Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 38
Filtrar
1.
Front Vet Sci ; 11: 1343768, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38887537

RESUMEN

The objective of this study is to review different methods to screen for the optimal model for preventing and treating chicken glandular and muscular gastritis syndrome. Twenty-four 40-day-old specific pathogen-free (SPF) chickens were randomly allocated into four groups (N = 6): polyethylene glycol + ammonium chloride group (M1 group), acetic acid + rhubarb group (M2 group), polyethylene glycol + rhubarb group (M3 group), and control group. The control group had free access to water, while the remaining groups received different doses of molding reagents added to their drinking water. The animal models were assessed based on clinical manifestations, histopathology findings, serological analysis, and composition of intestinal microbiota to establish an optimal approach for constructing an avian model of glandular and muscular gastritis. The SPF chickens in each model group exhibited typical symptoms of glandular and muscular gastritis, poor spirit, yellow loose stools with undigested feed, and enlargement and ulceration of the glandular and muscular stomach. Among these groups, the M3 group had the highest incidence rate of 100%. Compared to the control group, the body weight and body temperature of the chicken in the three model groups were reduced, and the glandular and muscular stomachs and duodenum showed different degrees of bleeding, mucosal abscission, and other pathological injuries. Additionally, the levels of serum IL-2 and α-amylase activity decreased while the content of IL-4 increased. After conducting 16s rDNA sequencing, it was observed that the abundance of Bacteroides, Faecalibacterium, and Ruminococcaceae UCG-014 was significantly increased in the model group compared to the control group. Conversely, there was a notable decrease in the levels of Megamonas and Lactobacillus, which are speculated to be associated with arachidonic acid metabolism, the NF-κB signaling pathway, and TNF signaling pathways. The combination of polyethylene glycol and rhubarb emerged as the most effective method for establishing the glandular and muscular gastritis model in SPF chickens. This constructed chicken model displayed distinct signs of damage to the glandular and muscular stomach, inflammatory response, and disturbance in the intestinal flora, thereby providing a foundation for future research on the prevention and treatment of this syndrome.

2.
Front Pharmacol ; 15: 1389293, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38783954

RESUMEN

Halicin, the first antibacterial agent discovered by artificial intelligence, exerts broad-spectrum antibacterial effects and has a unique structure. Our study found that halicin had a good inhibitory effect on clinical isolates of drug-resistant strains and Clostridium perfringens (C. perfringens). The safety of halicin was evaluated by acute oral toxicity, genotoxicity and subchronic toxicity studies. The results of acute toxicity test indicated that halicin, as a low-toxicity compound, had an LD50 of 2018.3 mg/kg. The results of sperm malformation, bone marrow chromosome aberration and cell micronucleus tests showed that halicin had no obvious genotoxicity. However, the results of the 90-day subchronic toxicity test indicated that the test rats exhibited weight loss and slight renal inflammation at a high dose of 201.8 mg/kg. Teratogenicity of zebrafish embryos showed that halicin had no significant teratogenicity. Analysis of intestinal microbiota showed that halicin had a significant effect on the intestinal microbial composition, but caused a faster recovery. Furthermore, drug metabolism experiments showed that halicin was poorly absorbed and quickly eliminated in vivo. Our study found that halicin had a good therapeutic effect on intestinal infection model of C. perfringens. These results show the feasibility of developing oral halicin as a clinical candidate drug for treating intestinal infections.

3.
Artículo en Inglés | MEDLINE | ID: mdl-38311916

RESUMEN

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

4.
Atherosclerosis ; 391: 117478, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38417185

RESUMEN

BACKGROUND AND AIMS: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. METHODS: ApoE-/- mice were fed a high-cholesterol diet and treated with GA for 16 weeks to induce AS and identify the effect of GA. Network pharmacological analysis was performed to predict the anti-atherosclerotic mechanisms. An invitro cell model was used to explore the effect of GA on macrophage polarization and the possible mechanism involved in bone marrow dereived macrophages (BMDMs) and RAW264.7 cells stimulated with lipopolysaccharide or oxidized low-density lipoprotein. RESULTS: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 µg/mL) significantly decreased the proportion of CD86+ macrophages and the mRNA levels of IL-6, IL-1ß, and MCP-1 in macrophages. Experimental results showed that GA inhibited M1 macrophage polarization by regulating TLR4/MyD88/NF-κB signaling pathway. CONCLUSIONS: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.


