Long-term trends in cycle threshold values: a comprehensive analysis of COVID-19 dynamics, viral load, and reproduction number in South Korea.

Background: With the emergence of COVID-19 cases, governments quickly responded with aggressive testing, contact tracing, isolation and quarantine measures. South Korea's testing strategy primarily relied on real-time reverse-transcriptase polymerase chain reaction (real-time RT-PCR), focusing on cycle threshold (Ct) values, indicative of viral load, to determine COVID-19 positivity. This study examined the long-term time series distribution of Ct values measured in the same laboratory using a nationally standardized testing type and sampling method in South Korea. It aimed to link Ct values, new COVID-19 cases, and the reproduction number (Rt), setting the stage for using Ct values effectively. Methods: This study analyzed nationally collected 296,347 samples Ct values from February 2020 to January 2022 and examined their associations with the number of new cases and Rt trends. The data were categorized into four COVID-19 periods for in-depth analysis. Statistical methods included time series trend analysis, local regression for smoothing, linear regression for association analysis, and calculation of correlation coefficients. Results: The median Ct values across four COVID-19 periods decreased gradually from 31.71 in the initial period to 21.27 in the fourth period, indicating higher viral load. The comparison of trends between Ct values and the number of new cases revealed that the decline in Ct values preceded the surge in new cases, particularly evident during the initial stages when new cases did not undergo a significant increase. Also, during variant emergence and vaccination rollout, marked shifts in Ct values were observed. Results from linear regression analysis revealed a significant negative relationship between Ct values and new cases (ß = -0.33, p < 0.001, R 2 = 0.67). This implies that as Ct values decrease, new case numbers increase. Conclusion: This study demonstrates the potential of Ct values as early indicators for predicting confirmed COVID-19 cases during the initial stages of the epidemic and suggests their relevance in large-scale epidemic monitoring, even when case numbers are similar.

Utilization of the Unlinked Case Proportion to Control COVID-19: A Focus on the Non-pharmaceutical Interventional Policies of the Korea and Japan.

OBJECTIVES: Korea and Japan have managed the spread of coronavirus disease 2019 (COVID-19) using markedly different policies, referred to as the "3T" and "3C" strategies, respectively. This study examined these differences to assess the roles of active testing and contact tracing as non-pharmaceutical interventions (NPIs). We compared the proportion of unlinked cases (UCs) and test positivity rate (TPR) as indicators of tracing and testing capacities. METHODS: We outlined the evolution of NPI policies and investigated temporal trends in their correlations with UCs, confirmed cases, and TPR prior to the Omicron peak. Spearman correlation coefficients were reported between the proportion of UCs, confirmed cases, and TPR. The Fisher r-to-z transformation was employed to examine the significance of differences between correlation coefficients. RESULTS: The proportion of UCs was significantly correlated with confirmed cases (r=0.995, p<0.001) and TPR (r=0.659, p<0.001) in Korea and with confirmed cases (r=0.437, p<0.001) and TPR (r=0.429, p<0.001) in Japan. The Fisher r-to-z test revealed significant differences in correlation coefficients between the proportion of UCs and confirmed cases (z=16.07, p<0.001) and between the proportion of UCs and TPR (z=2.12, p=0.034) in Korea and Japan. CONCLUSIONS: Higher UCs were associated with increases in confirmed cases and TPR, indicating the importance of combining testing and contact tracing in controlling COVID-19. The implementation of stricter policies led to stronger correlations between these indicators. The proportion of UCs and TPR effectively indicated the effectiveness of NPIs. If the proportion of UCs shows an upward trend, more testing and contact tracing may be required.

The Impact of Public Transfer Income on Catastrophic Health Expenditures for Households With Disabilities in Korea.

OBJECTIVES: Previous studies have reported that people with disabilities are more likely to be impoverished and affected by excessive medical costs than people without disabilities. Public transfer income (PTI) reduces financial strain in low-income households. This study examined the impact of PTI on catastrophic health expenditures (CHE), focusing on low-income households and households with Medical Aid beneficiaries that contained people with disabilities. METHODS: We constructed a panel dataset by extracting data on registered households with disabilities from the Korea Welfare Panel Study 2012-2019. We then used a generalized estimating equation model to estimate the impacts of PTI on CHE. A subgroup analysis was carried out to assess the moderating effects of family income levels and health insurance types. RESULTS: As PTI increased, the odds ratio (OR) of CHE in households that contained people with disabilities decreased significantly (OR, 0.92; 95% confidence interval [CI], 0.89 to 0.94; p<0.001). In particular, PTI effectively reduced the likelihood of CHE for low-income households (OR, 0.85; 95% CI, 0.81 to 0.89; p<0.001) and those who received medical benefits (OR, 0.78; 95% CI, 0.68 to 0.89; p<0.001). CONCLUSIONS: This study highlights the positive effect of PTI on decreasing CHE. Household income and the health insurance type were significant effect modifiers, but economic barriers seemed to persist among low-income households with non-Medical Aid beneficiaries. Federal policies or programs should consider increasing the total amount of PTI targeting low-income households with disabilities that are not covered by the Medical Aid program.

The Impact of Household Economic Deterioration Caused by the COVID-19 Pandemic and Socioeconomic Status on Suicidal Behaviors in Adolescents: A Cross-sectional Study Using 2020 Korea Youth Risk Behavior Web-based Survey Data.

OBJECTIVES: Economic hardship has a serious impact on adolescents' mental health. The financial impact of the coronavirus disease 2019 (COVID-19) pandemic was more severe for low-income families, and this also impacted adolescents. This study aimed to examine the associations of economic deterioration (ED) caused by the COVID-19 pandemic and low socioeconomic status (SES) with adolescents' suicidal behaviors. METHODS: This study analyzed data from the 2020 Korea Youth Risk Behavior Web-based Survey, which included 54 948 middle and high school students. Odds ratios (ORs) of suicidal ideation, suicidal planning, and suicide attempts related to ED and SES were calculated using multivariable logistic regression. We calculated relative excess risks due to interaction to assess additive interactions. RESULTS: The ORs for suicidal ideation, suicidal planning, and suicide attempts related to combined severe ED and low SES were 3.64 (95% confidence interval [CI], 3.13 to 4.23), 3.88 (95% CI, 3.09 to 4.88), and 4.27 (95% CI, 3.21 to 5.69), respectively. CONCLUSIONS: ED and low SES were significantly associated with suicidal behaviors in adolescents. Although no significant additive interaction was found, the ORs related to suicidal ideation, suicidal planning, and suicide attempts were highest among adolescents from low-income families with severe ED. Special attention is needed for this group, considering the increased impact of economic inequality due to the COVID-19 pandemic.

The Effect of Bright Light Therapy on Sleep and Quality of Life in Patients With Poststroke Insomnia.

OBJECTIVE: Poststroke insomnia is common and negatively affects stroke recovery. The objective of this study was to determine the effectiveness of bright light therapy for mild-to-moderate stroke patients with insomnia. METHODS: This study was randomized, double blind, and placebo controlled. A 2-week trial was conducted on patients with mild-to-moderate stroke who had poststroke insomnia. Only patients who had experienced a first episode of stroke were enrolled in this study. Sleep parameters were measured using the Actiwatch Spectrum Pro for 7 days before and after light therapy. The instrument specifically collected data concerning sleep, mood state, fatigue, and subjective quality of life. Participants with poststroke insomnia received bright light therapy (10,000 lux) or placebo therapy for 30 minutes in the early morning. A total of 112 eligible participants entered the study, but only 56 patients were randomized to treatment (27 to bright light therapy and 29 to placebo therapy). RESULTS: Results from analysis of variance showed that the mean change of sleep latency (F(1,55) =4.793, p = .033) and sleep efficiency (F(1,55) = 5.625, p = .022) were significantly superior in bright light therapy over placebo. Bright light therapy resulted in significant improvements in daytime sleepiness, fatigue, mood, and quality of life in study participants (p < .05). CONCLUSIONS: Bright light therapy is a nonpharmacological treatment of early, poststroke insomnia in patients who had a mild to moderate stroke. In addition, bright light therapy is effective for the treatment of daytime sleepiness, fatigue, and depression and for improving quality of life in patients with poststroke insomnia. TRIAL REGISTRATION: ClinicalTrials.gov Identifier: NCT04721574.

Important Consideration in Choosing Antipsychotics in the Treatment of Patients with 22q11.2 Deletion Syndrome: Risk of Convulsion.

The prevalence of epilepsy and psychosis in 22q11.2 deletion syndrome (22q11.2DS) is higher than in the general population. Recent study on adults with 22q11.2DS reported that the most common trigger for provoked seizures was the use of antipsychotics and antidepressants. In this paper, blonaserin was used because aripiprazole, quetiapine, paliperidone were not effective. The patient had convulsion on the fourth day of taking blonaserin. Neurological and cardiac examination was carried out, and lamotrigine was added at the advice of neurologist. Than the patient didn't have any convulsions and the symptoms gradually improved. When treating patients with 22q11.2DS, the medicine should be chosen carefully, and the patient should be observed closely, paying attention to the possibility of convulsions.

Low-dose Quetiapine-induced Syndrome of Inappropriate Antidiuretic Hormone in a Patient with Traumatic Brain Syndrome.

Syndrome of inappropriate antidiuretic hormone secretion (SIADH) is characterized by hyponatremia, low serum osmolality, and clinical euvolemia in the absence of diuretic medication. And the causes of SIADH are various, antipsychotic agents and traumatic brain injury (TBI) are well known. Quetiapine is often chosen to manage the maladaptive behavior of patients with post-TBI. Although a previous study reported that quetiapine doses ranging from 25 to 300 mg were effective and tolerable, the symptoms of the patient might be aggravated. The symptoms of TBI such as nausea, malaise, headache, lethargy, and mild cognitive deficits are similar to those of SIADH. So the differentiation between SIADH and TBI may be difficult. This paper reports a case of SIADH in a patient with a TBI after using a small dose of 25 to 50 mg quetiapine.

Objective and subjective sleep problems and quality of life of rehabilitation in patients with mild to moderate stroke.

Objective: The principal objectives of this study were to investigate relationships between objective sleep parameters, that is, sleep onset latency, wake after sleep onset, number of awakenings, sleep efficiency, and sleep duration, and quality of life after mild to moderate stroke.Methods: The subjects were 112 first-time mild to moderate stroke patients admitted to a rehabilitation unit. Physical functions, depression, anxiety, quality of life, subjective insomnia, quality of sleep, and fatigue were assessed at about 20 days after stroke. Objective sleep parameters were also assessed using a wrist-worn Actiwatch.Results: Patients with insomnia had greater sleep onset latencies (p = .001), wake after sleep onset (p = .005), awoke more frequently (p = .013), and slept less efficiency (p < .001) than patients without insomnia, but total sleep durations were similar. In all participants, lower overall domain of quality of life was significantly associated with sleep onset latency (p = .009), and total insomnia severity index (p < .001), total Epworth Sleepiness Scale (p < .001), the National Institute's Health Stroke Scale (p = .004), the Modified Barthel Index (p = .034), and Screening Tests for Aphasia and Neurologic-Communication Disorders (p = .044) scores.Conclusion: Objective sleep parameters (sleep onset latency and sleep efficiency) were found to be associated with quality of life during the early stage of rehabilitation in mild to moderate stroke patients.

The expression pattern of OsDim1 in rice and its proposed function.

Development of plant tissues is dependent on numerous factors, including hormone activity, signaling, cell division, and elongation. In plants, Defective Entry into Mitosis 1 (Dim1) homologs are recognized as pivotal in leaf senescence and progress of normal growth, but their role in rice has not been functionally characterized. The findings presented in this paper suggest that OsDim1 is important in early seedling development, pollen tube elongation, and impacts rice yield components. The gene is expressed in the scutellum, endosperm, embryonic root, shoot, pollen grains and tubes, as well as in several organs of the rice flower. According to the present study findings, RNAi mediated knockdown of OsDim1 resulted in phytohormonal imbalance, reduced amylase activity, affected differentiation of embryonic root elongation zone tissues, suppressed embryonic root and shoot growth, and impaired pollen tube elongation. In contrast, overexpression of OsDim1 showed significant growth in embryonic roots and shoots, while it increased culm length, total number of tillers per plant, seed setting rate, and total number of grains per panicle compared to its wild type line. In summary, we propose OsDim1 plays an important role in seedling growth and pollen tube elongation, and has pleiotropic effects on reproductive tissues.

The Influence of Depression and School Life on the Quality of Life of Korean Child and Adolescent Patients with Attention-Deficit/Hyperactivity Disorder:A Comparison of the Perspectives of the Patients and Their Caregivers.

OBJECTIVES: This study aimed to compare the quality of life reported by patients with attention-deficit/hyperactivity disorder (ADHD) to the patients' quality of life as reported by their caregivers. In addition, it aimed to examine how emotional problems, including depression and anxiety, and the severity of the symptoms affect the quality of life reported by the patients and their caregivers. METHODS: The patients' quality of life and their degree of depression and anxiety were measured using the Pediatric Quality of Life Inventory (PedsQL) 4.0 Child Self-Report, the Children's Depression Inventory (CDI), and the Revised Children's Manifest Anxiety Scale, respectively. The caregivers' perception of the patients' quality of life and severity of the ADHD symptoms were measured using the PedsQL 4.0 Parent Proxy Report and the Conners' Parent Rating Scale (CPRS), respectively. A total of 66 participants completed the survey. The independent-samples t-test, Pearson's correlation analysis, and multiple regression analysis were conducted. RESULTS: The mean score of the PedsQL 4.0 Child Self-Report was significantly higher than the mean score of the PedsQL 4.0 Parent Proxy Report. However, for school function, the PedsQL 4.0 Child Self-Report score was significantly lower than that of Parent Proxy Report. The correlation between the PedsQL 4.0 Child Self-Report and PedsQL 4.0 Parent Proxy Report scores was significant only for emotional function and social function. The multiple regression analysis showed that the PedsQL 4.0 Child Self-Report and PedsQL 4.0 Parent Proxy Report scores were significantly predicted by the CDI and CPRS scores, respectively. CONCLUSION: Our results demonstrate that there are clear differences between the quality of life reported by the patient themselves and that reported by their caregivers. In addition, the findings suggest that it is critical to treat the patients' accompanying depressive symptoms.

Deoxypodophyllotoxin inhibits the expression of intercellular adhesion molecule-1 induced by tumor necrosis factor-alpha in murine lung epithelial cells.

Intercellular adhesion molecule-1 (ICAM-1) is associated with processes of inflammation. We investigated the effects of deoxypodophyllotoxin (DPT) on tumor necrosis factor-alpha (TNF-alpha) induced ICAM-1 expression in the mouse lung epithelial cell line, LA4. DPT (5 to 20 nM) inhibited TNF-alpha-induced ICAM-1 expression through nuclear factor-kappa B (NF-kappaB) in a dose-dependent manner and repressed ICAM-1 promoter activity. NF-kappaB reporter gene activity and DNA binding activity were also strongly inhibited. In addition, DPT inhibited degradation by the TNF-alpha induced inhibitory kappaB-alpha (IkappaB-alpha) in a concentration-dependent manner. Taken together with our previous results suggest DPT might provide a basis for novel anti-inflammatory drug development.

Effect of dexamethasone on STAT6-dependent Ym1/2 expression in vivo and in vitro.

Ym1 and Ym2 (Ym1/2) are chitinase-like proteins and we reported previously that IL-4 induced Ym1/2 in mouse bone marrow-derived mast cells. In the present study, ovalbumin-induced asthmatic mice were used to investigate the effect of glucocorticoids on Ym1/2 expression. Ym1/2 were highly induced in bronchoalveolar lavage fluid (BALF) and the lung. Ym1/2 expression was completely inhibited by dexamethasone (Dex) in BALF and weakly inhibited in the lung. Primary cultured macrophages were used to investigate the inhibition of Ym1/2 expression at the cellular level. Although Dex pretreatment inhibited the Ym1/2 expression level in an animal model, it did not reduce IL-4 induction of Ym1/2 expression in vitro. Next, we tested whether Dex blocks IL-4 induced STAT6 signaling and found that it had no inhibitory effect on the phosphorylation level of STAT6 in macrophages. The luciferase reporter assay also revealed that Dex did not inhibit IL-4 induction of Ym1/2 promoter activity. These results indicate that the inhibitory effect of Dex on Ym1/2 protein expression in the murine model of asthma does not involve the STAT6 signaling pathway.

Identification of inducible genes during mast cell differentiation.

Mast cells play an important role in allergic inflammation by releasing their bioactive mediators. The function of mast cells is enhanced by stimulation because of the induction of specific genes and their products. While many inducible genes have been elucidated, we speculated that a significant number of genes remain to be identified. Thus, we applied differential display (dd) PCR to establish a profile of the induced genes in bone marrow-derived mast cells (BMMCs) after they were co-cultured with 3T3 fibroblasts. To date, 150 cDNA fragments from the connective-type mast cells (CTMCs) were amplified. Among them, thirty cDNA fragments were reamplified for cloning and sequencing. The ddPCR strategy revealed that serine proteases were the most abundant genes among the sequenced clones induced during the maturation. Additionally, unknown genes from the co-culture of BMMCs with 3T3 fibroblasts were identified. We confirmed their induction in the CTMCs by Northern blot analysis and RT-PCR. Characterization of these induced genes during the maturation processes will provide insight into the functions of mast cells.

Characterization of a new member of the glutathione peroxidase gene family in Oryza sativa.

A cDNA encoding an Oryza sativa glutathione peroxidase, OsGPX1, was isolated and characterized. OsGPX1 encodes a protein of 168 amino acids with a predicted molecular mass of approximately 18.5 kDa. The protein has 92% identity to a GPX of Zea mays, but only 65% identity to rice PHGPX. The deduced amino acid sequence of OsGPX1 contains two GPX active site domains and one WNF(S/T)KF domain. There is no plastid transit peptide sequence, suggesting that OSGPX1 may function in the cytoplasm. OsGPX1 is located slightly over 85.5 cM from the end of the short-arm of chromosome 4. The OsGPX1 transcripts were abundant only in the leaves of mature plants, and were barely detectable in the leaves of seedlings. However, the transcription of OsGPX1 gene was induced in the seedlings within an hour of exposure to salt stress and was also gradually increased by cold and drought stress. These results indicate that OsGPX1 is a stress-inducible gene of the rice glutathione peroxidase family that protects cells against both metabolic and environmental oxidative stresses.

Potato MADS-box gene POTM1-1 transcripts are temporally and spatially distributed in floral organs and vegetative meristems.

The POTM1-1 gene is abundantly expressed in both vegetative and reproductive organs of potato. We performed in situ hybridization and RNA blotting analysis to investigate the patterns of POTM1-1 gene expression in the flower development and the early tuber development. In the early flowers, POTM1-1 transcripts were accumulated abundantly in the developing reproductive organs, including the placentae of carpels and the pollen sacs of stamens. In contrast, the pattern of POTM1-1 distribution during late flower development was different from that of the early flower development. The POTM1-1 transcripts were abundant in the sepals and petals of late flowers, but were minimally expressed in the stamens and carpel. In the shoot apical meristem of the vegetative organs, transcripts were distributed throughout meristem domes, young leaves, and developing vascular cambium. In the early tuberization, the transcripts were widely distributed in the swollen tips of the stolons. Taken together, the results suggest that POTM1-1 gene expression is temporally and spatially regulated in active growing tissues of both vegetative and floral organs with specific distribution patterns dependent upon the developmental stages of the tissue.

Purification and characterization of a beta-galactosidase from peach (Prunus persica).

A beta-galactosidase (EC 3.2.1.23) from peach (Prunus persica cv Mibackdo) was purified and characterized. The purified peach beta-galactosidase was 42 kDa in molecular mass and showed high enzyme activity against a the beta-galactosidase substrate, rho-nitrophenyl-beta-D-galactopyranoside. The Km and Vmax values of the enzyme activity of the peach beta-galactosidase were 5.16 and 0.19 mM for rho-nitrophenyl-beta-D-galactopyranoside mM/h, respectively. The optimum pH of the enzyme activity was pH 3.0, but it was relatively stable from pH 3.0-10.0. The temperature optimum was 50 degrees C. The enzyme activities were not improved in the buffers that contained Ca2+, Cu2+, Zn2+, and Mg2+, which indicates that the purified peach beta-galactosidase did not require these cations as co-factors. However, the enzyme was completely inhibited by Hg2+. The purified protein was cross-reacted with an antibody against the persimmon fruit beta-galactosidase. A further comparison of the N-terminal amino acid sequence of the purified protein showed high homologies to those of beta-galactosidase in apple (87%), persimmon (80%), and tomato (87%). Therefore, enzymatic, immunological, and molecular evidences in this study indicate that the purified 42-kDa protein is a peach beta-galactosidase.

A leaf-specific 27 kDa protein of potato Kunitz-type proteinase inhibitor is induced in response to abscisic acid, ethylene, methyl jasmonate, and water deficit.

The 22 kDa Kunitz-type potato proteinase inhibitor (22 kDa KPPI) was induced in tubers. However, the 27 kDa protein, which is immunologically related to the 22 kDa KPPI, was induced in leaves by wounding, hormones, and environmental stresses. The leaf-specific 27 kDa protein was induced in leaves that were treated with exogenous abscisic acid (ABA), ethephon, methyl jasmonate (MeJA), and water deficit. These results indicate that the 27 kDa protein in leaves could function as a defense protein against mechanical damages by herbivorous animals and abiotic environmental stresses that could induce plant hormones.

Molecular cloning and characterization of cDNAs encoding heterotrimeric G protein alpha and beta subunits from potato (Solanum tuberosum L.).

Two cDNAs, STGA2 and STGB2, that encode heterotrimeric G protein alpha and beta subunit proteins, respectively, were cloned from an early tuber cDNA library of potato (Solanum tuberosum cv. Superior). The cDNA of STGA2 encoded 384 amino acids, which showed 75-98% identities to plant Ga-subunits; STGB2 encoded 377 amino acids, which showed 83-92% identities to plant Gbeta-subunits. The transcript levels of the two genes were abundant in leaves, shoots, axially buds, unopened flowers, and active growing sprouts. However, the transcripts were barely detectable in roots. The expressions of STGA2 and STGB2 were up-regulated by light. Interestingly, the STGA2 and STGB2 gene expression showed synchronous patterns in the examined organs. During the early tuber development, the transcripts of STGA2 and STGB2 were abundant in unswollen stolons, swollen stolons, and new tubers, but were undetected in matured tubers. This indicates that potato Galpha- and beta-subunit genes are developmentally regulated. Based on these observations, we propose that heterotrimeric G proteins may be involved in the signaling pathway during potato tuber development.

Identification of non-telomeric G4-DNA binding proteins in human, E. coli, yeast, and Arabidopsis.

G4-DNA binding proteins of E. coli, Saccharomyces cerevisiae, Arabidopsis, and human have been identified by a synthetic non-telomeric G4-DNA oligo 5'-d(ACTGTCGTACTTGATATGGGGGT)-3' using gel mobility shift assays. G4-DNA binding proteins are specific to G4-DNA, a four-stranded guanine-DNA structure. Bound complexes of G4-DNA and proteins were identified in nuclear extracts of all examined organisms in this study. In humans, three different G4-DNA and protein complexes were identified. However, human telomeric G-quadruplex oligo did not compete with G4-DNA oligo in the competition assays, suggesting that the identified G4-DNA binding proteins may be different from the known human telomeric G4-DNA binding proteins. We discovered two complexes of G4-DNA and protein in Arabidopsis identified in mobility shift assays. Interestingly, two complexes of G4-DNA and proteins were identified from E. coli, which have a circular genomic DNA structure. Results of this investigation suggest that non-telomeric G4-DNA structure and its binding proteins may be involved in important functional roles in both prokaryotes and eukaryotes.