Efficient isolation of encoded microparticles in a degassed micromold for highly sensitive and multiplex immunoassay with signal amplification.

Multiplex detection of low-abundance protein biomarkers in biofluids can contribute to diverse biomedical fields such as early diagnosis and precision medicine. However, conventional techniques such as digital ELISA, microarray, and hydrogel-based assay still face limitations in terms of efficient protein detection due to issues with multiplexing capability, sensitivity, or complicated assay procedures. In this study, we present the degassed micromold-based particle isolation technique for highly sensitive and multiplex immunoassay with enzymatic signal amplification. Using degassing treatment of nanoporous polydimethylsiloxane (PDMS) micromold, the encoded particles are isolated in the mold within 5 min absorbing trapped air bubbles into the mold by air suction capability. Through 10 min of signal amplification in the isolated spaces by fluorogenic substrate and horseradish peroxidase labeled in the particle, the assay signal is amplified with one order of magnitude compared to that of the standard hydrogel-based assay. Using the signal amplification assay, vascular endothelial growth factor (VEGF) and chorionic gonadotropin beta (CG beta), the preeclampsia-related protein biomarkers, are quantitatively detected with a limit of detection (LoD) of 249 fg/mL and 476 fg/mL in phosphate buffer saline. The multiplex immunoassay is conducted to validate negligible non-specific detection signals and robust recovery rates in the multiplex assay. Finally, the VEGF and CG beta in real urine samples are simultaneously and quantitatively detected by the developed assay. Given the high sensitivity, multiplexing capability, and process simplicity, the presented particle isolation-based signal amplification assay holds significant potential in biomedical and proteomic fields.

Sleep quality according to chronotype in nurses working 8-hour shifts.

BACKGROUND: To date, studies have been focused on sleep disturbances of nurses working during night shifts. There is a lack of understanding regarding the sleep quality of nurses working in the rapid rotation system for each type of shift work. AIMS: To determine the relationship between chronotype and sleep quality according to shift type (i.e. day, evening and night shifts) in nurses working 8-hour rotating shifts. METHODS: A cross-sectional, descriptive study was conducted from two tertiary hospitals in South Korea from December 2021 to September 2022, including nurses working 8-hour rotating shifts (N = 74). They completed questionnaires to measure general, occupational and sleep-related characteristics, chronotype, insomnia severity and daytime sleepiness. Additionally, sleep parameters were collected from actigraphy and sleep diaries for 7 days. RESULTS: A total of 64% of nurses had an evening chronotype and 37% of nurses had an intermediate chronotype. Nurses had significantly less total sleep time and worsened sleep latency and efficiency during the day shift compared to other shift types. Compared to nurses with an intermediate chronotype, those with an evening chronotype had poorer sleep quality during day shift work. CONCLUSIONS: Strategies to enhance nurses' sleep quality during day shifts should consider a two-level approach: individual approaches, such as improving sleep hygiene, and administrative approaches, such as establishing a chronotype-based shift system for scheduling.

FTY720 Suppresses Pathogenic Retinal Müller Cell Activation and Chronic Progression by Inhibiting the mTOR/NF-κB Signaling Pathway and Regulating Autophagy.

PURPOSE: FTY720 is an agonist of the Sphingosine-1-phosphate (S1P) receptor 1, 3, 4, and 5 and a functional antagonist of the S1P1 receptor; it can inhibit the activation of mTOR/NF-κB and has therapeutic potential in inflammatory disease. This study was designed to determine the role of the inflammatory process in diabetic retinopathy and investigate the effect of FTY720 on high glucose (HG)-induced rat retinal Müller cells (rMC-1 cells). METHODS: In the present study, the role of FTY720 in inhibiting inflammation and its underlying mechanism were investigated. rMC-1 cells were treated without or with HG, FTY720, CQ, or RAP. Cell viability was examined by CCK-8 assay; cell activation was assessed by western blot analysis and IF staining; and cell migration was evaluated by a scratch wound healing assay. The expression of inflammation-associated proteins and autophagy-related proteins was evaluated by transmission electron microscopy, AO staining, MDC-labeled autophagic vacuoles, western blot analysis and ELISA. RESULTS: Western blot analysis and IF staining showed that the level of the rMC-1 cell marker GFAP was decreased, while GS was increased in FTY720 groups compared to that in the HG group. The healing assay results showed that compared with HG treatment, FTY720 treatment significantly reduced cell migration. Western blot analysis, ELISA and IF staining showed that compared with HG, FTY720 reduced proinflammatory proteins by inhibiting the mechanistic target of the mTOR/NF-κB signaling pathway and regulating autophagy. CONCLUSIONS: This study suggests that in an HG-induced rMC-1 cell model, FTY720 significantly inhibited the production of inflammatory cytokines by inhibiting mTOR/NF-κB signaling and regulating autophagy. These findings were associated with a decrease in rMC-1 cell injury, suggesting that FTY720 or related compounds may be valuable modulators of HG-induced retinal injury.

[Focusing on the major national demands and developing novel research models--the research progress and prospective of islet organoid].

Diabetes is a major metabolic disease and health issue worldwide that imposes a heavy burden. Research on its pathogenesis and development of effective treatments are currently our major national demands. With the advent of organoid technology, islet organoids have emerged and are attracting increasing attention as a promising model for diabetes research. The establishment of islet organoids is based on the current understanding of islet development. With addition of extra induction factors in vitro to programmatically activate or inhibit specific signaling pathways during islet development, stem cells can be induced to differentiate into three-dimensional cell cultures that possess structures and functions similar to those of natural islets. Because of their capability to mimic the development of islets in vitro, faithfully replicate islet structure, and perform islet physiological functions, islet organoids have been widely used as a valuable tool for the investigation of diabetes pathogenesis, drug screening and evaluation, and clinical transplantation, showing a great potential application. This paper reviews the current research progress, application, and challenges of islet organoids, and discusses the future directions for research on islet organoids.

Internal structural analysis of the nasomaxillary complex in patients with skeletal class III asymmetry: A study on asymmetry patterns.

OBJECTIVES: To investigate the internal structure of the nasomaxillary complex, including the maxillary sinus, nasal cavity and nasal septum according to the facial asymmetry pattern and to evaluate its correlation with external maxillomandibular asymmetry in Class III patients based on cone-beam computerized tomography (CBCT) images. MATERIALS AND METHODS: Facial asymmetry was analysed in a total of 100 Class III patients aged 16 years or older using CBCT scans. Patients were categorized into subgroups based on asymmetry pattern. Measurements of the nasomaxillary complex were obtained from the CBCT scans, including the volume and width of the maxillary sinuses and nasal cavities on deviated and non-deviated sides, as well as the displacement of the nasal septum. Statistical analysis was performed to compare the internal nasomaxillary variables within and between groups, and regression analysis was conducted to evaluate the correlation between facial asymmetry and the internal nasomaxillary variables. RESULTS: Group comparisons showed that there were no significant differences in the volume of the maxillary sinus and nasal cavity. However, the direction and extent of nasal septum deviation, as well as the width of the nasal cavity, varied depending on the maxillary asymmetry pattern. Regression analysis indicated a correlation between nasal septum deviation and the difference in maxillary height, while the difference in nasal cavity width was correlated with the difference in maxillary width. CONCLUSION: A comprehensive evaluation of the internal nasal anatomy is vital for understanding the intricate relationship between nasal structure and maxillary growth.

[Experimental study on the therapeutic effect and mechanism of erlotinib on non-proliferative diabetic retinopathy].

Objective: To investigate the therapeutic effect and mechanism of erlotinib, an epidermal growth factor receptor (EGFR) inhibitor, on non-proliferative diabetic retinopathy (NPDR). Methods: An experimental research was conducted. Human retinal Müller cells (RMC) were MIO-M1 cells from Moorfields Ophthalmology Hospital and the Institute of Ophthalmology at London University College. MIO-M1 cells were divided into normal, hypertonic, high glucose, high glucose+dimethyl sulfoxide (DMSO), high glucose+erlotinib 0.5 mmol/L, high glucose+erlotinib 1 mmol/L, and high glucose+erlotinib 2 mmol/L groups using a random number table method. Detection of the effect of erlotinib on the proliferation of MIO-M1 cells under high glucose conditions was performed by 5-ethynyl-2'-deoxyuridine (EdU) method. Western blotting (WB) was used to detect the effect of erlotinib on the activation markers of glial fibrillary acidic protein (GFAP) and glutamine synthetase (GS) protein levels in MIO-M1 cells under high glucose conditions. WB was used to detect the effect of erlotinib on the protein levels of nerve growth factor receptor (p75NTR), vimentin, and cell retinol binding protein (CRALBP) in RMC under high glucose conditions. MIO-M1 cells were divided into normal group, high glucose group, high glucose+DMSO group, and high glucose+erlotinib (1 mmol/L) group using random number table method. The effect of erlotinib on EGFR nuclear translocation under high glucose conditions was detected by cell immunofluorescence staining. Immunoprecipitation was used to detect the effect of erlotinib on the interaction between EGFR and transcription intermediate factor 2 (TIF2) in MIO-M1 cells under high glucose conditions. MIO-M1 cells were randomly divided into normal group, high glucose group, high glucose+DMSO group, high glucose+Myc-DDK empty body group, high glucose+erlotinib group, high glucose+erlotinib+human doublet protein group, high glucose+erlotinib+TIF2 plasmid group, and high glucose+erlotinib+human doublet protein+TIF2 plasmid group. Cell immunofluorescence staining was used to detect the effect of erlotinib on the binding of EGFR and TIF2 in MIO-M1 cells under high glucose conditions through the EGFR/TIF2 axis. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to detect the regulatory effect of EGFR and TIF2 binding on cyclin D1 transcription in MIO-M1 cells under high glucose conditions. The mouse model of diabetes retinopathy (DR) was constructed and divided into normal group, DR group, DR+DMSO group, DR+erlotinib 0.25 mg·kg-1·d-1 group, DR+erlotinib 0.5 mg·kg-1·d-1 group and DR+erlotinib 1 mg·kg-1·d-1 group. 25 mice in total, 5 in each group. Tissue immunofluorescence staining was used to detect the expression of RMC activation marker GFAP. The FITC-dextran injection experiment was used to detect the effect of erlotinib on retinal vascular leakage in a murine DR model. Results: Compared with the normal group (32.4%±3.0%), the proportion of EdU positive cells in RMC in the high glucose group (59.2%±3.8%) increased (P<0.001). Compared with the high glucose group (59.2%±3.8%), the proportion of EdU positive cells in the high glucose+1 mmol/L erlotinib group (37.6%±4.4%) decreased (P<0.001). Compared with the normal group, the expression of GFAP in RMC in the high glucose group increased (1 in the normal group, 2.27±0.11 in the high glucose group, P<0.001), while the expression of GS decreased (1 in the normal group, 0.32±0.03 in the high glucose group, P<0.001). 1 mmol/L erlotinib treatment reduced the expression of GFAP in RMC under high glucose conditions (1.32±0.13 and 2.27±0.11, respectively; P<0.001), and increased the expression of GS (0.71±0.06 and 0.32±0.03, respectively; P<0.001). The colocalization of EGFR and DAPI in RMC of the high glucose+1 mmol/L erlotinib group was lower than that of the high glucose group (52.2%±4.1% and 76.4%±5.7%, respectively; P<0.001). The expression of TIF2 or EGFR both increased while using EGF or TIF2 antibodies to precipitate TIF2 or EGFR under high glucose conditions compared to the normal group (1 in the normal group, 2.27±0.20 in the high glucose group, 2.17±0.21 in the EGFR, all P<0.05). And the expression of TIF2 (1.38±0.10) or EGFR (1.32±0.13) in the high glucose+erlotinib group was lower than that in the high glucose group (2.27±0.20) and the high glucose group (2.17±0.21) (all P<0.05). The colocalization of EGFR and TIF2 (17.2%±3.9%) and the mRNA level of Cyclin D1 (1.32±0.16) in the RMC of the high glucose+erlotinib group were lower than those in the high glucose group (54.6%±3.7% of EGFR and TIF2 colocalization ratio, 2.58±0.19 of Cyclin D1 mRNA level,all P<0.05). The high glucose+erlotinib+AREG (EGFR agonist) group, high glucose+erlotinib+Myc DDK-TIF2 plasmid group and high sugar+erlotinib+AREG+Myc-DDK-TIF2 plasmid group EGFR colocalization with TIF2 (colocalization ratios 24.1%±1.9%, 26.0%±2.3%, 35.3%±2.5%) and TIF2 mRNA levels (1.71±0.16, 1.72±0.18, 2.20±0.18). Compared with the high glucose+erlotinib group, The increases were statistically significant (all P<0.05). Compared to the normal group, the expression of GFAP in mouse retina tissue was increased in the DR group (1 in the normal group, 3.07±0.19 in the DR group, P<0.001), and 0.5 mg·kg-1·d-1 erlotinib (1.73±0.30) significantly reduced the expression of GFAP in the retina of DR group mice (P<0.05). Compared to the normal group (3.97±0.47), the DR group (23.13±2.15) showed an increase in fluorescein leakage, while the DR+erlotinib group (11.66±1.45) showed a significant decrease in leakage compared to the DR group (all P<0.05). Conclusions: Erlotinib inhibits the proliferation and activation of RMC induced by high glucose, inhibits the entry of EGFR into the nucleus, inhibits the binding of EGFR to TIF2 in RMC, and reduces the transcription of Cyclin D1 in RMC by inhibiting the interaction between EGFR and TIF2. At the same time, erlotinib inhibits the proliferation and activation of RMC in the mouse DR model, ameliorating retinal vascular leakage in mice. These results suggest that erlotinib inhibits the activation and proliferation of RMC by downregulating the EGFR/TIF2/Cyclin D1 pathway under high glucose conditions, thereby alleviating the progression of NPDR.

Protective effects of KLF4 on blood-brain barrier and oxidative stress after cerebral ischemia-reperfusion in rats through the Nrf2/Trx1 pathway.

PURPOSE: To investigate the role of KLF4 in CI/R injury and whether Nrf2/Trx1 axis acted as a downstream pathway of KLF4 to exert the protective role in blood-brain barrier destruction after CI/R. METHODS: The tMCAO rat model in vivo was constructed and received the intracerebroventricular injection of 5 µg/kg and 10 µg/kg rhKLF4 before operation. TTC, brain water content, neurological function, ELISA, behavioral tests, HE, TUNEL, and qRT-PCR were performed to detect the protective role of KLF4 on CIR. Double-fluorescence staining and western blot were performed to determine the localization and spatiotemporal expression in brain tissues. Furthermore, we also analyzed the effect of KLF4 on the blood-brain barrier (BBB) and related mechanisms in vivo and in vitro. Nrf2 inhibitor tretinoin was applied, which was intraperitoneally injected into CIR rat. Evans blue staining was conducted. In vitro OGD/R models of bEnd.3 cells were also established, and received KLF4 overexpressed transfection and 12.5 µM tretinoin incubation. The permeability of bEnd.3 cells was evaluated by TEER and FITC-dextran leakage. BBB-related factors and oxidative stress were also analyzed, respectively. The tubular ability of KLF4 on OGD/R bEnd3 cells was also evaluated. RESULTS: In vivo study confirmed that KLF4 was expressed in astrocyte, and its content increased with time. KLF4 protected against brain injury caused by cerebral ischemia-reperfusion, reduced cerebral infarction area and oxidative stress levels, and promoted the recovery of behavioral ability in rats. Simultaneously, mechanism experiments confirmed that the repair effect of KLF4 on cerebral ischemia-reperfusion injury was closely related to the Nrf2/Trx1 pathway. KLF4 exerted the neuroprotective effect through upregulating Nrf2/Trx1 pathway. Consistent with in vivo animal study, in vitro study also confirmed the effect of KLF4 on the permeability of bEnd.3 cells after OGD/R injury through Nrf2/Trx1 pathway. CONCLUSION: Collectively, KLF4 played neuroprotective role in CIR induced MCAO and OGD/R, and the beneficial effects of KLF4 was partly linked to Nrf2/Trx1 pathway.

Assessment of precision and reliability of a novel computerized heterophoria test.

Purpose: To assess the precision and reliability of a novel computerized heterophoria test (CHT). Methods: One hundred and three subjects aged 20 to 48 (27.37 ± 5.15) were recruited from Wenzhou Medical University. All subjects with corrected spectacles were examined with CHT and a prism-neutralized objective cover test (POCT) in a randomized order. They were then re-examined with CHT within 1 week. Their heterophoria was measured at three different distances (3 m, 0.77 m and 0.4 m); the average was recorded after three consecutive measurements. Inter-examiner repeatability, intra-examiner repeatability of CHT and agreement between CHT and POCT were evaluated. Results: There was no significant difference among repeated measurements using CHT (all p > 0.05). The difference between POCT and CHT was statistically significant at three distances (all p < 0.001). However, the mean absolute difference was 1.20△, 1.93△, and 2.41△, all of which were significantly smaller than the permissible range of error (4△) at three different distances (all p < 0.001). Conclusion: The CHT demonstrated excellent inter- and intra-examiner repeatability, as well as good correlation with POCT. The differences between CHT and POCT were within the permissible range of error, indicating that CHT could provide a precise and reliable measurement for clinical applications.

Knowledge, attitudes and practices of undergraduate health sciences students on hepatitis B vaccination at a South African university highlight the need for improvement of policies, implementation and co-ordination.

BACKGROUND: Hepatitis B virus (HBV) infection causes nearly 300 million chronic infections globally. Healthcare workers face up to four times the risk of HBV infection through occupational exposure to contaminated blood and bodily fluids. Health sciences students (HSSs) are regarded as at an even greater risk as they embark on their clinical training journey. While chronic hepatitis B is incurable, it can be prevented by the safe and effective hepatitis B vaccine (HepB). The South African National Department of Health recommends at least three doses of vaccine (HepB3) for HSSs before patient contact. However, data on policy implementation at training institutions, vaccine coverage and HBV immunity in HSSs are lacking or limited. OBJECTIVES: To investigate knowledge, attitudes and practices of HSSs at the University of the Witwatersrand (Wits) in relation to international guidelines and institutional HepB programmes included in the Wits vaccination policy. Sociodemographic factors predicting HepB uptake were also investigated. METHODS: A cross-sectional study was conducted between February and June 2021. An electronic, self-administered survey was emailed to all current HSSs (N=3 785). The survey included questions on sociodemographic characteristics, knowledge of and attitudes towards HepB- related international guidelines and Wits policies, and HepB uptake and vaccine practices at Wits. Descriptive statistical analyses, followed by multivariable regression modelling, were used to identify factors associated with HepB uptake. RESULTS: A response rate of only 7.1% yielded 269 returned surveys, of which 221 were adequate for analysis. Most respondents were female (69.2%), with a mean (standard deviation) age of 22.5 (3.5) years, and were studying a Bachelor of Medicine and Surgery (MB BCh) degree (76.9%). Only 78% of those students who reported a history of vaccination (89.1% of study sample) reported a completed vaccine series. The only significant predictor, when adjusted for interactions, was being enrolled in MB BCh compared with other courses (odds ratio 4.69; p=0.026). Students displayed higher levels of knowledge around institutional (Wits) vaccine recommendations (94.1%) compared with international recommendations (75.6%). Most students were in favour of mandatory vaccination (91.4%), but not of serological testing following vaccination (42.5%). Half of our students received vaccinations in private facilities, but no follow-up or record was made of this by the designated Wits Campus Health and Wellness Centre. CONCLUSION: Institutional HepB policies are suboptimal, with no centralised co-ordination or implementation strategy. Urgent efforts are required to create awareness around policy and management, ensure vaccination coverage in this high-risk group, and foster positive practices with adequate monitoring.

High-Resolution Transcriptomic Landscape of the Human Submandibular Gland.

Saliva-secreting and transporting cells are part of the complex cellular milieu of the human salivary gland, where they play important roles in normal glandular physiology and diseased states. However, comprehensive molecular characterization, particularly at single-cell resolution, is still incomplete, in part due to difficulty in procuring normal human tissues. Here, we perform an in-depth analysis of male and female adult human submandibular gland (SMG) samples by bulk RNA sequencing (RNA-seq) and examine the molecular underpinnings of the heterogeneous cell populations by single-cell (sc) RNA-seq. Our results from scRNA-seq highlight the remarkable diversity of clusters of epithelial and nonepithelial cells that reside in the SMG that is also faithfully recapitulated by deconvolution of the bulk-RNA data sets. Our analyses reveal complex transcriptomic heterogeneity within both the ductal and acinar subpopulations and identify atypical SMG cell types, such as mucoacinar cells that are unique to humans and ionocytes that have been recently described in the mouse. We use CellChat to explore ligand-receptor interactome predictions that likely mediate crucial cell-cell communications between the various cell clusters. Finally, we apply a trajectory inference method to investigate specific cellular branching points and topology that offers insights into the dynamic and complex differentiation process of the adult SMG. The data sets and the analyses herein comprise an extensive wealth of high-resolution information and a valuable resource for a deeper mechanistic understanding of human SMG biology and pathophysiology.

Genetic Study of Elf5 and Ehf in the Mouse Salivary Gland.

Salivary gland (SG) development, maturation, and homeostasis require coordinated roles of transcription factors (TFs) that dictate specific cell identities and fate. The ETS family of proteins are important transcriptional drivers of diverse cell lineages, tissue development, and differentiation programs and hence are also likely to play an important role in the SG. Here we have leveraged genomic and epigenomic data of the SG to examine the expression profile of ETS genes and identified 2 closely related paralogs, Elf5 and Ehf, that are highly expressed in distinct epithelial subpopulations. By using a well-defined mouse knockout model of Elf5, we show that Elf5, despite its enriched expression in the acinar cells, is functionally dispensable for maintaining the homeostatic state of the adult SG epithelium. The lack of a discernible phenotype of the Elf5-null SG might be due to possible functional redundancy with Ehf or other ETS factors. To probe this possibility and to examine the specific consequences of Ehf loss in the SG, we used CRISPR-Cas9 to generate mice in which the DNA-binding ETS domain of Ehf is disrupted due to an insertion mutation. We demonstrate that the Ehf mutant (EhfMut) mice exhibit a distinct cellular phenotype with decreased granular convoluted tubules that are accompanied by an increased accumulation of the intercalated Sox9-positive ductal cell population. Interestingly, the ductal phenotype of the EhfMut animals is highly pronounced in males, reaffirming the established sexual dimorphism of the SG that exists in rodents. Our results show that unlike Elf5, Ehf plays a nonredundant role in directing ductal cell differentiation of the SG and highlights the phenotypic subtlety in mutant mice of closely related TFs and the importance of careful consideration of cell type-specific studies.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Validation of the vault prediction model based on the sulcus-to-sulcus diameter and lens thickness: a 925-eye prospective study.

BACKGROUND: To verify the accuracy and stability of the prediction formula based on the ciliary sulcus diameter and lens thickness and to analyse factors influencing the prediction results. METHODS: In total, 925 eyes from 506 subjects were enrolled in this prospective study between July 1, 2020, and June 30, 2021. Subjects were divided into four seasons, each spanning three months. The target vault was set to be between 300 µm and 700 µm according the prediction formula. The actual vault was measured one month postoperatively. The Bland-Altman test, 95% confidence intervals (95% CI) and 95% limits of agreement (95% LoA) were used to evaluate the agreement between the predicted vault and the actual vault. Eyes with absolute prediction errors greater than 300 µm were further analysed. RESULTS: The mean predicted vaults for the four seasons were 503 ± 99, 494 ± 96, 481 ± 92 and 502 ± 93 µm, while the mean actual vaults were 531 ± 189, 491 ± 179, 464 ± 179 and 529 ± 162 µm, respectively. The predicted and actual vaults of the overall subjects were 493 ± 95 and 500 ± 180 µm, respectively. Of the 925 eyes, 861 eyes (93.08%), 42 eyes (4.54%), and 22 eyes (2.38%) showed a normal vault, high vault, and low vault, respectively. Bland-Altman plots showed that the mean difference between the actual vault and predicted vault overall (± 95% LoA) was 6.43 ± 176.2 µm (-339 to 352 µm). Three UBM features may lead to large prediction errors (more than 300 µm): wide iris-ciliary angle (ICA), iris concavity and anteriorly positioned ciliary body. CONCLUSIONS: This study demonstrated the accuracy and stability of the prediction formula through the validation of a large sample size and a long time span. Wide ICA, iris concavity and anteriorly positioned ciliary body may have an effect on vault.

Prevalence and risk factors of diabetic retinopathy among Chinese adults with type 2 diabetes in a suburb of Shanghai, China.

BACKGROUND: To investigate the prevalence and risk factors of diabetic retinopathy (DR) in a Chinese population with type 2 diabetes mellitus (T2DM) in a suburb (Qingpu) of Shanghai, China. METHODS: A population-based cross-sectional study. A total of 7462 residents with T2DM in Qingpu were enrolled according to the resident health archives from January 2020 to December 2020. Blood and urine samples of the subjects were collected. Disc- and macula-centred retinal images were taken to assess DR. SPSS was used to analyse and investigate the prevalence and risk factors of DR. RESULTS: The fundus images of 6380 (85.5%) subjects were of sufficiently good quality for grading. The average (range) age of 6380 subjects was 63.46±7.77 (28-92) years. Six hundred forty-four subjects were diagnosed with DR. The prevalence of DR was 10.1% (95% CI 9.4%-10.8%), with mild, moderate, and severe non-proliferative retinopathy and proliferative retinopathy being 2.1%, 6.3%, 1.3% and 0.4%, respectively. The prevalence of bilateral DR was 6.5%. Higher T2DM duration (OR, 1.057), fasting plasma glucose (OR, 1.063), glycated hemoglobinA1c (OR, 1.269), urea nitrogen (OR, 1.059), and urinary albumin (OR, 1.001) were associated with the higher DR prevalence. CONCLUSION: The prevalence of DR among Chinese adults with T2DM in Qingpu was 10.1%, in which non-proliferative DR was more common. Higher fasting plasma glucose and glycated hemoglobinA1c are well-known risk factors of DR, consistent with the findings in our study. Our study didn't find the risk between lipid indicators and DR. However, several renal function indicators, like higher urea nitrogen and urinary albumin, were risk factors for DR in this study. Appropriate diagnosis and intervention should be taken in time to prevent and control DR development.

Macular pigment optical density of hyperopic anisometropic amblyopic patients measured by fundus reflectometry.

Purpose: Hyperopic anisometropia is a major cause of amblyopia and may be associated with macular pigment optical density (MPOD) reduction. To explore whether the MPOD changes in hyperopic anisometropic amblyopia, we measured the MPOD using fundus reflectometry in eyes with hyperopic anisometropic amblyopia and normal vision. Methods: This was a cross-sectional study conducted from January 2017 to June 2017. Forty subjects (25 males and 15 females) between the ages of 6 and 10 years were recruited. The subjects' eyes were divided into two groups: amblyopic eyes (best-corrected visual acuity (BCVA) not more than 20/25 or BCVA of two eyes differing by two or more lines) and fellow eyes. All enrolled subjects underwent a comprehensive ophthalmic examination, including extraocular motility assessment, cover-uncover testing, and refractive error (noncycloplegic), BCVA, axial length (AL), macular foveal thickness (MFT) and MPOD (Visucam® 200, Carl Zeiss Meditec AG, Germany). Results: The MPOD of amblyopic and fellow eyes was 0.12 ± 0.03 log units and 0.13 ± 0.04 log units, respectively, with a significant difference (P = 0.026). The MFT of amblyopic and fellow eyes was 241.28 ± 13.95 and 237.13 ± 16.02 µm, respectively, revealing that the MFT was significantly higher in amblyopic eyes than in fellow eyes (P = 0.028). Conversely, there was no correlation between the MPOD and MFT in the two groups. Conclusions: This study is the first to report that the MPOD is decreased in hyperopic anisometropic amblyopia. In this study, no correlation between the MPOD and MFT was found. In the future, factors that induce a decrease in the MPOD in eyes with hyperopic anisometropic amblyopia should be explored in a large-sample study with follow-up observation.

[Questions and reflections in the diagnosis and treatment of younger breast cancer in China].

Compared with the median age of breast cancer onset in western countries at 62-64 years, the median age in China is around 16 years earlier. There are nearly fifty thousand new breast cancer patients younger than 40 years in China every year. The tumor characteristics, diagnosis and treatment methods, and psychosocial needs of these young patients are often different from elder breast cancer patients. Currently, the international clinical guidelines for young breast cancer are mainly formulated by western countries, which often do not address the unique clinical needs from young breast cancer patients in China. There are many questions and problems in the diagnosis and treatment of young breast cancer in China that do not have standard answer and are urgently in need of expert consensus to guide clinical decision-making.

MEK/ERK/RUNX2 Pathway-Mediated IL-11 Autocrine Promotes the Activation of Müller Glial Cells during Diabetic Retinopathy.

PURPOSE: To uncover the role of the mitogen-activated protein kinase kinase (MEK)/extracellular signal-regulated kinase (ERK)/runt-related transcription factor 2 (RUNX2)/interleukin-11 (IL-11) pathway in the activation of Müller glial cells (MGCs) and the breakdown of blood-retina barrier (BRB) during diabetic retinopathy (DR). METHODS: Western blot (WB) detected the activation of MEK/ERK/RUNX2/IL-11 pathway, and quantitative reverse transcription polymerase chain reaction (qRT-PCR) detected IL-11 mRNA levels in high glucose (HG)-exposed MIO-M1 cells. Co-immunoprecipitation (Co-IP) identified the interaction between ERK and RUNX2. Immunofluorescence (IF) measured the co-localization of ERK and RUNX2. Luciferase reporter gene assay identified the transcription activity of IL-11 promoter under HG conditions. Enzyme-linked immunosorbent assay (ELISA) detected IL-11 levels in MIO-M1 cell culture supernatant. WB detected IL-RA protein levels, and Immunofluorescence measured the co-localization of IL-11 and IL-11RA. WB detected MGCs activation marker glial fibrillary acidic protein (GFAP) protein levels. 5-ethynyl-2'-deoxyuridine (EdU) incorporation assay detected the proliferation of MGCs. WB detected the activation of MEK/ERK/RUNX2/IL-11 pathway in streptozotocin (STZ)-induced diabetic mice. ELISA detected IL-11 and IL-11RA levels in mouse retina tissues. QRT-PCR and WB detected tight junction-associated molecules claudin-5, occluding and tight junction protein 1 (ZO-1) mRNA and protein levels in mouse retina tissues, respectively. RESULTS: MEK/ERK/RUNX2/IL-11 pathway was activated in HG-exposed MIO-M1 cells. Additionally, IL-11 bound to IL-11RA on MIO-M1 cells to promote MIO-M1 cell activation and proliferation. In the mouse STZ-induced diabetic model, MEK/ERK/RUNX2/IL-11/IL-11RA pathway was also activated. Finally, the blockade of the pathway mitigated the activation of MGCs and the breakdown of BRB. CONCLUSION: The data suggested that activated MEK/ERK/RUNX2/IL-11/IL-11RA autocrine pathway can promote the activation of MGCs and the breakdown of BRB during DR, implying novel anti-molecular strategies for the treatment of DR.

Neuromodulation Using Transcranial Focused Ultrasound on the Bilateral Medial Prefrontal Cortex.

Transcranial focused ultrasound (tFUS) is a promising technique of non-invasive brain stimulation for modulating neuronal activity with high spatial specificity. The medial prefrontal cortex (mPFC) has been proposed as a potential target for neuromodulation to prove emotional and sleep qualities. We aim to set up an appropriate clinical protocol for investigating the effects of tFUS stimulation of the bilateral mPFC for modulating the function of the brain-wide network using different sonication parameters. Seven participants received 20 min of 250 kHz tFUS to the bilateral mPFC with excitatory (70% duty cycle with sonication interval at 5 s) or suppressive (5% duty cycle with no interval) sonication protocols, which were compared to a sham condition. By placing the cigar-shaped sonication focus on the falx between both mPFCs, it was possible to simultaneously stimulate the bilateral mPFCs. Brain activity was analyzed using continuous electroencephalographic (EEG) recording during, before, and after tFUS. We investigated whether tFUS stimulation under the different conditions could lead to distinctive changes in brain activity in local brain regions where tFUS was directly delivered, and also in adjacent or remote brain areas that were not directly stimulated. This kind of study setting suggests that dynamic changes in brain cortical responses can occur within short periods of time, and that the distribution of these responses may differ depending on local brain states and functional brain architecture at the time of tFUS administration, or perhaps, at least temporarily, beyond the stimulation time. If so, tFUS could be useful for temporarily modifying regional brain activity, modulating functional connectivity, or reorganizing brain functions associated with various neuropsychiatric diseases, such as insomnia and depression.

Crosstalk Between RPE Cells and Choroidal Endothelial Cells via the ANXA1/FPR2/SHP2/NLRP3 Inflammasome/Pyroptosis Axis Promotes Choroidal Neovascularization.

One type of age-related macular degeneration (AMD), neovascular (nAMD), characterized by choroidal neovascularization (CNV), accounts for the majority of the severe central vision impairment associated with AMD. Endothelial cells (ECs) in direct contact with retinal pigment epithelial (RPE) cells are more prone to the pathological angiogenesis involved in CNV. Herein, we investigated the effect of crosstalk between RPE cells and choroidal endothelial cells (CECs) via the ANXA1/FPR2/NLRP3 inflammasome/pyroptosis axis on the development of choroidal neovascularization (CNV) in vitro and in vivo. ANXA1 expression and secretion from ARPE-19 cells were upregulated by hypoxia. FPR2 expression, especially on the plasma membrane, in HCECs was upregulated under hypoxic conditions. ANXA1 secreted from ARPE-19 cells inhibited NLRP3 inflammasome activation and NLRP3 inflammasome-mediated pyroptosis in HCECs by activating the FPR2/SHP2 axis. Moreover, ANXA1 secreted by ARPE-19 cells promoted behaviors of HCECs, including proliferation, migration, and tube formation, by activating the FPR2/SHP2 axis and inhibiting NLRP3 inflammasome-mediated pyroptosis. Inhibiting the upregulated ANXA1/FPR2/SHP2/NLRP3 inflammasome/pyroptosis axis decreased the volume of CNV. Our data suggest that the crosstalk between RPE cells and CECs via the ANXA1/FPR2/NLRP3 inflammasome/pyroptosis axis promotes CNV. This finding could identify a potential target for the prevention and treatment of CNV.

CLOCK Genetic Variations Are Associated With Age-Related Changes in Sleep Duration and Brain Volume.

BACKGROUND: Although a connection between sleep disruption and brain aging has been documented, biological mechanisms need to be further clarified. Intriguingly, aging is associated with circadian rhythm and/or sleep dysfunction in a key gene regulating circadian rhythm, Circadian Locomotor Output Cycles Kaput (CLOCK), has been linked to both aging-related sleep disturbances and neurodegenerative diseases. This study aims to investigate how CLOCK genetic variation associates with sleep duration changes and/or volumetric brain alteration. METHODS: This population-based cross-sectional study used data from the Korean Genome Epidemiology Study and analyzed sleep characteristics and genetic and brain imaging data in 2 221 participants (mean 58.8 ± 6.8 years, 50.2% male). Eleven single-nucleotide polymorphisms (SNPs) in CLOCK were analyzed using PLINK software v1.09 to test for their association with sleep duration and brain volume. Haplotype analysis was performed by using pair-wise linkage disequilibrium of CLOCK polymorphisms, and multivariate analysis of covariance was for statistical analysis. RESULTS: Decreased sleep duration was associated with several SNPs in CLOCK intronic regions, with the highest significance for rs10002541 (p = 1.58 × 10-5). Five SNPs with the highest significance (rs10002541, rs6850524, rs4580704, rs3805151, rs3749474) revealed that CGTCT was the most prevalent. In the major CGTCT haplotype, decreased sleep duration over time was associated with lower cortical volumes predominantly in frontal and parietal regions. Less common haplotypes (GCCTC/CGTTC) had shorter sleep duration and more decreases in sleep duration over 8 years, which revealed smaller total and gray matter volumes, especially in frontal and temporal regions of the left hemisphere. CONCLUSION: CLOCK genetic variations could be involved in age-related sleep and brain volume changes.