Asunto(s)
Aterosclerosis , Placa Aterosclerótica , Ratones , Animales , FN-kappa B/metabolismo , Factor 88 de Diferenciación Mieloide/metabolismo , Factor 88 de Diferenciación Mieloide/farmacología , Receptor Toll-Like 4/metabolismo , Aterosclerosis/tratamiento farmacológico , Aterosclerosis/prevención & control , Aterosclerosis/genética , Placa Aterosclerótica/metabolismo , Transducción de Señal , Macrófagos/metabolismo , Lípidos
5.
Stem Cell Res Ther ; 15(1): 14, 2024 01 08.
Artículo en Inglés | MEDLINE | ID: mdl-38191526

RESUMEN

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.


Asunto(s)
Células Madre Mesenquimatosas , Ovario , Femenino , Animales , Macaca mulatta , Peróxido de Hidrógeno , Envejecimiento
6.
Int J Biol Macromol ; 261(Pt 2): 129793, 2024 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-38290627

RESUMEN

A water-soluble glycopeptide (named GL-PWQ3) with a molecular weight (Mw) of 2.40 × 104 g/mol was isolated from Ganoderma lucidum fruiting body by hot water extraction, membrane ultrafiltration, and gel column chromatography, which mainly consisted of glucose and galactose. Based on the methylation, FT-IR, 1D, and 2D NMR analysis, the polysaccharide portion of GL-PWQ3 was identified as a glucogalactan, which was comprised of unsubstituted (1,6-α-Galp, 1,6-ß-Glcp, 1,4-ß-Glcp) and monosubstituted (1,2,6-α-Galp and 1,3,6-ß-Glcp) in the backbone and possible branches that at the O-3 position of 1,3-Glcp and T-Glcp, and the O-2 position of T-Fucp, T-Manp or T-Glcp. The chain conformational study by SEC-MALLS-RI and AFM revealed that GL-PWQ3 was identified as a highly branched polysaccharide with a polydispersity index of 1.25, and might have compact sphere structures caused by stacked multiple chains. Moreover, the GL-PWQ3 shows strong anti-oxidative activity in NRK-52E cells. This study provides a theoretical basis for further elucidating the structure-functionality relationships of GL-PWQ3 and its potential application as a natural antioxidant in pharmacotherapy as well as functional food additives.


Asunto(s)
Reishi , Reishi/química , Espectroscopía Infrarroja por Transformada de Fourier , Polisacáridos/química , Glucosa/análisis , Peso Molecular , Agua
7.
Curr Issues Mol Biol ; 45(12): 10211-10224, 2023 Dec 18.
Artículo en Inglés | MEDLINE | ID: mdl-38132483

RESUMEN

Porcine epidemic diarrhea virus (PEDV) belongs to the coronavirus family and the coronavirus genus, causing contact enteric infection in pigs. It is one of the most serious diseases that threatens the pig industry. However, there is currently no specific drug to prevent and treat the disease, indicating that we need to be vigilant about the spread of the disease and the development of anti-PEDV drugs. The dried aerial parts of the plant Portulaca oleracea in the family Portulacaceous, whose decoction can be used to treat acute enteritis, dysentery, diarrhea, and other diseases. This study explored the potential mechanism of water extract of Portulaca oleracea (WEPO) in PEDV-induced pyroptosis in Vero cells. PEDV decreased the viability of Vero cells in a dose- and time-dependent manner, causing cell damage, upregulating the level of intracellular Nlrp3, and inhibiting the level of Gasdermin D (GSDMD) and the activation of Caspase-1. WEPO can inhibit PEDV-induced pyroptosis, reduce the elevation of inflammatory factors caused by infection, and exhibit a dose-dependent effect. Knockdown of Caspase-1 and GSDMD separately can induce the production of the inflammatory factor IL-1ß to significantly decrease and increase, respectively. These results suggest that WEPO can inhibit cell pyroptosis caused by PEDV and that the Caspase-1 and GSDMD pathways play an important role in this process.

8.
Front Nutr ; 10: 1179749, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-37305093

RESUMEN

Ganoderma lucidum polysaccharide peptide (GLPP) is one of the most abundant constituents of Ganoderma lucidum (G. lucidum), with a wide range of functional activities. The present study investigated the immunomodulatory effects of GLPP in cyclophosphamide (CTX)-induced immunosuppressive mice. The results showed that 100 mg/kg/day of GLPP administration significantly alleviated CTX-induced immune damage by improving immune organ indexes, earlap swelling rate, the index of carbon phagocytosis and clearance value, secretion of cytokines (TNF-α, IFN-γ, and IL-2), and immunoglobulin A(IgA) in the mice. Furthermore, ultra-performance liquid chromatography with mass/mass spectrometry (UPLC-MS/MS) was conducted to identify the metabolites, followed by biomarker and pathway analysis. The results showed that GLPP treatment alleviated CTX-induced alterations in the fecal metabolome profile, including arachidonic acid (AA), leukotriene D4 (LTD4), indole-3-ethanol, and formyltetrahydrofolate (CF), by reversing citric acid, malic acid, cortisol, and oleic acid. These results support the concept that GLPP exhibits immunomodulatory activity via the folate cycle, methionine cycle, TCA cycle, fatty acid biosynthesis and metabolism, glycerophospholipid metabolism, AA metabolism, and cAMP pathways. In conclusion, the results could be helpful to understand the use of GLPP to clarify the immunomodulatory mechanism and be used as immunostimulants to prevent CTX-induced side effects in the immune system.

9.
Eur J Med Chem ; 251: 115269, 2023 May 05.
Artículo en Inglés | MEDLINE | ID: mdl-36924667

RESUMEN

A series of pyridinium cation-substituted pleuromutilin analogues were designed, synthesized and evaluated for their antibacterial activities in vitro and in vivo. Most derivatives showed potent antibacterial activities, especially e4 that displayed the highest antibacterial activity against multi-drug resistant bacteria and was subjected to time-kill kinetics, resistance studies, cytotoxicity and molecular docking assays. Molecular docking results, scanning electron microscopy and o-nitrophenyl-ß-galactopyranoside tests showed that e4 not only inhibited bacterial protein synthesis but also disrupted bacterial cell walls. Compound e4 showed an ED50 of 5.68 mg/kg against multi-drug resistant Staphylococcus aureus in infected mice model. In in vivo and in vitro toxicity tests, e4 showed low toxic effects with an LD50 of 879 mg/kg to mice. These results suggest that compound e4 may be considered as a new therapeutic candidate for bacterial infections.


Asunto(s)
Infecciones Bacterianas , Diterpenos , Staphylococcus aureus Resistente a Meticilina , Compuestos Policíclicos , Animales , Ratones , Simulación del Acoplamiento Molecular , Relación Estructura-Actividad , Pruebas de Sensibilidad Microbiana , Antibacterianos/farmacología , Diterpenos/farmacología , Diterpenos/uso terapéutico , Compuestos Policíclicos/farmacología , Resistencia a Múltiples Medicamentos , Pleuromutilinas
10.
Bioorg Chem ; 132: 106353, 2023 03.
Artículo en Inglés | MEDLINE | ID: mdl-36669358

RESUMEN

Antibiotic-resistant bacteria pose a major global public health concern, owing to the lack of effective antibacterial drugs. Consequently, the discovery and development of innovative antibacterial drug classes with unique mechanisms of action are urgently needed. In this study, we designed, synthesised, and tested a series of novel pleuromutilin derivatives with piperazine linker substituted by amino acids moieties to determine their antibacterial properties. Most synthesized compounds exhibited potent activities against Staphylococcus aureus (S. aureus), methicillin-resistant S. aureus (MRSA), and methicillin-resistant Staphylococcus epidermidis. Compound 6l, the most potent antibacterial agent created in this study, displayed a rapid bactericidal activity against MRSA, Klebsiella pneumoniae and S. aureus cfr N12. Moreover, pharmacokinetics study of compound 6l exhibited good PK performance with a low in vivo clearance (CL = 1965 mL/h/kg) and a suitable half-life (T1/2 = 11.614 ± 5.123 h). Molecular docking experiments revealed the binding model of compound 6l to the unmethylated A2503 of peptidyl transferase centre of 23S rRNA. Interaction pattern of 6l with cfr-mediated ribosomes revealed by molecular dynamics. Moreover in vivo mouse systemic infection experiments with compound 6l revealed its effectiveness against MRSA and S. aureus cfr N12 with the ED50 of 11.08 mg/kg and 14.63 mg/kg body weight, respectively.


Asunto(s)
Staphylococcus aureus Resistente a Meticilina , Infecciones Estafilocócicas , Ratones , Animales , Staphylococcus aureus , Simulación del Acoplamiento Molecular , Piperazina/farmacología , Pruebas de Sensibilidad Microbiana , Farmacorresistencia Microbiana , Antibacterianos/química , Staphylococcus epidermidis , Infecciones Estafilocócicas/tratamiento farmacológico , Pleuromutilinas
11.
Mol Biotechnol ; 65(7): 1076-1084, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-36436163

RESUMEN

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.


Asunto(s)
Células Madre Mesenquimatosas , ARN Pequeño no Traducido , Humanos , ARN Pequeño no Traducido/metabolismo , Cordón Umbilical
12.
Food Funct ; 13(24): 12619-12631, 2022 Dec 13.
Artículo en Inglés | MEDLINE | ID: mdl-36385640

RESUMEN

Hyperuricemia (HUA) affects human health and is involved in the pathogenesis of common chronic diseases. Previous studies showed that Ganoderma lucidum extract lowered HUA in animals. However, the active ingredient and pharmacological mechanism of Ganoderma lucidum extract in the improvement of HUA are unknown. The purpose of this study was to determine the anti-HUA efficacy and related mechanism of Ganoderma lucidum polysaccharide peptide (GLPP) using a potassium oxonate (PO)-induced mouse model and an adenosine-induced cell model. The experimental results showed that blood uric acid (UA) was decreased up to 40.6% by GLPP in HUA mice in a dose-dependent manner. Additionally, GLPP significantly reduced UA production by inhibiting the hepatic and blood adenosine deaminase (ADA) activity and increased UA excretion by decreasing the expression of glucose transporter 9 (GLUT9) and increasing the expression of organic anion transporter 1 (OAT1) in kidney. The adenosine-induced cell model showed that the inhibitory effect of GLPP on ADA activity may be the main reason for the alleviation of HUA by GLPP. Furthermore, PO-induced renal histopathological damage was also alleviated by GLPP in a dose-dependent manner. The experimental results in this study indicated that GLPP exerted anti-HUA effects via regulating the UA production and excretion, suggesting that GLPP could be developed into a therapeutic agent for HUA.


Asunto(s)
Hiperuricemia , Proteoglicanos , Reishi , Animales , Humanos , Ratones , Adenosina/farmacología , Adenosina Desaminasa/metabolismo , Hiperuricemia/terapia , Riñón/efectos de los fármacos , Transportadores de Anión Orgánico/metabolismo , Reishi/química , Proteoglicanos/aislamiento & purificación , Proteoglicanos/farmacología , Proteoglicanos/uso terapéutico
13.
J Vet Sci ; 23(4): e56, 2022 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-35698810

RESUMEN

BACKGROUND: At the therapeutic doses, diclofenac sodium (DFS) has few toxic side effects on mammals. On the other hand, DFS exhibits potent toxicity against birds and the mechanisms remain ambiguous. OBJECTIVES: This paper was designed to probe the toxicity of DFS exposure on the hepatic proteome of broiler chickens. METHODS: Twenty 30-day-old broiler chickens were randomized evenly into two groups (n = 10). DFS was administered orally at 10 mg/kg body weight in group A, while the chickens in group B were perfused with saline as a control. Histopathological observations, serum biochemical examinations, and quantitative real-time polymerase chain reaction were performed to assess the liver injury induced by DFS. Proteomics analysis of the liver samples was conducted using isobaric tags for relative and absolute quantification (iTRAQ) technology. RESULTS: Ultimately, 201 differentially expressed proteins (DEPs) were obtained, of which 47 were up regulated, and 154 were down regulated. The Gene Ontology classification and Kyoto Encyclopedia of Genes and Genomes pathway analysis were conducted to screen target DEPs associated with DFS hepatotoxicity. The regulatory relationships between DEPs and signaling pathways were embodied via a protein-protein interaction network. The results showed that the DEPs enriched in multiple pathways, which might be related to the hepatotoxicity of DFS, were "protein processing in endoplasmic reticulum," "retinol metabolism," and "glycine, serine, and threonine metabolism." CONCLUSIONS: The hepatotoxicity of DFS on broiler chickens might be achieved by inducing the apoptosis of hepatocytes and affecting the metabolism of retinol and purine. The present study could provide molecular insights into the hepatotoxicity of DFS on broiler chickens.


Asunto(s)
Enfermedad Hepática Inducida por Sustancias y Drogas , Proteómica , Animales , Enfermedad Hepática Inducida por Sustancias y Drogas/etiología , Enfermedad Hepática Inducida por Sustancias y Drogas/veterinaria , Pollos/genética , Diclofenaco/toxicidad , Mamíferos , Proteómica/métodos , Vitamina A
14.
Sci Rep ; 12(1): 8515, 2022 05 20.
Artículo en Inglés | MEDLINE | ID: mdl-35595813

RESUMEN

As a natural antiviral regulator, phospholipid scramblase 1 (PLSCR1) has been shown to inhibit influenza virus replication in infected cells through interacting with NP of influenza A virus (IAV). But its antiviral function as well as the underlying regulatory mechanism has not been examined in vivo. In the present work, we show that PLSCR1 expression is decreased in H1N1 SIV-infected mice, and Plscr1-/- mice are more susceptible to H1N1 SIV infection. By performing yeast two-hybrid screening, we identified immunoglobulin-like domain-containing receptor 1 (ILDR1) as a novel PLSCR1-binding partner. ILDR1 is highly expressed in the lungs, and its expression level is increased after virus infection. Interestingly, ILDR1 could not directly interact with virus NP protein, but could combine with PLSCR1 competitively. Our data indicates that there is a previously unidentified PLSCR1-ILDR1-NP regulatory pathway playing a vital role in limiting IAV infection, which provides novel insights into IAV-host interactions.


Asunto(s)
Subtipo H1N1 del Virus de la Influenza A , Virus de la Influenza A , Gripe Humana , Animales , Antivirales/farmacología , Humanos , Ratones , Replicación Viral
15.
Int J Mol Sci ; 22(19)2021 Sep 23.
Artículo en Inglés | MEDLINE | ID: mdl-34638569

RESUMEN

Renal ischemia reperfusion injury (RIRI) is one of the main causes of acute kidney injury (AKI), which can lead to acute renal failure. The development of RIRI is so complicated that it involves many factors such as inflammatory response, oxidative stress and cell apoptosis. Ganoderic acids (GAs), as one of the main pharmacological components of Ganoderma lucidum, have been reported to possess anti-inflammatory, antioxidant, and other pharmacological effects. The study is aimed to investigate the protective effect of GAs on RIRI and explore related underlying mechanisms. The mechanisms involved were assessed by a mouse RIRI model and a hypoxia/reoxygenation model. Compared with sham-operated group, renal dysfunction and morphological damages were relieved markedly in GAs-pretreatment group. GAs pretreatment could reduce the production of pro-inflammatory factors such as IL-6, COX-2 and iNOS induced by RIRI through inhibiting TLR4/MyD88/NF-kB signaling pathway. Furthermore, GAs reduced cell apoptosis via the decrease of the ratios of cleaved caspase-8 and cleaved caspase-3. The experimental results suggest that GAs prevent RIRI by alleviating tissue inflammation and apoptosis and might be developed as a candidate drug for preventing RIRI-induced AKI.


Asunto(s)
Lesión Renal Aguda/prevención & control , Apoptosis/efectos de los fármacos , Inflamación/tratamiento farmacológico , Sustancias Protectoras/farmacología , Daño por Reperfusión/prevención & control , Triterpenos/farmacología , Lesión Renal Aguda/etiología , Lesión Renal Aguda/patología , Animales , Línea Celular , Ciclooxigenasa 2/metabolismo , Modelos Animales de Enfermedad , Inflamación/metabolismo , Interleucina-6/metabolismo , Masculino , Ratones Endogámicos C57BL , Factor 88 de Diferenciación Mieloide/antagonistas & inhibidores , Factor 88 de Diferenciación Mieloide/metabolismo , FN-kappa B/antagonistas & inhibidores , FN-kappa B/metabolismo , Óxido Nítrico Sintasa de Tipo II/metabolismo , Estrés Oxidativo/efectos de los fármacos , Sustancias Protectoras/uso terapéutico , Ratas , Daño por Reperfusión/complicaciones , Daño por Reperfusión/patología , Receptor Toll-Like 4/antagonistas & inhibidores , Receptor Toll-Like 4/metabolismo , Triterpenos/uso terapéutico
16.
Oxid Med Cell Longev ; 2021: 9615429, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-34413929

RESUMEN

Keap1-Nrf2-ARE and heat shock proteins (Hsps) are important endogenous protection mechanisms initiated by heat stress to play a double protective role for cell adaptation and survival. H9C2 cells and 80 300-day-old specific pathogen-free chickens were randomly divided into the control and tea polyphenol groups and used to establish a heat stress model in vitro and in vivo. This task was conducted to explore the protection and mechanism of tea polyphenols in relieving thermal injury. A supplement with 10 µg/mL tea polyphenols could effectively relieve the heat damage of H9C2 cells at 42°C. Accordingly, weaker granular degeneration, vacuolar degeneration, and nucleus deep staining were shown. A strong antioxidant capacity was manifested in the upregulation of the total antioxidant capacity (T-AOC) (at 5 h, P < 0.05), Hemeoxygenase-1 mRNA (at 2 h, P < 0.01), superoxide dismutase (SOD) (at 2, 3, and 5 h, P < 0.05), and Nrf2 (at 0 and 5 h, P < 0.01). A high expression of Hsps was reflected in CRYAB at 3 h; Hsp27 at 0, 2, and 3 h (P < 0.01); and Hsp70 at 3 and 5 h (P < 0.01). The supplement with 0.2 g/L tea polyphenols in the drinking water also had a good effect in alleviating the heat stress damage of the myocardial cells of hens at 38°C. Accordingly, light pathological lesions and downregulation of the myocardial injury-related indicators (LDH, CK, CK-MB, and TNF-α) were shown. The mechanism was related to the upregulation of T-AOC (at 0 h, P < 0.05), GSH-PX (at 0.5 d, P < 0.01), SOD (at 0.5 d), and Nrf2 (at 0 d with P < 0.01 and 2 d with P < 0.05) and the induced expression of CRYAB (at 0.5 and 2 d), Hsp27 (at 0, 0.5, and 5 d), and Hsp70 (at 0 and 0.5 d). In conclusion, the tea polyphenols enhanced the antioxidant capacity and induced Hsps to relieve heat stress injury.


Asunto(s)
Antioxidantes/farmacología , Proteínas de Choque Térmico/metabolismo , Respuesta al Choque Térmico , Miocitos Cardíacos/efectos de los fármacos , Factor 2 Relacionado con NF-E2/metabolismo , Polifenoles/farmacología , Té/química , Animales , Proteínas de Choque Térmico/genética , Ratones , Miocitos Cardíacos/metabolismo , Miocitos Cardíacos/patología , Factor 2 Relacionado con NF-E2/genética , Estrés Oxidativo
17.
Artículo en Inglés | MEDLINE | ID: mdl-34229076

RESUMEN

Diclofenac sodium (DS) is one of the nonsteroidal anti-inflammatory drugs (NSAIDs), which exhibits potent toxicity to birds. To search the molecular mechanism of DS induced nephrotoxicity in broiler chicken, 20 apparently healthy 30-day old broiler chickens were separated randomly into two groups (n = 10): Group A was kept as control while DS was administered at the dose rate of 10 mg/kg body weight in group B through oral gavage. Kidney samples were collected, and the proteins were identified and quantified by iTRAQ. 434 differentially expressed proteins (DEPs) were screened, including 277 up-regulated DEPs and 157 down-regulated DEPs. The functional annotation and classification results indicated that DEPs were significantly enriched in apoptosis and metabolism-related pathways via GO and KEGG analysis. Compared with the control group, the most significant enrichment pathways are "ribosome", "metabolic pathways" and "protein processing in endoplasmic reticulum". Based on the proteomic results and relevant literature, some DEPs that potentially related to the toxicity of DS were screened. The mRNA transcript levels of these DEPs were characterized by qRT-PCR, and the results showed that Slc22a7, Gatm, Glud1, Agxt2 and Gldc were significantly down-regulated, while Gsl, Gpt2 and Asns were significantly up-regulated. We speculate that the toxic mechanism of DS to chicken might be that it induces kidney cell apoptosis, interferes with purine metabolism and inhibits the expression of OAT2. The current study provides a reference for elucidating the nephrotoxic mechanism of diclofenac sodium to broiler chicken from the molecular perspective.


Asunto(s)
Pollos , Diclofenaco/toxicidad , Riñón/efectos de los fármacos , Riñón/metabolismo , Proteínas/metabolismo , Administración Oral , Animales , Apoptosis/efectos de los fármacos , Diclofenaco/administración & dosificación , Riñón/patología , Transportadores de Anión Orgánico Sodio-Independiente/metabolismo , Proteínas/análisis , Proteínas/genética , Proteómica/métodos , Purinas/metabolismo
18.
Microb Pathog ; 154: 104832, 2021 May.
Artículo en Inglés | MEDLINE | ID: mdl-33781871

RESUMEN

Porcine epidemic diarrhea virus (PEDV), especially variants, causes a highly contagious enteric disease which could give rise to huge economic losses in the swine industry worldwide. Portulaca oleracea L. has been reported to regulate intestine disease and involved in viral infections. However, the underlying mechanisms of Portulaca oleracea L. extracts against PEDV have not been fully elucidated. In this study, the antiviral effects and potential mechanisms of Portulaca oleracea L. extracts against PEDV were investigated in vitro. We first examined the inhibitory effects of different Portulaca oleracea L. extracts on the PEDV(JX-16 strain) in vitro and found that the water extract of Portulaca oleracea L.(PO)could significantly inhibit PEDV replication by 92.73% on VH cells and 63.07% on Vero cells. Furthermore, time-course analysis showed PO inhibited PEDV replication during the adsorption period of infectious cycle. Western blot and indirect immunofluorescence assay indicated that PO down-regulated the S protein expression in a dose-dependent manner. In addition, our results demonstrated the ability of PO to inhibit PEDV replication in VH cells by down-regulating the cytokine levels (TNF-α,IL-22 and IFN-α) and inhibiting the NF-κB signaling pathway activated by PEDV. Thus, Portulaca oleracea L extracts have potential utility in the preventive and therapeutic strategies for PEDV infection.


Asunto(s)
Infecciones por Coronavirus , Virus de la Diarrea Epidémica Porcina , Portulaca , Animales , Antivirales/farmacología , Antivirales/uso terapéutico , Chlorocebus aethiops , Infecciones por Coronavirus/tratamiento farmacológico , Infecciones por Coronavirus/veterinaria , Factor 88 de Diferenciación Mieloide , FN-kappa B , Transducción de Señal , Porcinos , Células Vero
19.
Acta Pharmacol Sin ; 41(6): 782-790, 2020 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-31911637

RESUMEN

Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common life-threatening monogenetic diseases characterized by progressive enlargement of fluid-filled renal cysts. Our previous study has shown that Ganoderma triterpenes (GT) retards PKD renal cyst development. In the present study we identified the effective ingredient of GT in suppression of kidney cyst development. Using an in vitro MDCK cystogenesis model, we identified ganoderic acid A (GA-A) as the most promising candidate among the 12 ganoderic acid (GA) monomers. We further showed that GA-A (6.25-100 µM) significantly inhibited cyst growth in MDCK cyst model and embryonic kidney cyst model in vitro, and the inhibitory effect was reversible. In kidney-specific Pkd1 knockout (kPKD) mice displaying severe cystic kidney disease, administration of GA-A (50 mg· kg-1 ·d-1, sc) significantly attenuated renal cyst development. In both MDCK cells and kidney of kPKD mice, we revealed that GA-A dose-dependently downregulated the Ras/MAPK signaling pathway. The expression of proliferating cell nuclear antigen (PCNA) was also suppressed, suggesting a possible effect of GA-A on cell proliferation. These experimental data suggest that GA-A may be the main ingredient of GT as a potential therapeutic reagent for treating ADPKD.


Asunto(s)
Ganoderma/química , Ácidos Heptanoicos/farmacología , Lanosterol/análogos & derivados , Enfermedades Renales Poliquísticas/tratamiento farmacológico , Animales , Proliferación Celular/efectos de los fármacos , Células Cultivadas , Modelos Animales de Enfermedad , Perros , Relación Dosis-Respuesta a Droga , Ácidos Heptanoicos/administración & dosificación , Ácidos Heptanoicos/aislamiento & purificación , Inyecciones Subcutáneas , Lanosterol/administración & dosificación , Lanosterol/aislamiento & purificación , Lanosterol/farmacología , Células de Riñón Canino Madin Darby/efectos de los fármacos , Ratones , Ratones Endogámicos C57BL , Ratones Endogámicos ICR , Enfermedades Renales Poliquísticas/patología
20.
Acta Pharmacol Sin ; 41(5): 670-677, 2020 May.
Artículo en Inglés | MEDLINE | ID: mdl-31804606

RESUMEN

Renal fibrosis is considered as the pathway of almost all kinds of chronic kidney diseases (CKD) to the end stage of renal diseases (ESRD). Ganoderic acid (GA) is a group of lanostane triterpenes isolated from Ganoderma lucidum, which has shown a variety of pharmacological activities. In this study we investigated whether GA exerted antirenal fibrosis effect in a unilateral ureteral obstruction (UUO) mouse model. After UUO surgery, the mice were treated with GA (3.125, 12.5, and 50 mg· kg-1 ·d-1, ip) for 7 or 14 days. Then the mice were sacrificed for collecting blood and kidneys. We showed that GA treatment dose-dependently attenuated UUO-induced tubular injury and renal fibrosis; GA (50 mg· kg-1 ·d-1) significantly ameliorated renal disfunction during fibrosis progression. We further revealed that GA treatment inhibited the extracellular matrix (ECM) deposition in the kidney by suppressing the expression of fibronectin, mainly through hindering the over activation of TGF-ß/Smad signaling. On the other hand, GA treatment significantly decreased the expression of mesenchymal cell markers alpha-smooth muscle actin (α-SMA) and vimentin, and upregulated E-cadherin expression in the kidney, suggesting the suppression of tubular epithelial-mesenchymal transition (EMT) partially via inhibiting both TGF-ß/Smad and MAPK (ERK, JNK, p38) signaling pathways. The inhibitory effects of GA on TGF-ß/Smad and MAPK signaling pathways were confirmed in TGF-ß1-stimulated HK-2 cell model. GA-A, a GA monomer, was identified as a potent inhibitor on renal fibrosis in vitro. These data demonstrate that GA or GA-A might be developed as a potential therapeutic agent in the treatment of renal fibrosis.


Asunto(s)
Proteínas Smad/antagonistas & inhibidores , Factor de Crecimiento Transformador beta/antagonistas & inhibidores , Triterpenos/farmacología , Obstrucción Ureteral/tratamiento farmacológico , Animales , Células Cultivadas , Modelos Animales de Enfermedad , Relación Dosis-Respuesta a Droga , Humanos , Inyecciones Intraperitoneales , Sistema de Señalización de MAP Quinasas/efectos de los fármacos , Masculino , Ratones , Ratones Endogámicos C57BL , Transducción de Señal/efectos de los fármacos , Proteínas Smad/metabolismo , Factor de Crecimiento Transformador beta/metabolismo , Triterpenos/administración & dosificación , Obstrucción Ureteral/metabolismo , Obstrucción Ureteral/cirugía
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA