RESUMEN
To evaluate the implementation of Survey of oncomelanid snails (WS/T 563-2017) in schistosomiasis-endemic foci, two schistosomiasis-endemic counties were selected from two provinces of Sichuan and Anhui. Professional staff working in province-, city-, county- and township-level disease control and prevention institutions, parasitic disease control institutions or medical institutions were recruited, and the understanding, use and implementation of Survey of oncomelanid snails (WS/T 563-2017) were investigated using questionnaires and interviews. The awareness, use, proportion of propagation and implementation and correct rate of answering questions pertaining to Survey of oncomelanid snails (WS/T 563-2017) were analyzed. A total of 270 questionnaires were allocated, and 269 were recovered, including 254 valid questionnaires. The overall awareness of Survey of oncomelanid snails (WS/T 563-2017) was 84.64% (215/254), and propagation and implementation of Survey of oncomelanid snails (WS/T 563-2017) was not performed in 23.28% (17/73) of the survey institutions following implementation of Survey of oncomelanid snails (WS/T 563-2017), with meeting training and allocation of propagation materials as the main type of propagation and implementation. Among 254 respondents, 77.16% (196/254) were familiar with the standard, 66.14% (168/254) understood the conditions for use of the standard during snail surveys, and 96.85% (246/254) had the approach for identifying snails. In addition, there were 41.73% (106/254), 50.78% (129/254) and 7.48% (19/254) of respondents that considered the operability of Survey of oncomelanid snails (WS/T 563-2017) was very good, good and general, respectively. The findings demonstrate that the issue and implementation of Survey of oncomelanid snails (WS/T 563-2017) has filled the gap for the standardization of snail control techniques, and which plays an importang guiding role in the national schistosomiasis control program.
Asunto(s)
Esquistosomiasis , Humanos , Esquistosomiasis/epidemiología , Esquistosomiasis/prevención & control , Esquistosomiasis/parasitología , Encuestas y Cuestionarios , Ciudades , China/epidemiologíaRESUMEN
OBJECTIVE: The ApaI polymorphism (G > T, rs7975232) of the vitamin D receptor (VDR) gene in the risk of postmenopausal osteoporosis has been widely researched, and the results have yielded conflicts. Therefore, we performed an updated pooled analysis to comprehensively assess the association between VDR ApaI polymorphism and postmenopausal osteoporosis risk. METHODS: We searched eligible studies about ApaI polymorphism and osteoporosis through the PubMed, Embase, CNKI and Wanfang databases; case-control studies containing available genotype frequencies of A/a were chosen. We used the odds ratio with 95% confidence interval to assess the strength of this association. Sensitivity analysis and publication bias assessment were performed. Trial sequential analysis (TSA) was performed to evaluate a sufficient sample. RESULTS: Twenty-two studies assessed the relationship between ApaI polymorphism and the risk of osteoporosis in postmenopausal women. The comprehensive analyses showed no significant association for ApaI polymorphism with postmenopausal osteoporosis in the overall population, equally valid for Asian and Caucasian subgroups with any genetic model. TSA still indicated the results were robust. CONCLUSION: The present meta-analysis suggests that the VDR ApaI genotype may not affect the risk of postmenopausal osteoporosis in Asians and Caucasians.
Asunto(s)
Osteoporosis Posmenopáusica , Osteoporosis , Femenino , Humanos , Osteoporosis Posmenopáusica/genética , Predisposición Genética a la Enfermedad , Receptores de Calcitriol/genética , Polimorfismo GenéticoRESUMEN
An ambitious goal has been set for elimination of schistosomiasis in all endemic counties (districts) in Sichuan Province by 2023. To achieve this goal, and to continue to consolidate the control achievements, it is necessary to understand the current endemic status of schistosomiasis, identify the challenges and analyze the experiences and lessons from the schistosomiasis control program, and develop targeted control strategies and interventions in the province. This paper reviews the progress of schistosomiasis control in Sichuan Province since the 12th Five-Year Plan period, analyzes the challenges in the schistosomiasis elimination program, and proposes recommendations for future directions and priorities.
