Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 10 de 10
Filtrar
1.
Plant Dis ; 107(12): 3913-3923, 2023 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-37330632

RESUMEN

Options for managing southern blight of processing tomato (caused by Athelia rolfsii) in California are limited. The objectives of this study were to: (i) evaluate grafting with the resistant rootstock Maxifort for southern blight management in processing tomato and (ii) evaluate increasing the height of the graft union to further reduce incidence of southern blight in grafted plants. We evaluated two cultivars (Heinz 5608 or Heinz 8504) and a grafting factor with three levels (grafted to Maxifort rootstock with standard scion height, grafted to Maxifort rootstock at a tall height, and nongrafted) in a field study with natural inoculum or in inoculated greenhouse experiments. Southern blight severity was low in both greenhouse experiments in 2018 and 2019, and no consistent trends were observed. In field experiments in 2018 and 2019, mean incidence in nongrafted plots was 6.2 to 17.0 times higher when compared with either the standard or tall grafted treatments. Southern blight was numerically lower in tall grafted plots compared with standard, but the magnitude was small and not statistically significant. Based on our studies, grafting can reduce losses of processing tomato in California to southern blight, but increasing the height of the graft union does not offer a tangible benefit.


Asunto(s)
Solanum lycopersicum , Raíces de Plantas , California
2.
Mol Plant Microbe Interact ; 35(6): 450-463, 2022 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-35226812

RESUMEN

Downy mildew disease of spinach, caused by the oomycete Peronospora effusa, causes major losses to spinach production. In this study, the 17 chromosomes of P. effusa were assembled telomere-to-telomere, using Pacific Biosciences high-fidelity reads. Of these, 16 chromosomes are complete and gapless; chromosome 15 contains one gap bridging the nucleolus organizer region. This is the first telomere-to-telomere genome assembly for an oomycete. Putative centromeric regions were identified on all chromosomes. This new assembly enables a reevaluation of the genomic composition of Peronospora spp.; the assembly was almost double the size and contained more repeat sequences than previously reported for any Peronospora species. Genome fragments consistently underrepresented in six previously reported assemblies of P. effusa typically encoded repeats. Some genes annotated as encoding effectors were organized into multigene clusters on several chromosomes. Putative effectors were annotated on 16 of the 17 chromosomes. The intergenic distances between annotated genes were consistent with compartmentalization of the genome into gene-dense and gene-sparse regions. Genes encoding putative effectors were enriched in gene-sparse regions. The near-gapless assembly revealed apparent horizontal gene transfer from Ascomycete fungi. Gene order was highly conserved between P. effusa and the genetically oriented assembly of the oomycete Bremia lactucae; high levels of synteny were also detected with Phytophthora sojae. Extensive synteny between phylogenetically distant species suggests that many other oomycete species may have similar chromosome organization. Therefore, this assembly provides the foundation for genomic analyses of diverse oomycetes.[Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.


Asunto(s)
Oomicetos , Peronospora , Oomicetos/genética , Peronospora/genética , Enfermedades de las Plantas/microbiología , Spinacia oleracea , Telómero/genética
3.
Plant Dis ; 2022 Jan 27.
Artículo en Inglés | MEDLINE | ID: mdl-35084941

RESUMEN

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

4.
Plant Dis ; 103(4): 656-667, 2019 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-30823856

RESUMEN

Verticillium dahliae is widely distributed in potato and olive fields in Lebanon, causing serious economic losses. However, little is known about the inoculum source, population structure, and genetic diversity of the pathogen or the mechanisms of dissemination within Lebanon. To understand the population structure, a total of 203 isolates sampled from olive (n = 78) and potato (n = 125) were characterized for species, mating type, and race, and the genetic relationships were delineated using 13 microsatellite markers. All isolates except one from potato were V. dahliae, with 55.1 and 12.1% race 1, and 43.6 and 83.1% race 2 in olive and potato, respectively. The genetic structure of the studied population was best described by two large and two small clusters. Membership in the two large clusters was determined by the presence or absence of the effector gene Ave1. Furthermore, genetic structure was moderately associated with the host of origin but was weakly associated with the geographic origin. All but four isolates represented by three multilocus haploid genotypes were MAT1-2. This study identified a clear lack of gene flow between virulence genotypes of V. dahliae despite the proximity of these cropping systems and the wide distribution of genetic diversity among hosts and geographic regions in Lebanon.


