Mononuclear copper(II) complexes with polypyridyl ligands: synthesis, characterization, DNA interactions/cleavages and in vitro cytotoxicity towards human cancer cells.

DNA being the necessary element in cell regeneration, controlled cellular apoptosis via DNA binding/cleaving is considered an approach to combat cancer cells. The widely prescribed metallodrug cisplatin has shown interactions with the guanine-N7 center, and a plethora of complexes are continually developed to enhance crosslinking properties as well as covalent and non-covalent interactions. Two pentadentate ligands, L1 (1-(6-(1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine) and L2 (1-(6-(1-methyl-1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine), were synthesized together with their respective copper(II) complexes [1](ClO4)2 and [2](ClO4)2, which crystallized in a trigonal bipyramidal fashion. Different analytical and spectroscopic methods confirmed their formation, and their redox behaviour was also examined. The interactions of salmon sperm DNA (ss-DNA) with these two complexes were explored using absorbance spectroscopy, and they both exhibited a binding affinity (Kb) of ∼104 M-1. Fluorescence quenching experiments with ethidium bromide (EB)-bound DNA (EB-DNA) were also performed, and Stern-Volmer constant (KSV) values of 6.93 × 103 and 2.34 × 104 M-1 for [1](ClO4)2 and [2](ClO4)2, respectively, were obtained. Furthermore, DNA conformational changes due to the interactions of both complexes were validated via circular dichroism. We also assessed the DNA cleavage property of these complexes, which resulted in the linearization of circular plasmid DNA. This finding was supported by studying the growth of MDA-MB-231 breast cancer cells upon treatment with both Cu(II) complexes; IC50 values of 5.34 ± 1.02 µM and 0.83 ± 0.18 µM were obtained for [1](ClO4)2 and [2](ClO4)2, respectively. This validates their affinity towards DNA, and these insights can be further utilized for non-platinum based economical metallodrug development based on first row transition metals.

AR-V7 expression facilitates accelerated G2/M phase transition in castration-resistant prostate cancer.

The emergence of AR-V7, a truncated isoform of AR upon androgen deprivation therapy treatment, leads to the development of castration resistant prostate cancer (CRPC). Understanding mechanisms that regulate AR-V7 expression is critical for developing newer therapeutic strategies. In this study, we have investigated the regulation of AR-V7 during cell cycle and identified a distinct pattern of periodic fluctuation, peaking during G2/M phase. This fluctuation correlates with the expression of Cdc-2 like kinase 1 (CLK1) and phosphorylated serine/arginine-rich splicing factor 1 (p-SRSF1) during these phases, pointing towards their role in AR-V7 generation. Functional assays reveal that CLK1 knockdown prolongs the S phase, leading to altered cell cycle distribution and increased accumulation of AR-V7 and pSRSF1 in G1/S phase. Conversely, CLK1 overexpression rescues AR-V7 and p-SRSF1 levels in the G2/M phase, consistent with observed cell cycle alterations upon AR-V7 knockdown and overexpression in CRPC cells. Furthermore, overexpression of kinase-deficient CLK1 mutant leads to diminished AR-V7 levels during G2/M, underlining the essential contribution of CLK1's kinase activity in modulating AR-V7 expression. Collectively, our findings, for the first time, show periodic regulation of AR-V7 expression, its effect on cell cycle progression and the critical role of CLK1-pSRSF1 axis in modulating AR-V7 expression throughout the cell cycle.

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects.

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4'-(anthracene-9-yl)-2,2':6',2''-terpyridine and bpy = 2,2'-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 µM).