Asunto(s)
Esquistosomiasis , Humanos , Animales , Esquistosomiasis/epidemiología , Esquistosomiasis/prevención & control , China/epidemiología , CaracolesRESUMEN
OBJECTIVE: To investigate the anatomy of the perforator vessels of the deep circumflex iliac artery (DCIA) and the techniques for repairing mandibular complex defect using chimeric deep circumflex iliac artery perforator flap (DCIAPF). OBJECTIVE: We analyzed the origin, distribution, number and courses of the perforator vessels of the DCIA, and measured the outside diameters of the vessels at the origin in 6 adult cadaveric specimens (12 sides) with latex perfusion. From July, 2018 to September, 2019, based on the results of anatomical study and imaging findings and using the digital surgical guide plate, we harvested DCIAPF from 4 patients for repairing mandibular body or angle defects and oral soft tissue defects. OBJECTIVE: The perforating vessels of the DCIA included abdominal muscular branches, osteomusculocutaneous branches and terminal musculocutaneous branches. The abdominal muscle branches originated from the DCIA inguinal segment in 4 and from both the inguinal and iliac segments in 2 of the specimens. The osteomusculocutaneous branches all originated from the internal iliac crest in 75% and from both the inguinal and internal iliac crest segments in 25% of cases; the inguinal segment gave rise to only one perforating branch. The number of the musculocutaneous perforating branches was 1 (58.3%) or 2 (41.7%). In the 4 patients undergoing mandibular reconstruction, the DCIAPF survived in all cases with good recovery of the donor site wound. Satisfactory facial appearance with good oral morphology and occlusal relationship was achieved at 1 month postoperatively in all the patients. None of the patients experienced obvious functional abnormalities at the donor site, and imaging examination confirmed successful reconstruction of the oromandibular defects in all the cases. OBJECTIVE: A good understanding of the anatomic characteristics of the perforator vessels of the DCIA combined with imaging examinations and digital surgery technology facilitates the harvest of DCIAPF for repairing mandibular body or angle defects complicated by oral soft tissue defects.
Asunto(s)
Colgajo Perforante , Procedimientos de Cirugía Plástica , Adulto , Humanos , Arteria Ilíaca/cirugía , Ilion , Mandíbula/cirugía , Colgajo Perforante/cirugíaRESUMEN
Objective: To investigate the clinical and immunological features of cardiac involvement in patients with dermatomyositis (DM). Methods: Data of 271 adult patients with DM diagnosed in the Department of Rheumatology and Immunology, Peking University People's Hospital from 2003 to 2018 were collected retrospectively and analyzed statistically. Results: The occurrence of cardiac involvement in DM was 15.9% (43/271). Main feature of cardiac involvement in DM was elevated cardiac troponin I (cTnI). The most common abnormalities of ECG were T wave abnormality (27.9%, 12/43), sinus tachycardia (16.3%,7/43), ST-T change (14%, 6/43) and right bundle branch block (7%, 3/43). The common manifestations of echocardiography were left ventricular diastolic dysfunction (23.3%, 10/43) and pericardial effusion (23.3%, 10/43). As compared with DM patients without cardiac involvement, DM patients with cardiac damage were more likely to have rapidly progressive interstitial lung disease (ILD), skin damage, anemia, elevated creatine kinase, decreased C3 and serum albumin (P<0.05). Positive anti-Ro-52 antibody and Jo-1 antibody were detected more common in DM with cardiac involvement(P<0.05). Conclusions: Cardiac damage is common complication of DM. Manifestations of cardiac damaging are varied. Rapid progressive ILD and positive Jo-1 and Ro-52 antibodies are more common in this group. Clinicians should improve the awareness of cardiac involvement in DM patients.
Asunto(s)
Dermatomiositis , Adulto , Ecocardiografía , Humanos , Enfermedades Pulmonares Intersticiales , Estudios RetrospectivosRESUMEN
BACKGROUND: Let-7 is one of the earliest discovered microRNAs(miRNAs) and has been reported to be down-regulated in multiple malignant tumors. The effects and molecular mechanisms of let-7i in bladder cancer are still unclear. This study was to investigate the effects and potential mechanisms of let-7i on bladder cancer cells. METHODS: Total RNA was extracted from bladder cancer cell lines. The expression levels of let-7i and HMGA1 were examined by quantitative real-time PCR. Cell viability was detected using the CCK-8 and colony formation assays, while transwell and wound healing assays were used to evaluate migration ability. Luciferase reporter assay and western blot were used to confirm the target gene of let-7i. RESULTS: Compared with the SV-40 immortalized human uroepithelial cell line (SV-HUC-1), bladder cancer cell lines T24 and 5637 had low levels of let-7i expression, but high levels of high mobility group protein A1 (HMGA1) expression. Transfection of cell lines T24 and 5637 with let-7i mimic suppressed cell proliferation and migration. Luciferase reporter assay confirmed HMGA1 may be one of the target genes of let-7i-5p. Protein and mRNA expression of HMGA1 was significantly downregulated in let-7i mimic transfected cell lines T24 and 5637. CONCLUSIONS: Up-regulation of let-7i suppressed proliferation and migration of the human bladder cancer cell lines T24 and 5637 by targeting HMGA1. These findings suggest that let-7i might be considered as a novel therapeutic target for bladder cancer.
Asunto(s)
Movimiento Celular/fisiología , Proliferación Celular/fisiología , Proteína HMGA1a/biosíntesis , MicroARNs/biosíntesis , Neoplasias de la Vejiga Urinaria/metabolismo , Línea Celular Transformada , Línea Celular Tumoral , Proteína HMGA1a/antagonistas & inhibidores , Humanos , Neoplasias de la Vejiga Urinaria/patologíaRESUMEN
Ceratovacuna lanigera Zehntner is a major leaf pest of sugarcane. Widely distributed, it affects both the yield and quality of sugarcane in China. This study aimed to assess real yield and sugar yield losses, and the effect of C. lanigera damage on emergence of newly planted and ratoon cane under current production levels. Field experiments were carried out from 2014 to 2016 in Yunnan Province China. At maturity, plants were harvested and weighed to determine yield, and the effect on sugarcane quality and sucrose content analyzed. Real yield decreased by average of 46,185 kg hm-2 (range: 37,545-61,845 kg hm-2) in damaged versus undamaged areas, with an average yield loss rate of 35.9% (28.5-45.7%). Juice yield decreased by an average of 3.01% (2.4-4.13%) and sucrose content by 6.38% (5.48-8.16%). Juice brix decreased by an average of 7.66°BX (6.95-9.05°BX) and juice gravity purity by 12.35% (8.43-19.97%). In contrast, the reducing sugar content increased by an average of 1.21% (1.01-1.3%). Emergence rates of newly planted cane decreased by an average of 26.0% (24.7-27.3%). The emergence number of ratoon cane decreased by 66,834 hm2 (57,429-76,238 hm-2) and relative emergence loss rates of ratoon cane decreased by an average of 57.8% (57.6-58.0%). These findings confirm that C. lanigera damage severely affects sugarcane yield and quality in Yunnan Province. The results will help the implementation of effective control measures, thereby supporting sustainable development of the Chinese sugar industry.
Asunto(s)
Áfidos , Saccharum , Animales , Biomasa , ChinaRESUMEN
Objective: To explore the clinical application value of peripheral blood diagnostic report. Methods: 557 peripheral blood diagnostic reports were collected from Peking University First Hospital, YANDA LU DAOPEI Hospital and Beijing United Family Hospital. The results were analyzed and summarized according to different blood cell morphology character for the first time and review cases, respectively. Results: Two hundred and one samples from first time patients were found abnormal complete blood count or leukocyte differential count, they were summarized as anemia, anemia accompanied with leukopenia or thrombopenia, abnormal white blood cell count or leukocyte differential count and abnormal platelet count. Each condition was further distinguished on the basis of different morphology character. Initial diagnosis or further examination could be proposed if abnormal morphology was specific or typical, when blood cell morphology was atypical or normal, the morphology was described objectively. 22 review cases included many benign and malignant disorders such as acute leukemia, chronic leukemia, myelodysplastic syndrome, multiple myeloma, infectious mononucleosis and so on. Suggestion of therapeutic effect, progression of diseases or further examination could be present according to complete blood cell count and morphology character. Conclusion: Peripheral blood diagnostic report can provide more comprehensive and accurate information for clinic, and propose important advisory opinions for primary diagnosis, differential diagnosis, treatment monitoring and progression assessment.
Asunto(s)
Enfermedades Hematológicas/diagnóstico , Recuento de Leucocitos , Enfermedad Aguda , Pruebas Hematológicas , Humanos , Leucemia , Microscopía , Síndromes MielodisplásicosRESUMEN
Objective: To achieve definite diagnosis in a clinically diagnosed Charcot-Marie-Tooth disease (CMT) pedigree and broaden the mutational diversity of CMT-related mutations in Chinese Han population. Methods: Patients clinically diagnosed with CMT were recruited from Department of Neurology, Chinese PLA General Hospital between December, 2012 to June, 2016. Clinical examination, laboratory tests, nerve conduction studies, and molecular and bioinformatics analyses were performed on a clinically diagnosed CMT pedigree. Results: In the pedigree, a GARS mutation (c.794C>T, p. S265F) was identified and CMT2D was diagnosed. Conclusion: The newly identified GARS mutation has broaden the mutational diversity of CMT2D in Chinese Han population.
Asunto(s)
Enfermedad de Charcot-Marie-Tooth , Linaje , Pueblo Asiatico , Análisis Mutacional de ADN , Humanos , MutaciónRESUMEN
AIM: To identify the association between the expression of lncRNA NEAT1 and clinicopathological characteristics of patients with HCC, and to explore the prognostic significance of lncRNA NEAT1 in predicting prognosis of HCC. METHODS: We retrospectively reviewed 86 patients with HCC (35 female, 51 male) managed in our institution between 2009 and 2014. The expression level of lncRNA NEAT1 was detected by real-time PCR. Prognostic factors were evaluated using Kaplan-Meier curves and Cox proportional hazards models. RESULTS: For the entire cohort of 86 patients, we showed that the expression level of NEAT1 was significantly higher in HCC tissues compared with non-tumorous tissues and NEAT1 was increased obviously in the HCC cell lines including SMMC-7721, Huh-7 and Hep3B (P < 0.001). MTT assay showed that si-NEAT1 remarkably inhibited the cell proliferation in three HCC cell lines. Moreover, over-expression of lncRNA NEAT1 was closely related to liver cirrhosis (P = 0.026), microvascular invasion (MVI) (P = 0.023), and TNM stage (P = 0.017). After adjusting for competing risk factors, we identified that expression level of lncRNA NEAT1 was an independently risk factor associated with the prognosis of patients with HCC (P = 0.031). CONCLUSIONS: In this study, we found NEAT1 expressed significantly higher in HCC tissues compared with non-tumorous tissues. Overexpression of lncRNA NEAT1 was an independently risk factor associated with the prognosis of patients with HCC.
Asunto(s)
Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/cirugía , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/cirugía , ARN Largo no Codificante/genética , Adulto , Anciano , Vasos Sanguíneos/patología , Línea Celular Tumoral , Proliferación Celular/genética , China , Femenino , Expresión Génica , Hepatectomía , Humanos , Cirrosis Hepática/genética , Masculino , Persona de Mediana Edad , Invasividad Neoplásica , Estadificación de Neoplasias , Pronóstico , ARN Interferente Pequeño/genética , Estudios Retrospectivos , Factores de Riesgo , Tasa de SupervivenciaAsunto(s)
Trasplante de Células Madre Hematopoyéticas , Leucemia-Linfoma Linfoblástico de Células Precursoras , Receptores de Antígenos de Linfocitos T , Linfocitos T/trasplante , Neoplasias Testiculares , Adulto , Aloinjertos , Humanos , Masculino , Leucemia-Linfoma Linfoblástico de Células Precursoras/patología , Leucemia-Linfoma Linfoblástico de Células Precursoras/terapia , Proteínas Recombinantes de Fusión , Recurrencia , Neoplasias Testiculares/patología , Neoplasias Testiculares/terapiaRESUMEN
Swaziland has the highest prevalence of human immunodeficiency virus (HIV) in the world. Attrition (loss to follow-up and mortality) in people living with HIV/AIDS (PLWHA) already on treatment is a major challenge, undermining achievements of the antiretroviral treatment (ART) programme in Swaziland. The contributing factors to attrition in the Swazi context are unclear. This study aims to (1) estimate attrition from the ART programme 12 months after ART initiation in Swaziland, and (2) determine the predictors of attrition in PLWHA treated with ART in Swaziland. A retrospective cohort study using national baseline data was conducted. A competing-risk Cox proportional hazard regression was used to determine the predictors of attrition. We estimated 10·3% (95% confidence interval 10·1-10·6) attrition in 16 423 participants that initiated ART in 2012. Attrition was significantly associated with sex, age, district, treatment supporter at initiation, co-infection of HIV and TB, functional status, WHO clinical stage, and ownership of facility. Our study can form a base of policies, plans, and service delivery strategies for preventing and controlling attrition in Swaziland.
RESUMEN
We present a case of a 37-year-old man with a past history of a surgically removed thymoma, who presented with recurrent pulmonary infections and bronchiectasis. On further testing, he was found to have low total immunoglobulin levels, a constellation of findings known as Good's syndrome. He responded well to immunoglobulin replacement, in addition to the usual treatments for bronchiectasis. We present this case to emphasize the association of bronchiectasis, low immunoglobulins, and thymomas and the role of immunoglobulin replacement as a treatment option.
RESUMEN
BACKGROUND: The epidemiology, diagnosis, and treatment of motor neuron disease (MND) in Chinese patients are ill known. METHODS: A registered study of 461 MND patients was conducted across 10 facilities in 7 Chinese cities from February 2009 to March 2010. RESULTS: Patients were classified as amyotrophic lateral sclerosis (ALS) (84.4%), progressive bulbar palsy (PBP) (4.1%), progressive muscular atrophy (PMA) (10.4%), or primary lateral sclerosis (PLS) (0.9%). MND was predominant in men (men/women; 1.6:1.0). Mean onset age was 52.6 years, with the highest incidence being observed between 51 and 60 years. Notably, 26.0% of MND patients were employed in forestry, fishery, or animal husbandry industries. Ten cases (2.7%) reported family history of MND, and 54.2% exhibited cervical onset. MND was also associated with head/neck trauma. Non-invasive positive pressure ventilation was the most common supportive therapy. CONCLUSION: As a novel comprehensive report of a Chinese population, this study reveals that epidemiological characteristics of MND patients were similar to those observed in international populations. MND is age-related, male gender predominant, and may be associated with both environmental and genetic risk factors.
Asunto(s)
Enfermedad de la Neurona Motora/epidemiología , Adulto , Anciano , Anciano de 80 o más Años , Esclerosis Amiotrófica Lateral/diagnóstico , Esclerosis Amiotrófica Lateral/epidemiología , Esclerosis Amiotrófica Lateral/terapia , China/epidemiología , Femenino , Humanos , Incidencia , Masculino , Persona de Mediana Edad , Enfermedad de la Neurona Motora/diagnóstico , Enfermedad de la Neurona Motora/terapia , Factores SexualesRESUMEN
BACKGROUND: Currently, the laparoscopic technique is widely used for living donor nephrectomy. Does it provides adequate safety and benefits for the living donor? We performed a meta-analysis to evaluate the safety and efficacy of laparoscopic donor nephrectomy (LDN) as well as an analysis of postoperative quality of life compared with the open donor nephrectomy (ODN). METHODS: Eligible studies were identified from electronic databases: Cochrane CENTRAL, PubMed, and EMBASE as of October 2011. Relevant parameters explored by-using Review Manager V5.0 included operative time, warm ischemia time, intraoperative blood loss, hospital stay and time to return to work. RESULTS: Compared with ODN, LDN showed a shorter hospital stay (days; mean difference [MD]: -1.27, P < .00001) and time to return to work (days; MD: -16.35, P < .00001), less intraoperative blood loss (ml; MD: -101.23, P = .0001) without an increase among donor intraoperative and postoperative complications or compromise of recipient graft function. Hand-assisted laparoscopic donor nephrectomy (HLDN) showed a shorter warm ischemia time (minutes) than the standard laparoscopic donor nephrectomy (MD: -1.02, P < .00001). We also observed that hospital stay (days) significantly favored SLDN compared with HLDN (MD: 0.33, P < .005), but operative times, intraoperative estimated blood loss, and donor postoperative complications were not significantly different between them. Donor postoperative quality of life revealed only physical functioning and bodily pain scores to significantly favor LDN. CONCLUSIONS: LDN is a safe surgical procedure for a living donor.
Asunto(s)
Fallo Renal Crónico/terapia , Trasplante de Riñón/métodos , Laparoscopía/métodos , Donadores Vivos , Nefrectomía/métodos , Recolección de Tejidos y Órganos/métodos , Índice de Masa Corporal , Humanos , Tiempo de Internación , Oportunidad Relativa , Seguridad del Paciente , Periodo Posoperatorio , Calidad de Vida , Factores de TiempoRESUMEN
PURPOSE: This study was conducted to examine the atropine eye drop prescription trend for children diagnosed with myopia, and to determine the factors associated with the prescription of atropine eye drops. DESIGN: This was a population-based cross-sectional study. METHODS: This study was conducted using a national representative sample from the National Health Insurance (NHI) claims data. All school children between 4 and 18 years of age who had visited an ophthalmologist and were diagnosed with myopia between 2000 and 2007 were included herein. The main outcome measure was the proportion of subjects who were prescribed atropine eye drops in each year. Logistic regression was used to identify the factors associated with atropine eye drops being prescribed. RESULTS: The prescription of atropine eye drops for children diagnosed with myopia increased significantly from the school years 2000 (36.9%) to 2007 (49.5%). There was also a shift from prescribing high concentrations (0.5 and 1%) of atropine eye drops to lower concentration ones (0.3, 0.25, and 0.1%) within this period. Atropine eye drops were more frequently prescribed to 9-12-year-old children (OR=1.26-1.42, compared with those 7-8 years old), and to children from families with a high socioeconomic status (OR=1.19-1.25); however, they were less prescribed to those living in mid to low urbanized areas (OR=0.65-0.84). CONCLUSIONS: This study revealed an increasing trend of atropine eye drop prescription for children with myopia in Taiwan. Our study provides eye-care professionals worldwide a reference for the potential integration of atropine eye drops into their clinical practice toward children with myopia.
Asunto(s)
Atropina/administración & dosificación , Prescripciones de Medicamentos/estadística & datos numéricos , Midriáticos/administración & dosificación , Miopía/tratamiento farmacológico , Pautas de la Práctica en Medicina/estadística & datos numéricos , Adolescente , Niño , Preescolar , Estudios Transversales , Femenino , Humanos , Masculino , Miopía/epidemiología , Programas Nacionales de Salud/estadística & datos numéricos , Soluciones Oftálmicas , Oftalmología , Clase Social , Taiwán/epidemiología , Población Urbana/estadística & datos numéricosRESUMEN
A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 µm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 µm. Chlamydospores were spherical and 27 to 81 × 18 to 63 µm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.
RESUMEN
Relapsing polychondritis (RP) is a rare autoimmune disease that affects cartilage throughout the body, causing episodic and progressive inflammation. Although rare, RP has diverse acute and subacute nervous system complications, which may sometimes precede systemic manifestations. Here, we report four patients with RP who presented with meningoencephalitis or meningitis without infectious aetiology. In addition, we review the literature for this disease with regard to clinical manifestations and treatment options.
Asunto(s)
Meningoencefalitis/complicaciones , Policondritis Recurrente/complicaciones , Adulto , Ciclofosfamida/uso terapéutico , Femenino , Glucocorticoides/uso terapéutico , Humanos , Inmunosupresores/uso terapéutico , Masculino , Meningoencefalitis/tratamiento farmacológico , Metilprednisolona/uso terapéutico , Persona de Mediana Edad , Policondritis Recurrente/tratamiento farmacológico , Resultado del TratamientoRESUMEN
BACKGROUND: The Taiwanese government launched a new programme in November 2004 to support adults with intellectual disabilities living in smaller facilities. This paper aims to evaluate the service outcomes of this new residential scheme over 2 years including those residents who moved from an institution and those who moved from their family. METHODS: A one-group repeated-measures analysis was conducted for five interviews after the adults with intellectual disabilities entered the new environment. Forty-nine adults were initially studied (T1) and 29 adults remained in the homes until the end of the study (T5). RESULTS: This study found significant improvements over the 2 years in the residents' quality of life and family contact. The results also highlight a decrease in maladaptive behaviour among the residents moving from institution and an increase in choice making and family contact among the residents moving from family. No significant changes in adaptive behaviour and community inclusion were found. CONCLUSION: Results revealed that further policy changes and financial support including service quality assurance are required in order to improve service outcomes for adults living in the new residential scheme.
Asunto(s)
Discapacidad Intelectual/psicología , Discapacidad Intelectual/terapia , Evaluación de Resultado en la Atención de Salud , Instituciones Residenciales/organización & administración , Instituciones Residenciales/normas , Adaptación Psicológica , Adulto , Salud de la Familia , Femenino , Estudios de Seguimiento , Humanos , Masculino , Evaluación de Programas y Proyectos de Salud , Calidad de Vida , Conducta Social , Taiwán , Adulto JovenRESUMEN
SETTING: The deterioration of immunity in cancer patients may be associated with a higher incidence of tuberculosis (TB). OBJECTIVE: Despite several previous studies on cancer and TB, no population-based investigation has been published. We performed a nationwide population-based study to investigate the incidence of active TB among cancer patients, and the cancer-type specific risk factors related to TB. DESIGNS: This nationwide population-based retrospective cohort study was based on data obtained from the Taiwan National Health Insurance Database. A total of 16,487 cancer patients and 65,948 controls matched for age and sex were recruited. RESULTS: The incidence of TB per 100,000 person-years was 339 in the cancer patients and 202 in the controls, which gives a crude incidence rate ratio of 1.68 (95%CI 1.42-1.98). The hazard ratio (HR) was 1.67 (95%CI 1.42-1.96) after adjusting for age, sex and comorbidity. Cox regression showed that cancers of the aerodigestive tract, including oral, nasopharyngeal and oesophageal and lung cancer (HR 3.09, 95%CI 2.42-3.94) and haematological cancers, including non-Hodgkin's lymphoma and leukaemia (HR 3.22, 95%CI 1.98-5.22), were significant risk factors for TB. CONCLUSION: Cancer patients have a higher incidence of TB than controls. Patients with aerodigestive tract, lung and haematological cancers are especially vulnerable to TB.