Asunto(s)
Variación Genética , Olea , Solanum tuberosum , Verticillium , ADN de Hongos/genética , Flujo Génico , Genotipo , Líbano , Olea/microbiología , Solanum tuberosum/microbiología , Verticillium/genética
5.
Fungal Biol ; 122(8): 761-773, 2018 08.
Artículo en Inglés | MEDLINE | ID: mdl-30007427

RESUMEN

Dollar spot is one of the most destructive and economically important fungal diseases of amenity turfgrasses. The causal agent was first described in 1937 as the ascomycete Sclerotinia homoeocarpa. However, the genus-level taxonomic placement of this fungus has been the subject of an ongoing debate for over 75 y. Existing morphological and rDNA sequence evidence indicates that this organism is more appropriately placed in the family Rutstroemiaceae rather than the Sclerotiniaceae. Here we use DNA sequence data from samples of the dollar spot fungus and other members of the Rutstroemiaceae (e.g. Rutstroemia, Lanzia, Lambertella) collected throughout the world to determine the generic identity of the turfgrass dollar spot pathogen. Phylogenetic evidence from three nucleotide sequence markers (CaM, ITS and Mcm7; 1810-bp) confirmed that S. homoeocarpa is not a species of Sclerotinia; nor is it a member of any known genus in the Rutstroemiaceae. These data support the establishment of a new genus, which we describe here as Clarireedia gen. nov. The type species for the genus, Clarireedia homoeocarpa comb. nov., is described to accommodate the dollar spot fungus, and a neotype is designated. Three new species in this clade, Clarireedia bennettii sp. nov., Clarireedia jacksonii sp. nov., and Clarireedia monteithiana sp. nov. that also cause dollar spot disease are described. Clarireedia homoeocarpa and C. bennettii occur primarily on Festuca rubra (C3 grass) hosts and appear to be restricted to the United Kingdom. Clarireedia jacksonii and C. monteithiana occur on a variety of C3 and C4 grass hosts, respectively, and appear to be globally distributed. This resolved taxonomy puts to rest a major controversy amongst plant pathologists and provides a foundation for better understanding the nature and biology of these destructive pathogens.


Asunto(s)
Ascomicetos/clasificación , Ascomicetos/genética , Enfermedades de las Plantas/microbiología , Poaceae/microbiología , Ascomicetos/crecimiento & desarrollo , Ascomicetos/aislamiento & purificación , Calmodulina/genética , Análisis por Conglomerados , ADN de Hongos/química , ADN de Hongos/genética , ADN Espaciador Ribosómico/química , ADN Espaciador Ribosómico/genética , Técnicas Microbiológicas , Microscopía , Componente 7 del Complejo de Mantenimiento de Minicromosoma/genética , Filogenia , Análisis de Secuencia de ADN
6.
Fungal Genet Biol ; 81: 25-40, 2015 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-26049125

RESUMEN

Sclerotinia homoeocarpa F.T. Bennett is a filamentous member of Ascomycota that causes dollar spot, the most economically important disease of turfgrass worldwide. We sequenced and characterized the mating-type (MAT) locus of four recently-collected contemporary strains causing dollar spot, four historical type strains used to describe the fungus, and three species of Rutstroemiaceae. Moreover, we developed a multiplex PCR assay to screen 1019 contemporary isolates for mating-type. The organization of the MAT loci of all strains examined could be classified into one of four categories: (1) putatively heterothallic, as exemplified by all contemporary strains and three of four historical type strains; (2) putatively heterothallic with a deleted putative gene in the MAT1-2 idiomorph, as detected in strains from two recently-collected populations in the United Kingdom that show more similarity to historical strains; (3) putatively homothallic with close physical linkage between MAT1-1-1 and MAT1-2-1, as found in one historical type strain of S. homoeocarpa and two strains of Rutstroemia cuniculi; and (4) an unresolved but apparently homothallic organization in which strains contained both MAT1-1-1 and MAT1-2-1 but linkage between these genes and between the two flanking genes could not be confirmed, as identified in R. paludosa and Poculum henningsianum. In contemporary S. homoeocarpa populations there was no significant difference in the frequency of the two mating types in clone-corrected samples when analyzed on regional and local scales, suggesting sex may be possible in this pathogen. However, two isolates from Italy and twenty from California were heterokaryotic for both complete heterothallic MAT idiomorphs. Results from this study contribute to knowledge about mating systems in filamentous fungi and enhance our understanding of the evolution and biology of an important plant pathogen.


Asunto(s)
Ascomicetos/clasificación , Ascomicetos/genética , Genes Fúngicos , Genes del Tipo Sexual de los Hongos , Genotipo , Ascomicetos/aislamiento & purificación , California , Cartilla de ADN/genética , ADN de Hongos/química , ADN de Hongos/genética , Italia , Datos de Secuencia Molecular , Reacción en Cadena de la Polimerasa Multiplex/métodos , Análisis de Secuencia de ADN , Reino Unido
7.
Ecol Evol ; 4(22): 4399-428, 2014 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-25540699

RESUMEN

Advancing technologies have facilitated the ever-widening application of genetic markers such as microsatellites into new systems and research questions in biology. In light of the data and experience accumulated from several years of using microsatellites, we present here a literature review that synthesizes the limitations of microsatellites in population genetic studies. With a focus on population structure, we review the widely used fixation (F ST) statistics and Bayesian clustering algorithms and find that the former can be confusing and problematic for microsatellites and that the latter may be confounded by complex population models and lack power in certain cases. Clustering, multivariate analyses, and diversity-based statistics are increasingly being applied to infer population structure, but in some instances these methods lack formalization with microsatellites. Migration-specific methods perform well only under narrow constraints. We also examine the use of microsatellites for inferring effective population size, changes in population size, and deeper demographic history, and find that these methods are untested and/or highly context-dependent. Overall, each method possesses important weaknesses for use with microsatellites, and there are significant constraints on inferences commonly made using microsatellite markers in the areas of population structure, admixture, and effective population size. To ameliorate and better understand these constraints, researchers are encouraged to analyze simulated datasets both prior to and following data collection and analysis, the latter of which is formalized within the approximate Bayesian computation framework. We also examine trends in the literature and show that microsatellites continue to be widely used, especially in non-human subject areas. This review assists with study design and molecular marker selection, facilitates sound interpretation of microsatellite data while fostering respect for their practical limitations, and identifies lessons that could be applied toward emerging markers and high-throughput technologies in population genetics.

8.
Mol Ecol Resour ; 13(5): 966-8, 2013 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-23937578

RESUMEN

This article documents the addition of 234 microsatellite marker loci to the Molecular Ecology Resources Database. Loci were developed for the following species: Acipenser sinensis, Aleochara bilineata, Aleochara bipustulata, Barbus meridionalis, Colossoma macropomum, Delia radicum, Drosophila nigrosparsa, Fontainea picrosperma, Helianthemum cinereum, Liomys pictus, Megabalanus azoricus, Pelteobagrus vachelli, Pleuragramma antarcticum, Podarcis hispanica type 1A, Sardinella brasiliensis and Sclerotinia homoeocarpa. These loci were cross-tested on the following species: Acipenser dabryanus, Barbus balcanicus, Barbus barbus, Barbus cyclolepis, Drosophila hydei, Drosophila melanogaster, Drosophila obscura, Drosophila subobscura, Fontainea australis, Fontainea fugax, Fontainea oraria, Fontainea rostrata, Fontainea venosa, Podarcis bocagei, Podarcis carbonelli, Podarcis liolepis, Podarcis muralis and Podarcis vaucheri.


Asunto(s)
Repeticiones de Microsatélite , Animales , Biología Computacional/métodos , Bases de Datos Genéticas
9.
Plant Dis ; 95(11): 1433-1442, 2011 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-30731787

RESUMEN

Management of dollar spot (incited by Sclerotinia homoeocarpa) on golf course fairways is increasingly challenging. The objectives of this study were to determine the influence of mowing frequency and plant growth regulators (PGRs) on dollar spot severity and on the residual efficacy of fungicides for control of dollar spot. Two 4-month-long studies were conducted on 'Putter' creeping bentgrass (Agrostis stolonifera) maintained as a fairway at the University of Connecticut. Treatments were arranged in a three-by-three-by-five factorial that assessed the influence of mowing frequency (2, 4, or 6 days week-1) and PGRs (paclobutrazol, trinexapac-ethyl, or none) on dollar spot control by five fungicide treatments (boscalid, chlorothalonil, iprodione, propiconazole, or none). Turf was mowed in the afternoon hours to minimize the confounding effect of mowing frequency on leaf wetness duration. Treatments were initiated in the late spring of 2007 and 2008, and each fungicide treatment was reapplied only when dollar spot exceeded a threshold of five infection centers plot-1. In the absence of fungicides, dollar spot severity was reduced by 63 to 90% in plots treated with paclobutrazol and by 13 to 55% in plots treated with trinexapac-ethyl. Dollar spot severity was 23 to 50% lower in plots mown 2 days week-1 compared with those mown 6 days week-1. In cases where a significant interaction was observed between mowing frequency and PGRs, dollar spot was reduced on most rating dates in plots treated with trinexapacethyl that were mown 2 days week-1 compared with those mown 6 days week-1. Survival analysis of days until threshold was met revealed that duration of control of fungicides in plots receiving paclobutrazol were 28 to 84% longer compared with plots not receiving PGR. Duration of control by fungicides was generally similar between plots treated with trinexapac-ethyl and no PGR. In general, mowing frequency did not influence duration of control. Results from this study indicate that paclobutrazol could be used to increase the treatment interval of fungicides and that mowing frequency in the absence of dew is likely to have little influence on fungicide residual efficacy. When used without fungicides, PGRs and less frequent mowing may reduce dollar spot in situations where fungicide use is limited.

10.
Plant Dis ; 94(2): 186-195, 2010 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-30754261

RESUMEN

Chemical management of dollar spot in turf may lead to the development of Sclerotinia homoeocarpa populations with reduced fungicide sensitivity. The objective of this study was to determine the scope of S. homoeocarpa insensitivity to fungicides commonly used to control dollar spot on golf courses in the northeastern United States. A total of 965 and 387 isolates of S. homoeocarpa from intensively or individually sampled sites, respectively, were evaluated for in vitro sensitivity to iprodione, propiconazole, and thiophanate-methyl. Mean baseline sensitivities to iprodione and propiconazole were 0.2763 and 0.0016 µg a.i. ml-1, respectively, and all baseline isolates were sensitive to thiophanate-methyl at 1,000 µg a.i. ml-1. When compared with the baseline population, 14 and 18 of 20 total populations were less sensitive to iprodione and propiconazole, respectively. Individually sampled isolates obtained from fairways, putting greens, or tees were less sensitive to iprodione and propiconazole when compared with the baseline. For thiophanate-methyl, five populations were sensitive, six were resistant, and the remaining nine populations contained various proportions (2 to 92%) of resistant isolates. Individually sampled isolates obtained from fairways and putting greens were evaluated for associations in sensitivity among the three fungicides. A weak but positive correlation in sensitivity to iprodione and propiconazole was observed for isolates resistant to thiophanate-methyl but correlations for sensitive isolates were not significant. Furthermore, isolates with highly reduced sensitivity to iprodione clustered in a narrow range of propiconazole sensitivity. These data suggest the possible existence of resistance mechanisms common to diverse fungicide classes. Overall, results indicate that insensitivity of S. homoeocarpa to iprodione, propiconazole, and thiophanate-methyl exists in varying degrees on golf courses in the northeastern United States.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA