The alarmin IL-33 exacerbates pulmonary inflammation and immune dysfunction in SARS-CoV-2 infection.

Dysregulated host immune responses contribute to disease severity and worsened prognosis in COVID-19 infection and the underlying mechanisms are not fully understood. In this study, we observed that IL-33, a damage-associated molecular pattern molecule, is significantly increased in COVID-19 patients and in SARS-CoV-2-infected mice. Using IL-33-/- mice, we demonstrated that IL-33 deficiency resulted in significant decreases in bodyweight loss, tissue viral burdens, and lung pathology. These improved outcomes in IL-33-/- mice also correlated with a reduction in innate immune cell infiltrates, i.e., neutrophils, macrophages, natural killer cells, and activated T cells in inflamed lungs. Lung RNA-seq results revealed that IL-33 signaling enhances activation of inflammatory pathways, including interferon signaling, pathogen phagocytosis, macrophage activation, and cytokine/chemokine signals. Overall, these findings demonstrate that the alarmin IL-33 plays a pathogenic role in SARS-CoV-2 infection and provides new insights that will inform the development of effective therapeutic strategies for COVID-19.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Sensitive detection of synthetic response to cancer immunotherapy driven by gene paralog pairs.

Emerging immunotherapies such as immune checkpoint blockade (ICB) and chimeric antigen receptor T-cell (CAR-T) therapy have revolutionized cancer treatment and have improved the survival of patients with multiple cancer types. Despite this success many patients are unresponsive to these treatments or relapse following treatment. CRISPR activation and knockout (KO) screens have been used to identify novel single gene targets that can enhance effector T cell function and promote immune cell targeting and eradication of tumors. However, cancer cells often employ multiple genes to promote an immunosuppressive pathway and thus modulating individual genes often has a limited effect. Paralogs are genes that originate from common ancestors and retain similar functions. They often have complex effects on a particular phenotype depending on factors like gene family similarity, each individual gene's expression and the physiological or pathological context. Some paralogs exhibit synthetic lethal interactions in cancer cell survival; however, a thorough investigation of paralog pairs that could enhance the efficacy of cancer immunotherapy is lacking. Here we introduce a sensitive computational approach that uses sgRNA sets enrichment analysis to identify cancer-intrinsic paralog pairs which have the potential to synergistically enhance T cell-mediated tumor destruction. We have further developed an ensemble learning model that uses an XGBoost classifier and incorporates features such as gene characteristics, sequence and structural similarities, protein-protein interaction (PPI) networks, and gene coevolution data to predict paralog pairs that are likely to enhance immunotherapy efficacy. We experimentally validated the functional significance of these predicted paralog pairs using double knockout (DKO) of identified paralog gene pairs as compared to single gene knockouts (SKOs). These data and analyses collectively provide a sensitive approach to identify previously undetected paralog pairs that can enhance cancer immunotherapy even when individual genes within the pair has a limited effect.

Identification of a Hippocampus-to-Zona Incerta Projection involved in Motor Learning.

Motor learning (ML), which plays a fundamental role in growth and physical rehabilitation, involves different stages of learning and memory processes through different brain regions. However, the neural mechanisms that underlie ML are not sufficiently understood. Here, a previously unreported neuronal projection from the dorsal hippocampus (dHPC) to the zona incerta (ZI) involved in the regulation of ML behaviors is identified. Using recombinant adeno-associated virus, the projections to the ZI are surprisingly identified as originating from the dorsal dentate gyrus (DG) and CA1 subregions of the dHPC. Furthermore, projection-specific chemogenetic and optogenetic manipulation reveals that the projections from the dorsal CA1 to the ZI play key roles in the acquisition and consolidation of ML behaviors, whereas the projections from the dorsal DG to the ZI mediate the retrieval/retention of ML behaviors. The results reveal new projections from the dorsal DG and dorsal CA1 to the ZI involved in the regulation of ML and provide insight into the stages over which this regulation occurs.

Assessment of Left Ventricular Diastolic Function in Patients with Diffuse Large B-cell Lymphoma after Anthracycline Chemotherapy by using Vector Flow Mapping.

BACKGROUND: Patients with diffuse large B-cell lymphoma (DLBCL) often experience a poor prognosis due to cardiac damage induced by anthracycline chemotherapy, with left ventricular diastolic dysfunction manifesting early. Vector Flow Mapping (VFM) is a novel technology, and its effectiveness in detecting left ventricular diastolic dysfunction following anthracycline chemotherapy remains unverified. OBJECTS: This study evaluates left ventricular diastolic function in DLBCL patients after anthracycline chemotherapy using vector flow mapping (VFM). MATERIALS AND METHODS: We prospectively enrolled 54 DLBCL patients who had undergone anthracycline chemotherapy (receiving a minimum of 4 cycles) as the case group and 54 age- and sex-matched individuals as controls. VFM assessments were conducted in the case group pre-chemotherapy (T0), post-4 chemotherapy cycles (T4), and in the control group. Measurements included basal, middle, and apical segment energy loss (ELb, ELm, ELa) and intraventricular pressure differences (IVPDb, IVPDm, IVPDa) across four diastolic phases: isovolumic relaxation (D1), rapid filling (D2), slow filling (D3), and atrial contraction (D4). RESULTS: When comparing parameters between the control and case groups at T0, no significant differences were observed in general data, conventional ultrasound parameters, and VFM parameters (all P > 0.05). From T0 to T4, ELa significantly increased throughout the diastole cycle (all P < 0.05); ELm increased only during D4 (all P < 0.05); and ELb increased during D1, D2, and D4 (all P < 0.05). All IVPD measurements (IVPDa, IVPDm, IVPDb) increased during D1 and D4 (all P < 0.05) but decreased during D2 and D3 (all P < 0.05). Significant positive correlations were identified between ELa-D4, IVPDa-D4, and parameters A, e', E/e,' and LAVI (all r > 0.5, all P < 0.001). Negative correlations were noted with E/A for ELa- D4 IVPDa-D4 (all r < -0.5, all P < 0.001). Positive correlations were observed for IVPDa-D1, IVPDa-D2 with E, E/e', and LAVI (0.3

Different reference genomes determine different results: Comparing SNP calling in RAD-seq of Engelhardia roxburghiana using different reference genomes.

Advances in next-generation sequencing (NGS) have significantly reduced the cost and improved the efficiency of obtaining single nucleotide polymorphism (SNP) markers, particularly through restriction site-associated DNA sequencing (RAD-seq). Meanwhile, the progression in whole genome sequencing has led to the utilization of an increasing number of reference genomes in SNP calling processes. This study utilized RAD-seq data from 242 individuals of Engelhardia roxburghiana, a tropical tree of the walnut family (Juglandaceae), with SNP calling conducted using the STACKS pipeline. We aimed to compare both reference-based approaches, namely, employing a closely related species as the reference genome versus the species itself as the reference genome, to evaluate their respective merits and limitations. Our findings indicate a substantial discrepancy in the number of obtained SNPs between using a closely related species as opposed to the species itself as reference genomes, the former yielded approximately an order of magnitude fewer SNPs compared to the latter. While the missing rate of individuals and sites of the final SNPs obtained in the two scenarios showed no significant difference. The results showed that using the reference genome of the species itself tends to be prioritized in RAD-seq studies. However, if this is unavailable, considering closely related genomes is feasible due to their wide applicability and low missing rate as alternatives. This study contributes to enrich the understanding of the impact of SNP acquisition when utilizing different reference genomes.

Enhancing Candida auris Surveillance in High-Risk Settings by Implementing a High-Throughput Molecular Assay on the Hologic Fusion Open Access Platform.

Candida auris, a resilient pathogenic yeast with frequent multidrug resistance, presents a persistent challenge in healthcare settings. The timely identification of C. auris is crucial for infection control and prevention, especially in facilities facing unique hurdles, such as our institution, which serves four major hospitals and approximately 80% of the Texas inmate population. Understaffing, communal living, and financial constraints exacerbate infection control issues. To address common staff shortages, streamline testing services, and enhance testing efficiency, there was a pressing need for rapid and high-throughput detection of C. auris. This study presents the validation and utility of an assay implemented on the Hologic Fusion Open Access platform using samples collected from high-risk patients' axilla and groin areas, as well as environmental swab samples from patient rooms. Our assay complemented efforts to control C. auris outbreaks within our healthcare system, providing valuable insights into its presence within surveillance samples. This assay demonstrated the value of high-throughput molecular detection platforms in challenging healthcare environments by aiding infection preventionists in containing the spread of C. auris and preventing nosocomial infections. Our research contributes essential data on the suitability and performance of the Hologic Fusion Open Access platform for C. auris detection. These findings hold significant implications for enhancing surveillance and control measures in high-risk settings, making a significant impact on the field of infection control and prevention.

In Situ Construction of a Hydrophobic Honeycomb-like Structured ZnMoO4 Coating Applied for Enhancing Zinc Anode Performance.

Aqueous zinc-ion batteries (AZIBs) suffer from sharp cycling deterioration due to serious interfacial side reactions and corrosion problems on the zinc anode. Herein, an efficacious approach to construct hydrophobic ZnMoO4 coatings on Zn (denoted as Zn@ZMO) is proposed to mitigate direct contact between the zinc anode and electrolyte and enhance its cycle life. The hydrophobic ZnMoO4 layer (contact angle = 128°) with a honeycomb-like structure is prepared by an in situ liquid phase deposition method. The as-prepared ZnMoO4 coating exhibits persistent corrosion protection for Zn through 30 days of immersion in a 2 M ZnSO4 electrolyte, indicating excellent stability of the ZnMoO4 layer and ensuring its available application in AZIBs. Unique microchannels in this kind of honeycomb-like structured coating favor Zn2+ ion diffusion and ease of ion transport, especially at high current cycling. Its robust surface exclusion can effectively counter other side reactions induced by water, simultaneously. As a result, the Zn@ZMO symmetrical cell shows a remarkable cycle lifespan exceeding 2700 h at 1 mA cm-2/1 mA h cm-2, surpassing that of the bare zinc cell by more than 100 folds. At a current density of 5 A g-1, the Zn@ZMO//V2O5 cell can still achieve a specific capacity of 167.0 mA h g-1 after 500 cycles with a capacity retention rate of 88%, which demonstrates its long-term cycling stability.

Advances in the role and mechanism of fibroblasts in fracture healing.

With the development of social population ageing, bone fracture has become a global public health problem due to its high morbidity, disability and mortality. Fracture healing is a complex phenomenon involving the coordinated participation of immigration, differentiation and proliferation of inflammatory cells, angioblasts, fibroblasts, chondroblasts and osteoblasts which synthesize and release bioactive substances of extracellular matrix components, Mortality caused by age-related bone fractures or osteoporosis is steadily increasing worldwide as the population ages. Fibroblasts play an important role in the process of fracture healing. However, it is not clear how the growth factors and extracellular matrix stiffness of the bone-regeneration microenvironment affects the function of osteoblasts and fibroblasts in healing process. Therefore, this article focuses on the role of fibroblasts in the process of fracture healing and mechanisms of research progress.

Role of GABAB receptors in cognition and EEG activity in aged APP and PS1 transgenic mice.

Alzheimer's disease (AD) is the most common cause of dementia in the elderly. Recent evidence suggests that gamma-aminobutyric acid B (GABAB) receptor-mediated inhibition is a major contributor to AD pathobiology, and GABAB receptors have been hypothesized to be a potential target for AD treatment. The aim of this study is to determine how GABAB regulation alters cognitive function and brain activity in an AD mouse model. Early, middle and late stage (8-23 months) amyloid precursor protein (APP) and presenilin 1 (PS1) transgenic mice were used for the study. The GABAB agonist baclofen (1 and 2.5 mg/kg, i. p.) and the antagonist phaclofen (0.5 mg/kg, i. p.) were used. Primarily, we found that GABAB activation was able to improve spatial and/or working memory performance in early and late stage AD animals. In addition, GABAB activation and inhibition could regulate global and local EEG oscillations in AD animals, with activation mainly regulating low-frequency activity (delta-theta bands) and inhibition mainly regulating mid- and high-frequency activity (alpha-gamma bands), although the regulated magnitude at some frequencies was reduced in AD. The cognitive improvements in AD animals may be explained by the reduced EEG activity in the theta frequency band (2-4 Hz). This study provides evidence for a potential therapeutic effect of baclofen in the elderly AD brain and for GABAB receptor-mediated inhibition as a potential therapeutic target for AD.

Mind shift I: Fructus Aurantii - Rhizoma Chuanxiong synergistically anchors stress-induced depression-like behaviours and gastrointestinal dysmotility cluster by regulating psycho-immune-neuroendocrine network.

BACKGROUND: Researchers have not studied the integrity, orderly correlation, and dynamic openness of complex organisms and explored the laws of systems from a global perspective. In the context of reductionism, antidepressant development formerly focused on advanced technology and molecular details, clear targets and mechanisms, but the clinical results were often unsatisfactory. PURPOSE: MDD represents an aggregate of different and highly diverse disease subtypes. The co-occurrence of stress-induced nonrandom multimorbidity is widespread, whereas only a fraction of the potential clusters are well known, such as the MDD-FGID cluster. Mapping these clusters, and determining which are nonrandom, is vital for discovering new mechanisms, developing treatments, and reconfiguring services to better meet patient needs. STUDY DESIGN: Acute stress 15-minute forced swimming (AFS) or CUMS protocols can induce the nonrandom MDD-FGID cluster. Multiple biological processes of rats with depression-like behaviours and gastrointestinal dysmobility will be captured under conditions of stress, and the Fructus Aurantii-Rhizoma Chuanxiong (ZQCX) decoction will be utilized to dock the MDD-FGID cluster. METHODS/RESULTS: Here, Rhizoma Chuanxiong, one of the seven components of Chaihu-shugan-San, elicited the best antidepressant effect on CUMS rats, followed by Fructus Aurantii. ZQCX reversed AFS-induced depression-like behaviours and gastrointestinal dysmobility by regulating the glutamatergic system, AMPAR/BDNF/mTOR/synapsin I pathway, ghrelin signalling and gastrointestinal nitric oxide synthase. Based on the bioethnopharmacological analysis strategy, the determined meranzin hydrate (MH) and senkyunolide I (SI) by UPLC-PDA, simultaneously absorbed by the jejunum and hippocampus of rats, have been considered major absorbed bioactive compounds acting on behalf of ZQCX. Cotreatment with MH and SI at an equivalent dose in ZQCX synergistically replicated over 50.33 % efficacy of the parent formula in terms of antidepressant and prokinetic actions by modulating neuroinflammation and ghrelin signalling. CONCLUSION: Brain-centric mind shifts require the integration of multiple central and peripheral systems and the elucidation of the underlying neurobiological mechanisms that ultimately contribute to novel therapeutic options. Ghrelin signalling and the immune system may partially underlie multimorbidity vulnerability, and ZQCX anchors stress-induced MDD-FGID clusters by docking them. Combining the results of micro details with the laws of the macro world may be more effective in finding treatments for MDD.

Is Takotsubo syndrome induced by patent ductus arteriosus occlusion?

Takotsubo syndrome (TTS), commonly referred to as "broken heart syndrome," is a distinctive form of acute and reversible heart failure that primarily affects young to middle-aged individuals, particularly women. While emotional or physical stressors often trigger TTS, rare cases have been linked to interventional procedures for congenital heart disease (CHD). Despite its recognition, the exact causes of TTS remain elusive. Research indicates that dysregulation in autonomic nerve function, involving sympathetic and parasympathetic activities, plays a pivotal role. Genetic factors, hormonal influences like estrogen, and inflammatory processes also contribute, unveiling potential gender-specific differences in its occurrence. Understanding these multifaceted aspects of TTS is crucial for refining clinical approaches and therapies. Continued research efforts will not only deepen our understanding of this syndrome but also pave the way for more targeted and effective diagnostic and treatment strategies. In this report, we conduct an in-depth analysis of a case involving a TTS patient, examining the illness progression and treatment procedures. The aim of this analysis is to enhance the understanding of TTS among primary care physicians. By delving into this case, we aspire to prevent misdiagnosis of typical TTS cases that patients may present, thereby ensuring a more accurate diagnosis and appropriate treatment.

Genomic basis of environmental adaptation in the widespread poly-extremophilic Exiguobacterium group.

Delineating cohesive ecological units and determining the genetic basis for their environmental adaptation are among the most important objectives in microbiology. In the last decade, many studies have been devoted to characterizing the genetic diversity in microbial populations to address these issues. However, the impact of extreme environmental conditions, such as temperature and salinity, on microbial ecology and evolution remains unclear so far. In order to better understand the mechanisms of adaptation, we studied the (pan)genome of Exiguobacterium, a poly-extremophile bacterium able to grow in a wide range of environments, from permafrost to hot springs. To have the genome for all known Exiguobacterium type strains, we first sequenced those that were not yet available. Using a reverse-ecology approach, we showed how the integration of phylogenomic information, genomic features, gene and pathway enrichment data, regulatory element analyses, protein amino acid composition, and protein structure analyses of the entire Exiguobacterium pangenome allows to sharply delineate ecological units consisting of mesophilic, psychrophilic, halophilic-mesophilic, and halophilic-thermophilic ecotypes. This in-depth study clarified the genetic basis of the defined ecotypes and identified some key mechanisms driving the environmental adaptation to extreme environments. Our study points the way to organizing the vast microbial diversity into meaningful ecologically units, which, in turn, provides insight into how microbial communities adapt and respond to different environmental conditions in a changing world.

Identification of therapeutic targets and prognostic biomarkers in the Siglec family of genes in tumor immune microenvironment of sarcoma.

Sarcomas (SARC) are a highly heterogeneous cancer type that is prone to recurrence and metastasis. Numerous studies have confirmed that Siglecs are involved in immune signaling and play a key role in regulating immune responses in inflammatory diseases and various cancers. However, studies that systematically explore the therapeutic and prognostic value of Siglecs in SARC patients are very limited. The online databases GEPIA, UALCAN, TIMER, The Kaplan-Meier Plotter, GeneMANIA, cBioPortal, and STING were used in this study. IHC staining was performed on the collected patient tissues, and clinical data were statistically analyzed. The transcript levels of most Siglec family members showed a high expression pattern in SARC. Compared with normal tissues, Siglec-5, Siglec-10, and Siglec-12 were abnormally highly expressed in tumor tissues. Importantly, Siglec-15 was significantly associated with poor prognosis. Functional enrichment analysis showed that the Siglec family was mainly enriched in hematopoietic cell lineages. The genes associated with molecular mutations in the Siglec family were mainly TP53 and MUC16, among which Siglec-2 and Siglec-15 were significantly associated with the survival of patients. The expression levels of all Siglec family members were significantly correlated with various types of immune cells (B cells, CD8 + T cells, CD4 + T cells, macrophages, neutrophils and dendritic cells). Furthermore, a significant correlation was found between the somatic copy number changes of all Siglec molecules and the abundance of immune infiltrates. Our study paints a promising vision for the development of immunotherapy drugs and the construction of prognostic stratification models by investigating the therapeutic and prognostic potential of the Siglec family for SARC.

Dynamic reconfiguration of brain coactivation states that underlying working memory correlates with cognitive decline in clinically unimpaired older adults.

Impairments in working memory (WM) are evident in both clinically diagnosed patients with mild cognitive decline and older adults at risk, as indicated by lower scores on neuropsychological tests. Examining the WM-related neural signatures in at-risk older adults becomes essential for timely intervention. WM functioning relies on dynamic brain activities, particularly within the frontoparietal system. However, it remains unclear whether the cognitive decline would be reflected in the decreased dynamic reconfiguration of brain coactivation states during WM tasks. We enrolled 47 older adults and assessed their cognitive function using the Montreal Cognitive Assessment. The temporal dynamics of brain coactivations during a WM task were investigated through graph-based time-frame modularity analysis. Four primary recurring states emerged: two task-positive states with positive activity in the frontoparietal system (dorsal attention and central executive); two task-negative states with positive activity in the default mode network accompanied by negative activity in the frontoparietal networks. Heightened WM load was associated with increased flexibility of the frontoparietal networks, but the cognitive decline was correlated with reduced capacity for neuroplastic changes in response to increased task demands. These findings advance our understanding of aberrant brain reconfiguration linked to cognitive decline, potentially aiding early identification of at-risk individuals.

Dorsal and ventral fronto-amygdala networks underlie risky decision-making in age-related cognitive decline.

Older adults often have difficulty in making decisions under uncertainty, increasing the risk of financial exploitation. However, it is still under investigation about the extent to which cognitive decline influences risky decision-making and the underlying neural correlates. We hypothesized that the individual differences of risk-taking behavior depend on cognitive integrity, in which the dorsal and ventral fronto-amygdala connectivity would play dissociable roles. In the current study, thirty-six young and 51 older adults were tested with the Iowa gambling task combing resting-state and task-related functional magnetic resonance imaging. The results showed significant changes in behaviors and the fronto-amygdala network in older adults relative to young adults. More importantly, age-effect on risk-taking behaviors was remarkably different in cognitively normal and impaired older adults. In resting-state analysis, task performance was positively correlated with the ventral fronto-amygdala connectivity and negatively correlated with the dorsal fronto-amygdala connectivity in cognitively impaired older adults, compared with cognitively normal individuals. Furthermore, task-related analysis confirmed the relationships between dorsal/ventral fronto-amygdala network and risk-taking behaviors depending on cognitive integrity. These findings indicate that the fronto-amygdala network is crucial for understanding altered risky decision-making in aging, suggesting dissociable contributions of the dorsal and ventral pathways in the context of cognitive decline.

Quantitative information from gadobenate dimeglumine-enhanced MRI can predict proliferative subtype of solitary hepatocellular carcinoma: a multicenter retrospective study.

OBJECTIVES: To investigate the value of quantitative parameters derived from gadobenate dimeglumine-enhanced magnetic resonance imaging (MRI) for predicting molecular subtype of hepatocellular carcinoma (HCC) and overall survival. METHODS: This multicenter retrospective study included 218 solitary HCC patients who underwent gadobenate dimeglumine-enhanced MRI. All HCC lesions were resected and pathologically confirmed. The lesion-to-liver contrast enhancement ratio (LLCER) and lesion-to-liver contrast (LLC) were measured in the hepatobiliary phase. Potential risk factors for proliferative HCC were assessed by logistic regression. The ability of LLCER and LLC to predict proliferative HCC was assessed by the receiver operating characteristic (ROC) curve. Prognostic factors were evaluated using the Cox proportional hazards regression model for survival outcomes. RESULTS: LLCER was an independent predictor of proliferative HCC (odds ratio, 0.015; 95% confidence interval [CI], 0.008-0.022; p < 0.001). The area under the ROC curve was 0.812 (95% CI, 0.748-0.877), higher than that of LLC, alpha-fetoprotein > 100 ng/ml, satellite nodules, and rim arterial phase hyperenhancement (all p ≤ 0.001). HCC patients with LLCER < -4.59% had a significantly higher incidence of proliferative HCC than those with the LLCER ≥ -4.59%. During the follow-up period, LLCER was an independent predictor of overall survival (hazard ratio, 0.070; 95% CI, 0.015-0.324; p = 0.001) in HCC patients. CONCLUSIONS: Gadobenate dimeglumine-enhanced quantitative parameter in the hepatobiliary phase can predict the proliferative subtype of solitary HCC with a moderately high accuracy. CLINICAL RELEVANCE STATEMENT: Quantitative information from gadobenate dimeglumine-enhanced MRI can provide crucial information on hepatocellular carcinoma subtypes. It might be valuable to design novel therapeutic strategies, such as targeted therapies or immunotherapy. KEY POINTS: • The lesion-to-liver contrast enhancement ratio (LLCER) is an independent predictor of proliferative hepatocellular carcinoma (HCC). • The ability of LLCER to predict proliferative HCC outperformed lesion-to-liver contrast, alpha-fetoprotein > 100 ng/ml, satellite nodules, and rim arterial phase hyperenhancement. • HCC patients with LLCER < -4.59% had a significantly higher incidence of proliferative HCC than those with the LLCER ≥ -4.59%.

Continuous high-frequency repetitive transcranial magnetic stimulation at extremely low intensity affects exploratory behavior and spatial cognition in mice.

High-frequency repetitive transcranial magnetic stimulation (HF-rTMS) has been shown to be effective for cognitive intervention. However, whether HF-rTMS with extremely low intensity could influence cognitive functions is still under investigation. The present study systematically investigated the effects of continuous 40 Hz and 10 Hz rTMS on cognition in young adult mice at extremely low intensity (10 mT and 1 mT) for 11 days (30 min/day). Cognitive functions were assessed using diverse behavioral tasks, including the open field, Y-maze, and Barnes maze paradigms. We found that 40 Hz rTMS significantly impaired exploratory behavior and spatial memory in both 10 mT and 1 mT conditions. In addition, 40 Hz rTMS induced remarkably different effects on exploratory behavior between 10 mT and 1mT, compared to 10 Hz stimulation. Our results indicate that extremely low intensity rTMS can significantly alter cognitive performance depending on intensity and frequency, shedding light on the understanding of the mechanism of rTMS effects.

Upregulation of Hsp27 via further inhibition of histone H2A ubiquitination confers protection against myocardial ischemia/reperfusion injury by promoting glycolysis and enhancing mitochondrial function.

Research suggests that ischemic glycolysis improves myocardial tolerance to anoxia and low-flow ischemia. The rate of glycolysis during ischemia reflects the severity of the injury caused by ischemia and subsequent functional recovery following reperfusion. Histone H2AK119 ubiquitination (H2Aub) is a common modification that is primarily associated with gene silencing. Recent studies have demonstrated that H2Aub contributes to the development of cardiovascular diseases. However, the underlying mechanism remains unclear. This study identified Hsp27 (heat shock protein 27) as a H2Aub binding protein and explored its involvement in mediating glycolysis and mitochondrial function. Functional studies revealed that inhibition of PRC1 (polycomb repressive complex 1) decreased H2Aub occupancy and promoted Hsp27 expression through inhibiting ubiquitination. Additionally, it increased glycolysis by activating the NF-κB/PFKFB3 signaling pathway during myocardial ischemia. Furthermore, Hsp27 reduced mitochondrial ROS production by chaperoning COQ9, and suppressed ferroptosis during reperfusion. A delivery system was developed based on PCL-PEG-MAL (PPM)-PCM-SH (CWLSEAGPVVTVRALRGTGSW) to deliver PRT4165 (PRT), a potent inhibitor of PRC1, to damaged myocardium, resulting in decreased H2Aub. These findings revealed a novel epigenetic mechanism connecting glycolysis and ferroptosis in protecting the myocardium against ischemia/reperfusion injury.

The Protective Effect of Auricularia cornea var. Li. Polysaccharide on Alcoholic Liver Disease and Its Effect on Intestinal Microbiota.

This study's objective was to examine the protective effect and mechanism of a novel polysaccharide (AYP) from Auricularia cornea var. Li. on alcoholic liver disease in mice. AYP was extracted from the fruiting bodies of Auricularia cornea var. Li. by enzymatic extraction and purified by DEAE-52 and Sephacryl S-400. Structural features were determined using high-performance liquid chromatography, ion exchange chromatography and Fourier-transform infrared analysis. Additionally, alcoholic liver disease (ALD) mice were established to explore the hepatoprotective activity of AYP (50, 100 and 200 mg/kg/d). Here, our results showed that AYP presented high purity with a molecular weight of 4.64 × 105 Da. AYP was composed of galacturonic acid, galactose, glucose, arabinose, mannose, xylose, rhamnose, ribos, glucuronic acid and fucose (molar ratio: 39.5:32.9:23.6:18.3:6.5:5.8:5.8:3.3:2:1.1). Notably, AYP remarkably reduced liver function impairment (alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglyceride (TG), total cholesterol (TC)), nitric oxide (NO) and malondialdehyde (MDA) of the liver and enhanced the activity of antioxidant enzymes (superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and glutathione (gGSH)) in mice with ALD. Meanwhile, the serum level of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) and interleukin-1ß (IL-1ß) were reduced in ALD mice treated by AYP. Furthermore, the AYPH group was the most effective and was therefore chosen to further investigate its effect on the intestinal microbiota (bacteria and fungi) of ALD mice. Based on 16s rRNA and ITS-1 sequencing data, AYP influenced the homeostasis of intestinal microbiota to mitigate the damage of ALD mice, possibly by raising the abundance of favorable microbiota (Muribaculaceae, Lachnospiraceae and Kazachstania) and diminishing the abundance of detrimental microbiota (Lactobacillus, Mortierella and Candida). This discovery opens new possibilities for investigating physiological activity in A. cornea var. Li. and provides theoretical references for natural liver-protecting medication research.