Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 36
Filtrar
1.
Eur Rev Med Pharmacol Sci ; 27(11): 5039-5052, 2023 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-37318478

RESUMEN

OBJECTIVE: Giant cell tumor of bone (GCTB) is a common primary bone tumor with latent malignant tendency. GCTB is prone to occur around the knee joint, and surgery is the major treatment method. There are relatively few reports on denosumab in the treatment of recurrent GCTB around the knee joint and postoperative function evaluation of patients. This research aimed to explore the appropriate surgical options for the treatment of recurrent GCTB around the knee joint. PATIENTS AND METHODS: 19 patients with recurrent GCTB around the knee joint, who were admitted to Hospital for 3 months following denosumab treatment from January 2016 to December 2019, were included as the research subjects. The prognosis was compared between patients treated with curettage combined with polymethylmethacrylate (PMMA) and those with extensive-resection replacement of tumor prosthesis (RTP). A deep learning model of Inception-v3 combined with a Faster region-based convolutional neural network (Faster-RCNN) was constructed to classify and identify X-ray images of patients. The Musculoskeletal Tumor Society (MSTS) score, short form-36 (SF-36) score, recurrence, and the rate of complications were also analyzed during the follow-up period. RESULTS: The results showed that the Inception-v3 model trained on the low-rank sparse loss function was obviously the best for X-ray image classification, and the classification and identification effect of the Faster-RCNN model was significantly better than that of the convolutional neural network (CNN), U-Net, and Fast region-based convolutional neural network (Fast-RCNN) models. During the follow-up period, the MSTS score in the PMMA group was significantly higher than that in the RTP group (p<0.05), while there was no significant difference in the SF-36 score, recurrence, and the rate of complications (p>0.05). CONCLUSIONS: The deep learning model could improve the classification and identification of the lesion location in the X-ray images of GCTB patients. Denosumab was an effective adjuvant for recurrent GCTB, and widely extensive-resection RTP could reduce the risk of local recurrence after denosumab treatment for recurrent GCTB.


Asunto(s)
Conservadores de la Densidad Ósea , Neoplasias Óseas , Tumor Óseo de Células Gigantes , Humanos , Denosumab/uso terapéutico , Cementos para Huesos/uso terapéutico , Tumor Óseo de Células Gigantes/diagnóstico por imagen , Tumor Óseo de Células Gigantes/tratamiento farmacológico , Tumor Óseo de Células Gigantes/cirugía , Polimetil Metacrilato , Articulación de la Rodilla/diagnóstico por imagen , Articulación de la Rodilla/cirugía , Articulación de la Rodilla/patología , Neoplasias Óseas/diagnóstico por imagen , Neoplasias Óseas/tratamiento farmacológico , Neoplasias Óseas/cirugía , Legrado/efectos adversos , Recurrencia Local de Neoplasia/patología , Estudios Retrospectivos
2.
Zhonghua Nei Ke Za Zhi ; 59(8): 588-597, 2020 Aug 01.
Artículo en Chino | MEDLINE | ID: mdl-32521953

RESUMEN

Coronavirus disease 2019 (COVID-19) can cause great damage to the elderly patients and lead to high mortality. The clinical presentations and auxiliary examinations of the elderly patients with COVID-19 are atypical, due to the physiological ageing deterioration and basal pathological state. The treatment strategy for the elderly patients has its own characteristics and treatment protocol should be considered accordingly. To improve the diagnosis, treatment, and prevention of COVID-19 in the elderly, the Expert Committee of Geriatric Respiratory and Critical Care Medicine, China Society of Geriatrics established the "Expert consensus for the diagnosis, treatment, and prevention of coronavirus disease 2019 in the elderly" . We focused on the clinical characteristics and key points for better treatment and prevention of COVID-19 in the elderly. (1) For diagnosis, atypical clinical presentation of COVID-19 in the elderly should be emphasized, which may be complicated by underlying disease. (2) For treatment, strategy of multiple disciplinary team (mainly the respiratory and critical care medicine) should be adopted and multiple systemic functions should be considered. (3) For prevention, health care model about integrated management of acute and chronic diseases, in and out of hospital should be applied.


Asunto(s)
COVID-19 , Anciano , China , Consenso , Humanos , SARS-CoV-2
3.
Zhonghua Yan Ke Za Zhi ; 54(12): 954-960, 2018 Dec 11.
Artículo en Chino | MEDLINE | ID: mdl-30526795

RESUMEN

Endothelial keratoplasty is a surgery that selectively replaces the diseased endothelium and reserves the normal corneal epithelial and stromal layers. It is now gradually replacing penetrating keratoplasty in treating endothelial dysfunction. Although endothelial cell loss exists after endothelial keratoplasty, the number of lost cells is obviously less than that of penetrating keratoplasty. The amount and function of corneal endothelial cells are important factors for maintaining corneal transparency and indicating the survival of the graft. Thus, the changes of corneal endothelial cell density after surgery are significant in predicting the prognosis. This article elaborates on the changes of endothelial cell density after endothelial keratoplasty and related influencing factors, aiming to provide reference and basis for clinical diagnosis and treatment. (Chin J Ophthalmol, 2018, 54:954-960).


Asunto(s)
Trasplante de Córnea , Células Endoteliales , Endotelio Corneal , Queratoplastia Penetrante , Recuento de Células , Córnea , Humanos
4.
Hernia ; 22(6): 1023-1032, 2018 12.
Artículo en Inglés | MEDLINE | ID: mdl-29961197

RESUMEN

BACKGROUND: The US healthcare system is shifting towards reimbursement for quality over quantity of care. Quality measures are tied to financial incentives in these healthcare models. It is important that surgeons become familiar with quality measures addressing ventral hernia repair and understand candidate measures that may drive future quality measure development. STUDY DESIGN: We performed a systematic review of society websites, quality measure databases, and the literature (Pubmed, Embase/Scopus, and Google Scholar) for quality measures addressing ventral hernia surgery. Clinical practice guidelines were included as candidate quality measures. All measures were categorized as structure, process or outcome according to Donabedian domains, as well as within the six National Quality Strategy (NQS) domains. RESULTS: Thirty quality measures and candidate measures were identified. Eight candidate measures from the American Hernia Society addressed ventral hernia repair, and 22 quality measures in general surgery were also relevant to ventral hernia repair. Of the candidate measures, 6 (75%) were outcome and 2 (25%) were process measures. Of existing general surgery quality measures, 9 (41%) were outcome and 13 (59%) were process measures. No structural measures were identified. Overall, the majority of measures addressed NQS priorities of effective clinical care (33%) and patient safety (27%), while few addressed other domains. CONCLUSION: Both the Donabedian domains of quality and NQS priorities were unequally represented in the current measures addressing ventral hernia repair. Recognizing and addressing the under-represented areas will provide a more balanced framework for developing quality measures and ensure that ventral hernia surgery is appropriately evaluated in value-based payment models.


Asunto(s)
Hernia Ventral/cirugía , Herniorrafia/normas , Humanos , Calidad de la Atención de Salud , Estados Unidos
5.
Zhonghua Er Ke Za Zhi ; 55(1): 70-73, 2017 Jan 02.
Artículo en Chino | MEDLINE | ID: mdl-28072965
6.
Eur Rev Med Pharmacol Sci ; 20(11): 2450-9, 2016 06.
Artículo en Inglés | MEDLINE | ID: mdl-27338074

RESUMEN

OBJECTIVE: Continued EGFR-TKIs treatment is still controversial for NSCLC patients with activating EGFR mutations, who acquire resistance to the drug. Of these patients, elderly ones were worth to be investigated to further examine efficacy of continued EGFR-TKIs treatment. PATIENTS AND METHODS: A total of 232 NSCLC patients (≥ 70-year-old) were recruited from the Chinese People's Liberation Army General Hospital between January 1, 2009, and July 31, 2014. And 44 patients were qualified for further retrospectively investigated, which were divided into dramatic and non-dramatic progression groups based on the characteristics of progression during first-line EGFR-TKIs treatment. And they were also divided into two groups: continued EGFR-TKIs group and discontinued EGFR-TKIs group. Subsequently, progression-free survival (PFS), post-progression survival (PPS), and overall survival (OS) of these groups were investigated by multivariate analysis. RESULTS: Median OS (28.9 months vs. 23.2 months, p = 0.46) and median PPS (16.9 months vs. 4.4 months, p = 0.216) were both not significantly different between continued EGFR-TKIs groups and discontinued ones. However, when focusing on patients with non-dramatic progression, the median OS (29.0 months vs. 23.2 months, p = 0.039) and median PPS (21.3 months vs. 3.9 months, p = 0.001) were significantly longer in the continued EGFR-TKIs patients than discontinued ones. DISCUSSION: Continued EGFR-TKIs beyond PD may be a good option for elderly patients with non-dramatic progression. The characteristic of progression after first-line EGFR-TKIs treatment should be taken into account to determine which part of patients is suitable for continued EGFR-TKIs treatment, especially for the speed of progression. CONCLUSION: Continued EGFR-TKIs treatment promotes the survival of elderly patients with acquired resistance to EGFR-TKIs therapy.


Asunto(s)
Carcinoma de Pulmón de Células no Pequeñas/tratamiento farmacológico , Receptores ErbB/genética , Receptores ErbB/uso terapéutico , Neoplasias Pulmonares/tratamiento farmacológico , Anciano , Antineoplásicos/uso terapéutico , Carcinoma de Pulmón de Células no Pequeñas/genética , Resistencia a Antineoplásicos , Humanos , Neoplasias Pulmonares/genética , Mutación , Oligopéptidos/genética , Oligopéptidos/uso terapéutico , Inhibidores de Proteínas Quinasas/administración & dosificación , Factores de Tiempo
7.
Chem Commun (Camb) ; 52(4): 741-4, 2016 Jan 14.
Artículo en Inglés | MEDLINE | ID: mdl-26564002

RESUMEN

Urea is considered a fundamental building block in prebiotic chemistry. Its formation on early Earth has not yet been explained satisfactorily and exogenous delivery has been considered. We report on the synthesis along with the first online and in situ identification of urea after exposing inorganic ices to ionizing radiation.


Asunto(s)
Hielo/análisis , Urea/síntesis química , Difusión , Medio Ambiente Extraterrestre , Meteoroides , Radiación , Análisis Espectral , Urea/química
8.
Genet Mol Res ; 14(1): 1782-7, 2015 Mar 13.
Artículo en Inglés | MEDLINE | ID: mdl-25867322

RESUMEN

The prognostic role of c-erbB-2 in gastric cancer is controversial. We conducted a meta-analysis to evaluate the relationship between c-erbB-2 expression and the prognosis of gastric cancer. We evaluated 20 published studies assessing the relationship between c-erbB-2 and gastric cancer prognosis. The Revman 5.0 software was used to perform literature retrieval, article selection, data collection, and statistical analysis. We utilized a fixed-effect model to pool hazard ratios and 95% confidence intervals from the studies. A total of 20 eligible studies including 4468 gastric cancer patients were analyzed. We were unable to demonstrate the prognostic value of c-erbB-2 for gastric cancer (hazard ratio = 1.01, 95% confidence interval = 0.87-1.16, P = 0.93). The present study indicated that c-erbB-2 expression is not a prognostic factor for gastric cancer.


Asunto(s)
Regulación Neoplásica de la Expresión Génica , Receptor ErbB-2/genética , Neoplasias Gástricas/diagnóstico , Neoplasias Gástricas/genética , Humanos , Pronóstico
9.
J Phys Chem A ; 118(36): 7715-24, 2014 Sep 11.
Artículo en Inglés | MEDLINE | ID: mdl-25116460

RESUMEN

The reaction of ground-state cyano radicals, CN(X(2)Σ(+)), with the simplest polyene, 1,3-butadiene (C4H6(X(1)Ag)), is investigated to explore probable routes and feasibility to form pyridine at ultralow temperatures. The isomerization and dissociation channels for each of the seven initial collision complexes are characterized by utilizing the unrestricted B3LYP/cc-pVTZ and the CCSD(T)/cc-pVTZ calculations. With facilitation of RRKM rate constants, through ab initio paths composed of 7 collision complexes, 331 intermediates, 62 hydrogen atom, 71 hydrogen molecule, and 3 hydrogen cyanide dissociated products, the most probable paths at collision energies up to 10 kcal/mol, and thus the reaction mechanism, are determined. Subsequently, the corresponding rate equations are solved that the concentration evolutions of collision complexes, intermediates, and products versus time are obtained. As a result, the final products and yields are determined. The low-energy routes for the formation of most thermodynamically stable product, pyridine, are identified. This study, however, predicts that seven collision complexes would produce predominately 1-cyano-1,3-butadiene, CH2CHCHCHCN (p2) plus atomic hydrogen via the collision complex c1(CH2CHCHCH2CN) and intermediate i2(CH2CHCH2CHCN), with a very minor amount of pyridine. Our scheme also effectively excludes the presence of 2-cyano-1,3-butadiene, which has energy near-degenerate to 1-cyano-1,3-butadiene, as supported by experimental findings.

10.
ACS Appl Mater Interfaces ; 6(4): 2639-46, 2014 Feb 26.
Artículo en Inglés | MEDLINE | ID: mdl-24467526

RESUMEN

Highly elongated BiFeO3 is epitaxially grown on hexagonal sapphire(0001) substrate within a rather narrow synthesis window. Both X-ray reciprocal space maps and Raman characterizations reveal that it is of true tetragonal symmetry but not the commonly observed MC type monoclinic structure. The tetragonal BiFeO3 film exhibits an island growth mode, with the island edges oriented parallel to the ⟨10-10⟩ and ⟨12-30⟩ directions of the sapphire substrate. With increasing deposition time, a transition from square island to elongated island and then to a continuous film is observed. The metastable tetragonal phase can remain on the substrate without relaxation to the thermally stable rhombohedral phase up to a critical thickness of 450 nm, providing an exciting opportunity for practicable lead-free ferroelectrics. These results facilitate a better understanding of the phase stability of BiFeO3 polymorphs and enrich the knowledge about the heteroepitaxial growth mechanism of functional oxides on symmetry-mismatched substrates.

11.
Phys Chem Chem Phys ; 16(3): 989-97, 2014 Jan 21.
Artículo en Inglés | MEDLINE | ID: mdl-24281672

RESUMEN

The crossed molecular beam reaction of boron monoxide ((11)BO; X(2)Σ(+)) with dimethylacetylene (CH3CCCH3; X(1)A(1g)) was investigated at a collision energy of 23.9 ± 1.5 kJ mol(-1). The scattering dynamics were suggested to be indirect (complex forming reaction) and were initiated by the addition of (11)BO(X(2)Σ(+)) with the radical center located at the boron atom to the π electron density at the acetylenic carbon-carbon triple bond without entrance barrier leading to cis-trans(11)BOC4H6 doublet radical intermediates. cis-(11)BOC4H6 underwent cis-trans isomerization followed by unimolecular decomposition via a methyl group (CH3) loss forming 1-propynyl boron monoxide (CH3CC(11)BO) in an overall exoergic reaction (experimental: -91 ± 22 kJ mol(-1); theoretical: -105 ± 9 kJ mol(-1); NIST: -104 ± 12 kJ mol(-1)) via a tight exit transition state; trans-(11)BOC4H6 was found to lose a methyl group instantaneously. Neither atomic nor molecular hydrogen loss pathways were detectable. The experimental finding of an exclusive methyl loss pathway gains full support from our computational study predicting a methyl group versus atomic hydrogen loss branching ratio of 99.99% to 0.01% forming 1-propynyl boron monoxide (CH3CC(11)BO) and 1-methyl-propadienyl boron monoxide (CH3((11)BO)CCCH2), respectively.

12.
Phytopathology ; 103(9): 949-59, 2013 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-23550972

RESUMEN

To study the population genetic structure and forces driving the evolution of Wheat yellow mosaic virus (WYMV), the nucleotide sequences encoding the coat protein (CP) (297 sequences) or the genome-linked virion protein (VPg) (87 sequences) were determined from wheat plants growing at 11 different locations distributed in five provinces in China. There were close phylogenetic relationships between all sequences but clustering on the phylogenetic trees was congruent with their provenance, suggesting an origin-dependent population genetic structure. There were low levels of genetic diversity, ranging from 0.00035 ± 0.00019 to 0.01536 ± 0.00043 (CP), and 0.00086 ± 0.00039 to 0.00573 ± 0.00111 (VPg), indicating genetic stability or recent emergence of WYMV in China. The results may suggest that founder effects play a role in shaping the genetic structure of WYMV. Between-population diversity was consistently higher than within-population diversity, suggesting limited gene flow between subpopulations (average FST 0.6241 for the CP and 0.7981 for the VPg). Consistent amino acid substitutions correlated with the provenance of the sequences were observed at nine positions in the CP (but none in the VPg), indicating an advanced stage in population structuring. Strong negative (purifying) selection was implicated on both the CP and VPg but positive selection on a few codons in the CP, indicating an ongoing molecular adaptation.


Asunto(s)
Efecto Fundador , Estructuras Genéticas , Variación Genética , Genética de Población , Potyviridae/genética , Selección Genética , Secuencia de Bases , Proteínas de la Cápside/genética , China , Evolución Molecular , Genoma Viral/genética , Geografía , Filogenia , Enfermedades de las Plantas/virología , Potyviridae/aislamiento & purificación , Potyviridae/patogenicidad , Potyviridae/fisiología , ARN Viral/genética , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Triticum/virología , Proteínas Virales/genética
13.
Plant Dis ; 96(7): 1065, 2012 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-30727237

RESUMEN

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 µm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

14.
J Chem Phys ; 134(3): 034315, 2011 Jan 21.
Artículo en Inglés | MEDLINE | ID: mdl-21261361

RESUMEN

Following single-photon dissociation of CH(2)I(2) at 248 nm, I(2) molecular elimination is detected by using cavity ring-down absorption spectroscopy. The technique comprises two laser beams propagating in a perpendicular configuration, in which a tunable laser beam along the axis of the ring-down cell probes the I(2) fragment in the B (3)Π(ou)(+) - X (1)Σ(g)(+) transition. The nascent vibrational populations for v = 0, 1, and 2 levels are obtained with a population ratio of 1:(0.65 ± 0.10):(0.30 ± 0.05), corresponding to a Boltzmann-like vibrational temperature of 544 ± 73 K. The quantum yield of the ground state I(2) elimination reaction is determined to be 0.0040 ± 0.0025. With the aid of ab initio potential energy calculations, the pathway of molecular elimination is proposed on the energetic ground state CH(2)I(2) via internal conversion, followed by asynchronous three-center dissociation. A positive temperature effect supports the proposed mechanism.


Asunto(s)
Hidrocarburos Yodados/química , Yodo/química , Fotones , Teoría Cuántica , Espectrofotometría Ultravioleta , Temperatura
15.
Plant Dis ; 94(12): 1505, 2010 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-30743387

RESUMEN

Cereal cyst nematode (CCN) is now recognized as a widespread and often damaging parasite of wheat in China. Only Heterodera avenae has been reported in China (4). However, molecular analysis of four samples from Beijing and one from Shanxi Province indicated genetic differences from H. avenae and other named species (3). Here we report the detection of H. filipjevi at a site in Henan Province that was not included in any previous study or report. The infested crop was rainfed winter wheat (Triticum aestivum) cv. Wenmai 19 in a field near Banpopu Village in Xuchang County (34.0447°N, 113.7415°E) with a long-established maize-wheat semiannual crop rotation. During the winter growing season, the crop was patchy with uneven growth and cyst nematode females were observed on the roots. In June 2009, soil was collected and mature cysts were extracted for morphological and molecular identification. Cysts were also kept at 4°C for 2 months and then incubated in shallow water at 15°C for a month to obtain second-stage juveniles (J2). Measurements (range; mean ± sd) of 10 cysts were body length including neck (569 to 786 µm; 699 ± 56), body width (403 to 600 µm; 523 ± 55), length:width ratio (1.3 to 1.5; 1.3 ± 0.1), neck length (61 to 125 µm; 106 ± 19) and width (49 to 83 µm; 69 ± 13), fenestra length (52 to 59 µm; 57 ± 2.9) and width (24.5 to 34.4; 27.9 ± 3.5), underbridge (64 to 101 µm; 85 ± 10), and vulval slit (7.4 to 10.0 µm; 9.6 ± 1.0). Lemon-shaped cysts were brown with a surface zigzag pattern. The vulval cone was bifenestrate with horseshoe-shaped semifenestra, with heavy underbridge and many bullae. The J2 (n = 22) measurements were body length (496 to 590 µm; 552 ± 24), body width (20.0 to 23.8; 21.5 ± 0.9), stylet (22.8 to 25.3; 24.0 ± 1.0) with anchor-shaped basal knobs, tail (47 to 64; 61.6 ± 4.4), and hyaline tail terminus (32 to 43; 40.2 ± 3.0). The J2 had up to four lateral lines, but the inner two were often the only lines clearly visible, and the shape of the stylet knobs, tail, and tail terminus were consistent with H. filipjevi. All morphological data and characters were consistent with H. filipjevi (1). Specimens have been lodged with the Australian National Insect Collection. DNA from single cysts was extracted to amplify the internal transcribed spacer region of rDNA by PCR with forward primer TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and reverse primer AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (2). The PCR product was sequenced (Genbank Accession No. HM027892) and digested by restriction enzymes (AluI, CfoI, HaeI, HinfI, PstI, RsaI, TaqI, and Tru9I) to obtain restriction fragment length polymorphism profiles (2). Profiles for the Xuchang population consistently matched those published for H. filipjevi and were distinct from those of H. avenae and other species (3). Phylogenic analysis of the sequence further indicated conspecificity with H. filipjevi. These morphological and molecular data confirmed that the specimens from Xuchang were H. filipjevi, which represents the first detection of H. filipjevi in China, and extends the known distribution of the species from Europe, North America, South Asia, and West Asia to East Asia. This finding adds complexity to the management of CCN in China, especially for control by host resistance, which now must consider both species and pathotype diversity. References: (1) Z. A. Handoo. J. Nematol. 34:250, 2002. (2) S. A. Subbotin et al. Nematology 2:153, 2000. (3) S. A. Subbotin et al. Nematology 5:515, 2003. (4) H. X. Yuan et al. Australas. Plant Pathol. 39:107, 2010.

16.
J Chem Phys ; 128(24): 244303, 2008 Jun 28.
Artículo en Inglés | MEDLINE | ID: mdl-18601328

RESUMEN

The interstellar reaction of ground-state carbon atom with the simplest polyyne, diacetylene (HCCCCH), is investigated theoretically to explore probable routes to form hydrogen-deficient carbon clusters at ultralow temperature in cold molecular clouds. The isomerization and dissociation channels for each of the three collision complexes are characterized by utilizing the unrestricted B3LYP/6-311G(d,p) level of theory and the CCSD(T)/cc-pVTZ calculations. With facilitation of RRKM and variational RRKM rate constants at collision energies of 0-10 kcalmol, the most probable paths, thus reaction mechanism, are determined. Subsequently, the corresponding rate equations are solved that the evolutions of concentrations of collision complexes, intermediates, and products versus time are obtained. As a result, the final products and yields are identified. This study predicts that three collision complexes, c1, c2, and c3, would produce a single final product, 2,4-pentadiynylidyne, HCCCCC(X (2)Pi), C(5)H (p1)+H, via the most stable intermediate, carbon chain HC(5)H (i4). Our investigation indicates the title reaction is efficient to form astronomically observed 2,4-pentadiynylidyne in cold molecular clouds, where a typical translational temperature is 10 K, via a single bimolecular gas phase reaction.

17.
Chemphyschem ; 9(8): 1137-45, 2008 Jun 02.
Artículo en Inglés | MEDLINE | ID: mdl-18481339

RESUMEN

The Br2 elimination channel is probed for 1,2-C2H2Br2 in the B(3)Pi(+)ou-X(1)Sigma(+)g transition upon irradiation at 248 nm by using cavity ring-down absorption spectroscopy (CRDS). The nascent vibrational population ratio of Br2(v=1)/Br2(v=0) is obtained to be 0.7+/-0.2, thus indicating that the Br2 fragment is produced in hot vibrational states. The obtained Br2 products are anticipated to result primarily from photodissociation of the ground-state cis isomer via four-center elimination or from cis/trans isomers via three-center elimination, each mechanism involving a transition state that has a Br-Br distance much larger than that of ground state Br2. According to ab initio potential energy calculations, the pathways that lead to Br2 elimination may proceed either through the electronic ground state by internal conversion or through the triplet state by intersystem crossing. Temperature-dependence measurements are examined, thereby supporting the pathway that involves internal conversion--which was excluded previously by using product translational spectroscopy (PTS). The quantum yield for the Br2 elimination reaction is determined to be 0.120.1, being substantially contributed by the ground-state Br2 product. The discrepancy of this value from that (of 0.2) obtained by PTS may rise from the lack of measurements in probing the triplet-state Br2 product.

18.
Fish Shellfish Immunol ; 24(6): 701-14, 2008 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-18407520

RESUMEN

SIMP (source of immunodominant MHC-associated peptides) plays a key role in N-linked glycosylation with the active site of oligosaccharyltransferase, being the source of MHC-peptides in the MHC I presentation pathway. In the present study, the SIMP gene has been cloned from grass carp Ctenopharyngodon idella by rapid amplification of cDNA ends (RACE). The full length of the cDNA sequence is 4384bp, including a 1117bp 5' UTR (untranslated region), a 2418bp open reading frame, and a 849bp 3' UTR. The deduced amino acids of the grass carp SIMP (gcSIMP) are a highly conserved protein with a STT3 domain and 11 transmembrane regions. The gcSIMP spans over more than 24,212bp in length, containing 16 exons and 15 introns. Most encoding exons, except the first and the 15th, have the same length as those in human and mouse. The gcSIMP promoter contains many putative transcription factor binding sites, such as Oct-1, GCN4, YY1, Sp1, Palpha, TBP, GATA-1, C/EBP beta, and five C/EBP alpha binding sites. The mRNA expression of gcSIMP in different organs was examined by real-time PCR. The gcSIMP was distributed in all the organs examined, with the highest level in brain, followed by the level in the heart, liver, gill, trunk kidney, muscle, head kidney, thymus, and the lowest level in spleen. Furthermore, the recombinant gcSIMP has been constructed successfully and expressed in Escherichia coli by using pQE-40 vector, and the polyclonal antibody for rabbit has been successfully obtained, which was verified to be specific. Identification of gcSIMP will help to explore the function in fish innate immunity.


Asunto(s)
Carpas/genética , Carpas/metabolismo , Perfilación de la Expresión Génica , Glicosiltransferasas/genética , Glicosiltransferasas/metabolismo , Secuencia de Aminoácidos , Animales , Especificidad de Anticuerpos , Secuencia de Bases , Clonación Molecular , Escherichia coli/genética , Regulación de la Expresión Génica , Genoma , Glicosiltransferasas/química , Datos de Secuencia Molecular , Filogenia , Regiones Promotoras Genéticas/genética , Proteínas Recombinantes/genética , Alineación de Secuencia
19.
Inorg Chem ; 47(7): 2543-51, 2008 Apr 07.
Artículo en Inglés | MEDLINE | ID: mdl-18318488

RESUMEN

Ionic gold(I) complexes with general formula of [Au(Py)2][AuCl2] and [Au(Py)2][PF6] (Py = 4-substituted pyridines) have been synthesized. Structures of five Au(I) complexes and a Ag(I) complex were determined by single crystal X-ray diffraction. Evidence for cationic aggregation of [Au(py)2][PF6] complexes in solution was obtained by conductivity measurements and by the isosbestic point observed from variable temperature UV-visible absorption spectra. All compounds were luminous in the solid state. Calculations employing density functional theory were performed to shed light on the nature of the electronic transitions. While the [Au(4-dmapy)2][AuCl2] (4-dmapy = 4-dimethylaminopyridine) and [Au(4-pic)2][AuCl2] (4-pic = 4-picoline) emissions were found to be mainly ligand in nature, their [PF6](-) counterparts involved a Au...Au-interaction imbedded in the highest occupied molecular orbital. [Au(4-dmapy)2][AuCl2] was found to be an efficient catalyst for Suzuki cross-coupling of aryl bromide and phenylboronic acid.

20.
Fish Shellfish Immunol ; 24(1): 55-66, 2008 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-18083044

RESUMEN

Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is one of the TNF superfamily members, participating in many biological processes including cell proliferation and apoptotic death. In this study, a TRAIL gene was cloned from a perciform fish, the mandarin fish Siniperca chuatsi, a major cultured fish in China's aquaculture, and is named as SCTRAIL for S. chuatsi TRAIL. The full-length cDNA of SCTRAIL is 1359bp, encoding a 283-amino-acid protein. This deduced protein contains the Cys(231), a 23-mer fragment of transmembrane region, a glycosylation site and a TNF family signature, all of which are conserved among TRAIL members. SCTRAIL gene consists of six exons, with five intervening introns, spaced over approximately 9kb of genomic sequence. Southern blotting demonstrated that the SCTRAIL gene is present as a single copy in mandarin fish genome. A 620bp promoter region obtained by genome walking contains a number of putative transcription factor binding sites, such as Oct-1, Sp-1, NF-1, RAP-1, C/EBPalp, NF-kappaB and AP-1. The SCTRAIL is constitutively expressed in all the analyzed tissues, as revealed by RT-PCR, which is confirmed by Western blotting analysis using polyclonal antibody against bacteria-derived recombinant SCTRAIL protein. As an apoptosis-inducing ligand, the overexpression of SCTRAIL but not the mutant SCTRAIL-C203S in HeLa cells induced changes characteristic of apoptosis, including chromatin condensation, nucleus fragmentation, DNA ladder, and increase of sub-G0/G1 cells in FACS analysis.


Asunto(s)
Apoptosis , Perciformes/genética , Ligando Inductor de Apoptosis Relacionado con TNF/genética , Ligando Inductor de Apoptosis Relacionado con TNF/metabolismo , Secuencia de Aminoácidos , Animales , Secuencia de Bases , China , ADN Complementario/genética , Escherichia coli/genética , Perfilación de la Expresión Génica , Células HeLa , Humanos , Datos de Secuencia Molecular , Especificidad de Órganos , Filogenia , Alineación de Secuencia , Ligando Inductor de Apoptosis Relacionado con TNF/química
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA