RESUMEN
BACKGROUND: The genotype characteristics and their associated clinical phenotypes in patients with aniridia were analyzed to explore pathogenic variants using whole-exome sequencing. METHODS: One patient with aniridia was enrolled at the Beijing Tongren Hospital. Comprehensive ophthalmic and general examinations were performed on the patient. DNA was extracted from the patient, and whole-exome sequencing was performed to identify the causative variant. The pathogenicity of the variant was predicted using in silico analysis and evaluated according to American College of Medical Genetics and Genomics guidelines. Relationships between genetic variants and clinical features were analyzed. RESULTS: In addition to the classical aniridia phenotype showing complete iris aplasia, foveal hypoplasia, and ectopic lentis, the patient also exhibited spontaneous reattachment rhegmatogenous retinal detachment (SRRRD). Whole-exome sequencing identified a novel heterozygous variant, exon8:c.640_646del:p.R214Pfs*28. CONCLUSIONS: The present study broadens the range of genetic variants described in aniridia and presents an aniridia patient with SRRRD.
Asunto(s)
Aniridia , Desprendimiento de Retina , Humanos , Aniridia/complicaciones , Aniridia/genética , Aniridia/patología , Pueblos del Este de Asia , Genotipo , Proteínas de Homeodominio/genética , Mutación , Factor de Transcripción PAX6/genética , LinajeRESUMEN
PURPOSE: Alström Syndrome (AS) is an autosomal recessive hereditary disease with the characteristics of multiorgan dysfunction. Due to the heterogeneity of clinical manifestations of AS, genetic testing is crucial for the diagnosis of AS. Herein, we used whole-exome sequencing (WES) to determine the genetic causes and characterize the clinical features of three affected patients in two Chinese families with Alström Syndrome. MATERIALS AND METHODS: Three affected patients (initially diagnosed as achromatopsia). and five asymptomatic members were recruited for both genetic and clinical tests. The complete ophthalmic examinations and systemic examinations were performed on all participants. Whole exome sequencing (WES) was performed for mutation detection. The silico analysis was also applied to predict the pathogenesis of identified pathogenic variants. RESULTS: In family 1, the proband showed low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that she carried a compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asp2252Tyr)) and NM_015120.4:c.11641_11642del (NP_055935.4:p.(Val3881ThrfsTer11)). Further systemic examinations showed short stature, acanthosis nigricans, and sensorineural hearing loss. In family 2, two affected siblings presented the low vision, hyperopia, photophobia, nystagmus, and total color blindness. DNA analysis revealed that they carried a same compound heterozygote with two novel pathogenic variants in the ALMS1 gene NM_015120.4:c.10379del (NP_055935.4:p.(Asn3460IlefsTer49)), NM_015120.4:c.10819C > T (NP_055935.4:p.(Arg3607Trp)). Further systemic examinations showed obesity and mild abnormalities of lipid metabolism. According to the genetic testing results and further systemic analysis, the three affected patients were finally diagnosed as Alström Syndrome (AS). CONCLUSIONS: We found two new compound heterozygous pathogenic variants of the ALMS1 gene and determined the diagnosis as Alström Syndrome in three patients of two Chinese families. Our study extends the genotypic and phenotypic spectrums for ALMS1 -AS and emphasizes the importance of gene testing in assisting the clinical diagnosis for cases with phenotypic diversities, which would help the AS patients with early diagnosis and treatment to reduce future systemic damage.
Asunto(s)
Síndrome de Alstrom , Hiperopía , Baja Visión , Síndrome de Alstrom/diagnóstico , Síndrome de Alstrom/genética , Proteínas de Ciclo Celular/genética , China , Defectos de la Visión Cromática , ADN/genética , Femenino , Humanos , Mutación , Linaje , FotofobiaRESUMEN
BACKGROUND: This study was to report a novel CREBBP mutation and phenotype in a child with Rubinstein-Taybi syndrome. METHODS: Case report of a 9-year-old boy. RESULTS: We described the patient's clinical manifestations in detail, and found that in addition to the typical systemic manifestations of the syndrome, the outstanding manifestation of the child was severe intellectual deficiency and prominent ocular abnormalities. Whole-exome sequencing and sanger sequencing were performed on the patient and his parents, a large intragenic deletion, covering the exon 1 region and part of the intron 1 region of the TRAP1 gene, and the entire region from intron 27 to exon 30 of the CREBBP gene (chr16:3745393-3783894) was identified on the patient. This mutation affected the CREBBP histone acetyltransferase (HAT) domain. CONCLUSIONS: This findings in our patient add to the spectrum of genetic variants described in Rubinstein-Taybi syndrome and present a RSTS patient with various ocular anomalies including early onset glaucoma.
Asunto(s)
Síndrome de Rubinstein-Taybi , Proteína de Unión a CREB/genética , Proteínas HSP90 de Choque Térmico/genética , Humanos , Mutación , Fenotipo , Síndrome de Rubinstein-Taybi/genética , Secuenciación del ExomaRESUMEN
AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.
RESUMEN
AIM: To describe the prevalence and demographic characteristics of corneal blindness in an urban and rural region of Ningxia, located in the northwest part of China. METHODS: A stratified, randomized sampling procedure was employed in the study, including urban and rural area of all age group. Visual acuity, anterior segment and ocular fundus were checked. Related factor of corneal disease, including age, gender, education status, ethnic group, location and occupation, were identified according to uniform customized protocol. An eye was defined to be corneal blindness if the visual acuity was <20/400 due to a corneal disease. RESULTS: Three thousand individuals (1290 from urban area and 1710 from rural area) participated in the investigation, with a response rate of 80.380%. The prevalence of corneal blindness was 0.023% in both eyes and 0.733% in at least one eye. The blindness in at least one eye with varied causes was present in 106 participants (3.533%) and in bilateral eyes in 34 participants (1.133%). The corneal diseases accounted for 20.754% of blindness in at least one eye and 20.588% of bilateral blindness. The prevalence of corneal disease was higher in older and Han ethnic group, especially those who occupied in agriculture and outdoor work. People with corneal blindness were more likely to be older and lower education. Rural population were more likely to suffer from bilateral corneal blindness than the urban population in ≥59-year group (χ (2)=6.716, P=0.019). Infectious, trauma and immune corneal disease were the three leading causes of corneal disease. Trauma corneal disease was more likely leading to blindness in one eye. However, infectious and immune corneal diseases make more contribution to the bilateral corneal blindness. CONCLUSION: Corneal blindness is a significant burden of in Ningxia population, encompassing a variety of corneal infections and trauma; the majority of those were avoidable. Health promotion strategies and good hygienic conditions have to be developed.
RESUMEN
AIM: To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. METHODS: Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.
RESUMEN
AIM: To assess the visual outcomes and possible risk factors associated with axis alignment and rotational stability after implantation of Toric implantable collamer lens (TICL) for the correction of high myopic astigmatism. METHODS: In this prospective, nonrandomized clinical study, 54 consecutive eyes of 29 patients with high myopic astigmatism received TICL implantation. To evaluate postoperative axis deviation from the intended axis, a digital anterior segment photograph was taken. The ultrasound biomicroscopy(UBM) was used to observe footplate-position. RESULTS: After mean follow-up of 8.6 months, mean manifest refractive cylinder (MRC) decreased 79.3% from (-1.88±1.49)D preoperatively to (0.39±0.61)D postoperatively. MRC within 1.00 D occurred in 68.5% (37/54) of eyes, whereas 48.1% (26/54) had MRC within 0.50 D. Mean manifest refraction spherical equivalent (MRSE) changed from (-12.08±4.22)D preoperatively to (-0.41±0.61)D postoperatively. Uncorrected binocular vision of 20/20 or better occurred in 72.2% (39/54) of patients compared with binocular best-corrected visual acuity (BCVA) of 20/20 or better in 44.4% (24/54) preoperatively. The mean difference between intended and achieved TICL axes was (6.96±8.37)°. Footplates of TICLs were in the ciliary sulcus in 22 eyes (46.3%), below the ciliary sulcus in 32 eyes (53.7%). The angle of TICL rotation had significant correlation with the footplates-position (t=2.127; P=0.045) and the postoperative TICL vaulting (r=-0.516; P=0.000). CONCLUSION: The results of our study further support the safety, efficacy and predictability of TICL for the correct high myopic astigmatism. The footplate-position of TICL and vault value should be taken into consideration as two possible risks factors for TICL rotation.
RESUMEN
OBJECTIVE: To analyse the mode of inheritance and clinical characteristics of retinitis pigmentosa (RP) patients with consanguineous marriage. METHODS: RP patients were recruited for this study in Ningxia Eye Hospital from September 2009 to July 2011. All patients received complete ophthalmic examination. The mode of inheritance were determined based on family history and marriage history. Clinical features were characterized by complete ophthalmic examinations including visual acuity, macular OCT, visual field and electroretinogram (ERG). RESULTS: A total of 143 individuals with RP (33 families) were recruited. Based on analysis of family history and marriage history, 20 RP families (23 patients) had consanguineous marriage history accounted for 60.6% RP families (16.1% RP patients). There were 4 patients (from 4 families) diagnosed as Usher syndrome. In 20 RP families with consanguineous marriage history, 7 families (35.0%) were Hui ethnicity and 13 families (65%) were Han ethnicity. The marriages of 15 families were between first cousins and 3 families were between second cousins, only 2 families were between half cousins matrimony. Of 23 RP patients, 12 were males and 11 were females. The average age of onset was 11.4 ± 6.8 years and the average age of recruitment was (32.0 ± 13.5) years. The best-corrected visual acuity was less than 0.6 in 78.2% patients. According to the features of the fundus, 13 patients were classical retinitis pigmentosa and 10 patients were retinitis pigmentosa sine pigmento. Visual field examination showed that all patients had varying degrees of peripheral visual field defect. Retinal neuroepithelial layer of macular and peripheral retina became thinner and retinal photoreceptors were disappeared. The average thickness of macular fovea was (186.1 ± 78.7) µm on right eyes and (187.4 ± 76.3) µm on left eyes. CONCLUSIONS: The incidence of RP with consanguineous marriages was high in Ningxia Region. The mode of inheritance of RP patients with consanguinity is autosomal recessive. The common marriage pattern of consanguinity is between first cousins. The age of onset is early and the ocular fundus changes of some patients are atypical, this should be paid attention clinically.
Asunto(s)
Consanguinidad , Patrón de Herencia , Retinitis Pigmentosa/genética , Adolescente , Adulto , Niño , Preescolar , Femenino , Humanos , Masculino , Persona de Mediana Edad , Linaje , Fenotipo , Adulto JovenRESUMEN
OBJECTIVE: To screen the mutation in the RPGR gene in a large Chinese family with X-linked recessive retinitis pigmentosa (RP) and to describe the phenotype in affected males and female carriers. METHODS: Ophthalmic examinations were performed in 77 family members of a RP pedigree to identify affected individuals. Polymerase chain reaction (PCR) and direct sequencing were used for screening of mutations in RPGR gene exon ORF15. RESULTS: Mutation screening demonstrated a novel mutation, g.ORF15 + 577_578delAG, which caused an open reading frameshift and resulted in premature truncation of the RPGR protein. This mutation was detected in 8 affected male individuals and 14 obligate female carriers in this family and was found to segregate with the phenotype in this family. This mutation led to a severe RP phenotype in male affected individuals with some variability in the age of onset of night blindness and loss of visual acuity, but was recessive in female carriers without a RP phenotype. However the most striking phenotypic feature in female carriers in this pedigree was moderate to high myopia with refractive error ranging from -5.00 D to -22.00 D in 14 female carriers. CONCLUSIONS: This novel mutation in RPGR ORF15 causes serious RP phenotype in males and no RP phenotype in female carriers. Moderate to high myopia was a particular feature for female carriers in this pedigree. Our finding expands the spectrum of RPGR mutations causing RP and phenotypic spectrum of the disease in Chinese family, which is useful for further genetic consultation and genetic diagnosis.