individual cities will not reach carbon peak. Comprehensive CE reduction policies are better than a single CE reduction policy. The study found that this model framework provides a systematic analysis of carbon reduction strategies for urban agglomerations, offering decision-makers various combinations of economic development and green low-carbon objectives. This will further contribute to a multi-faceted mitigation of high emission in urban agglomeration and promote regional sustainable development.

17.
PLoS One ; 18(8): e0290301, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37603567

RESUMEN

As a natural ecological fragile region, the vast desert steppe in the Inner Mongolia has a developed animal husbandry, and thus posed great impacts on soil quality. In order to accurately evaluate the current situation of soil quality in the desert steppe, it is therefore imperative to adopt a suitable method to effectively assess the soil quality in the region. In this study, the minimum data set (MDS) was established with the help of principal component analysis, Norm value calculation, and correlation analysis, and four indicators, including organic matter, sand grains, soil erosion degree, and pH, were established to evaluate the soil quality of the desert steppe in the Siziwang Banner, a county in the Inner Mongolia. The results from the minimum data set (MDS) method were validated based on the total data set (TDS) method, and the validation indicated that the MDS method can be representative of the soil quality of the study area. The results indicated: 1) the soil quality index (SQI) of 0-30 cm in more than 90% of the study area falls in the range of 0.4 and 0.6 (medium level), while the better level (SQI ≥0.6) only accounted less than 10% of the study area; 2) For the MDS indexes, soil organic matter content at all depths decreased in the southern mountains, central hills, and northern plateau, which is consistent with the changing trends of SQI; 3) The sand grain was the dominant particle in the study region, which was in accordance with the intense wind erosion; 4) The negative correlation was found between the soil pH value and SQI (the high value in pH corresponded to the low value in SQI), which reflected that soil pH has a more stressful effect on the local vegetation. Overall, the MDS indexes in this study can objectively and practically reflect the soil quality in the study area, which can provide a cost effective method for SQI assessment in the desert steppe, which is important for the further grassland ecological construction and grassland management to improve the soil quality in the desert steppes.


Asunto(s)
Arena , Suelo , Animales , Erosión del Suelo , Crianza de Animales Domésticos , China
18.
Front Cell Infect Microbiol ; 13: 1115268, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-36816584

RESUMEN

We reported a 31-year-old man who received renal transplantation for more than 2 years. He was admitted to our hospital on 9 March 2022 due to intermittent diarrhea accompanied by leukopenia for more than 1 month. The patient successively developed high fever, cough, anemia, weight loss, gastrointestinal bleeding, and liver function impairment. Computed tomography (CT) revealed a slight inflammation in the lower lobes of both lungs, enlargement of the lymph nodes in the retroperitoneal and the root of mesenteric areas, and hepatosplenomegaly. Talaromyces marneffei was detected by metagenomics next-generation sequencing (mNGS) in blood and bronchoalveolar lavage fluid, and the pathogen was subsequently verified by blood culture. After endoscopic hemostatic therapy and antifungal therapy with voriconazole and amphotericin B cholesteryl sulfate complex, the patient was successfully discharged. Oral voriconazole was given regularly after discharge. Diarrhea, fever, enlargement of the lymph nodes, and endoscopic evidence of erosion may indicate intestinal T. marneffei infection. Although the mortality of T. marneffei infection after renal transplantation is very high, timely and effective antifungal therapy with amphotericin B cholesteryl sulfate complex is still expected to improve its prognosis.


Asunto(s)
Antifúngicos , Trasplante de Riñón , Masculino , Humanos , Adulto , Antifúngicos/uso terapéutico , Anfotericina B , Voriconazol
19.
Front Plant Sci ; 14: 1101665, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-36794222

RESUMEN

Introduction: Plant-specific Class III peroxidases (PRXs) play a crucial role in lignification, cell elongation, seed germination, and biotic and abiotic stresses. Methods: The class III peroxidase gene family in sugarcane were identified by bioinformatics methods and realtime fluorescence quantitative PCR. Results: Eighty-two PRX proteins were characterized with a conserved PRX domain as members of the class III PRX gene family in R570 STP. The ShPRX family genes were divided into six groups by the phylogenetic analysis of sugarcane, Saccharum spontaneum, sorghum, rice, and Arabidopsis thaliana. The analysis of promoter cis-acting elements revealed that most ShPRX family genes contained cis-acting regulatory elements involved in ABA, MeJA, light responsiveness, anaerobic induction, and drought inducibility. An evolutionary analysis indicated that ShPRXs was formed after Poaceae and Bromeliaceae diverged, and tandem duplication events played a critical role in the expansion of ShPRX genes of sugarcane. Purifying selection maintained the function of ShPRX proteins. SsPRX genes were differentially expressed in stems and leaves at different growth stages in S. spontaneum. However, ShPRX genes were differentially expressed in the SCMV-inoculated sugarcane plants. A qRT-PCR analysis showed that SCMV, Cd, and salt could specifically induce the expression of PRX genes of sugarcane. Discussion: These results help elucidate the structure, evolution, and functions of the class III PRX gene family in sugarcane and provide ideas for the phytoremediation of Cd-contaminated soil and breeding new sugarcane varieties resistant to sugarcane mosaic disease, salt, and Cd stresses.

20.
Environ Sci Pollut Res Int ; 30(3): 6875-6890, 2023 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-36008585

RESUMEN

The Pearl River Basin (PRB) is a significant area for economic development (ED) and ecological protection in China. Studying the relationship between carbon emission (CE) and ED is crucial for China and the world to cope with climate change and achieve CO2 reduction. For 48 cities in the PRB, we used the coupling coordination model and geographically weighted regression model to analyze the coupling coordination degree (CCD) between CE and ED and investigate the main influencing factors. The results suggested that (1) the CCD presents spatial heterogeneity, with the Pearl River Delta having the highest value and the middle reaches having the lowest value; (2) the coupling coordination type between CE and ED changes from incoordination to coordination in general; and (3) the resident income and population size have a positive influence on the CCD of the cities in the lower reaches, while the secondary industry scale has a beneficial impact on the upstream. Finally, we put forward corresponding policy suggestions to achieve sustainable development in terms of reducing economic inequities, enhancing public expenditure and innovation capability, and streamlining the industrial structure.


Asunto(s)
Desarrollo Económico , Ríos , China , Carbono , Ciudades
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA