Dihydroartemisinin-driven selective anti-lung cancer proliferation by binding to EGFR and inhibition of NRAS signaling pathway-induced DNA damage.

Chemotherapeutic agents can inhibit the proliferation of malignant cells due to their cytotoxicity, which is limited by collateral damage. Dihydroartemisinin (DHA), has a selective anti-cancer effect, whose target and mechanism remain uncovered. The present work aims to examine the selective inhibitory effect of DHA as well as the mechanisms involved. The findings revealed that the Lewis cell line (LLC) and A549 cell line (A549) had an extremely rapid proliferation rate compared with the 16HBE cell line (16HBE). LLC and A549 showed an increased expression of NRAS compared with 16HBE. Interestingly, DHA was found to inhibit the proliferation and facilitate the apoptosis of LLC and A549 with significant anti-cancer efficacy and down-regulation of NRAS. Results from molecular docking and cellular thermal shift assay revealed that DHA could bind to epidermal growth factor receptor (EGFR) molecules, attenuating the EGF binding and thus driving the suppressive effect. LLC and A549 also exhibited obvious DNA damage in response to DHA. Further results demonstrated that over-expression of NRAS abated DHA-induced blockage of NRAS. Moreover, not only the DNA damage was impaired, but the proliferation of lung cancer cells was also revitalized while NRAS was over-expression. Taken together, DHA could induce selective anti-lung cancer efficacy through binding to EGFR and thereby abolishing the NRAS signaling pathway, thus leading to DNA damage, which provides a novel theoretical basis for phytomedicine molecular therapy of malignant tumors.

Clinical Efficacy of Percutaneous Osteoplasty Under Fluoroscopy and Cone-Beam CT Guidance for Painful Sternal Metastases: A Case Series.

Background: Although percutaneous osteoplasty (POP) has been widely accepted and is now being performed for the treatment of painful bone metastases outside the spine. It is emerging as one of the most promising procedures for patients with painful bone metastasis who are unsuitable for surgery or who show resistance to radiotherapy and/or analgesic therapies. However, there are only scarce reports regarding osteoplasty in painful sternal metastases. Subjects and Method: We report four patients with sternal metastases suffered with severe pain of anterior chest wall. The original tumors included lung cancer and thyroid cancer. For the initially pain medication failing, all the four patients received POP procedure under fluoroscopic and cone-beam CT (CBCT) guidance, and obtained satisfying resolution of painful symptoms at 6-month postop follow-up. Conclusion: POP is a safe and effective treatment for pain caused by metastatic bone tumors in the sternum. In practice, however, percutaneous puncture of pathologic sternal fractures can be a challenge because of the long flat contour and the defacement by lytic tumor of bony landmarks. We find that the use of fluoroscopic and CBCT can facilitate POP for flat bone fractures with displacing the trajectory planning, needle advancement, and cement delivery in time.

TyG-GGT is a Reliable Non-Invasive Predictor of Advanced Liver Fibrosis in Overweight or Obese Individuals.

BACKGROUND: Liver fibrosis is a predisposing factor for liver cancer. This study will investigate the predictive role of the Triglyceride-glucose and Gamma-glutamyl transferase index (TyG-GGT) as a non-invasive indicator of advanced liver fibrosis in individuals with obesity or overweight. METHOD: We enrolled patients who underwent metabolic and bariatric surgery as well as intraoperative liver biopsies at Zhejiang provincial people's hospital from August 2020 to March 2023. Clinical characteristics, comorbidities, laboratory data, and pathological variables of patients were collected and analysed. Then, we conducted logistics regression model to compare the performance of the TyG-GGT index with other 4 non-invasive models. RESULTS: A total of 65 patients were included in this study. 43(66.2%) of them were female, with the mean body mass index (BMI) of 39.0 ± 7.3 kg/m2. Meanwhile, 24(36.9%) patients were diagnosed with diabetes. Advanced liver fibrosis were observed in 16.9% of patients, while liver cirrhosis was found in 4.6% of patients. The multivariable logistics regression showed that TyG-GGT was an independent risk factor of advanced liver fibrosis (OR = 6.989, P = 0.049). Additionally, compared to another 4 non-invasive liver fibrosis models (NFS = 0.66, FIB4 = 0.65, METS-IR = 0.68, APRI = 0.65), TyG-GGT exhibits the highest AUC value of 0.75. CONCLUSIONS: More than one-third of patients undergoing metabolic and bariatric surgery are afflicted with nonalcoholic steatohepatitis (NASH), and a significant proportion exhibit advanced fibrosis. TyG-GGT was a potentially reliable predictor for screening individuals with overweight or obesity at high risk of advanced liver fibrosis, thus providing clinical guidance for early intervention in this targeted group.

Objective Assessment of Visual Field Defects Caused by Optic Chiasm and Its Posterior Visual Pathway Injury.

OBJECTIVES: To investigate the characteristics and objective assessment method of visual field defects caused by optic chiasm and its posterior visual pathway injury. METHODS: Typical cases of visual field defects caused by injuries to the optic chiasm, optic tracts, optic radiations, and visual cortex were selected. Visual field examinations, visual evoked potential (VEP) and multifocal visual evolved potential (mfVEP) measurements, craniocerebral CT/MRI, and retinal optical coherence tomography (OCT) were performed, respectively, and the aforementioned visual electrophysiological and neuroimaging indicators were analyzed comprehensively. RESULTS: The electrophysiological manifestations of visual field defects caused by optic chiasm injuries were bitemporal hemianopsia mfVEP abnormalities. The visual field defects caused by optic tract, optic radiation, and visual cortex injuries were all manifested homonymous hemianopsia mfVEP abnormalities contralateral to the lesion. Mild relative afferent pupil disorder (RAPD) and characteristic optic nerve atrophy were observed in hemianopsia patients with optic tract injuries, but not in patients with optic radiation or visual cortex injuries. Neuroimaging could provide morphological evidence of damages to the optic chiasm and its posterior visual pathway. CONCLUSIONS: Visual field defects caused by optic chiasm, optic tract, optic radiation, and visual cortex injuries have their respective characteristics. The combined application of mfVEP and static visual field measurements, in combination with neuroimaging, can maximize the assessment of the location and degree of visual pathway damage, providing an effective scheme for the identification of such injuries.

Targeting abnormal lipid metabolism of T cells for systemic lupus erythematosus treatment.

Systemic lupus erythematosus (SLE) is an autoimmune disease in which the immune system attacks its own tissues and organs. However, the causes of SLE remain unknown. Dyslipidemia is a common symptom observed in SLE patients and animal models and is closely correlated to disease activity. Lipid metabolic reprogramming has been considered as a hallmark of the dysfunction of T cells in patients with SLE, therefore, manipulating lipid metabolism provides a potential therapeutic target for treating SLE. A better understanding of the underlying mechanisms for the metabolic events of immune cells under pathological conditions is crucial for tuning immunometabolism to manage autoimmune diseases such as SLE. In this review, we aim to summarize the cross-link between lipid metabolism and the function of T cells as well as the underlying mechanisms, and provide light on the novel therapeutic strategies of active compounds from herbals for the treatment of SLE by targeting lipid metabolism in immune cells.

ß-Elemene enhances erlotinib sensitivity through induction of ferroptosis by upregulating lncRNA H19 in EGFR-mutant non-small cell lung cancer.

Nearly half of all Asian non-small cell lung cancer (NSCLC) patients harbour epidermal growth factor receptor (EGFR) mutations, and first-generation EGFR tyrosine kinase inhibitors (TKIs) are one of the first-line treatments that have improved the outcomes of these patients. Unfortunately, 20% of these patients can not benefit from the treatment. The basis of this primary resistance is poorly understood. Therefore, overcoming EGFR-TKI primary resistance and maintaining the efficacy of TKIs has become a key issue. ß-Elemene, a sesquiterpene compound extracted from Curcuma aromatica Salisb. (wenyujing), has shown potent antitumor effects. In this research, we found that ß-elemene combined with erlotinib enhanced the cytotoxicity of erlotinib to primary EGFR-TKI-resistant NSCLC cells with EGFR mutations and that ferroptosis was involved in the antitumor effect of the combination treatment. We found that lncRNA H19 was significantly downregulated in primary EGFR-TKI-resistant NSCLC cell lines and was upregulated by the combination treatment. Overexpression or knockdown of H19 conferred sensitivity or resistance to erlotinib, respectively, in both in vitro and in vivo studies. The high level of H19 enhanced the cytotoxicity of erlotinib by inducing ferroptosis. In conclusion, our data showed that ß-elemene combined with erlotinib could enhance sensitivity to EGFR-TKIs through induction of ferroptosis via H19 in primary EGFR-TKI-resistant lung cancer, providing a promising strategy to overcome EGFR-TKI resistance in NSCLC patients.

Traditional Herbal Medicine: A Potential Therapeutic Approach for Adjuvant Treatment of Non-small Cell Lung Cancer in the Future.

Lung carcinoma is the primary reason for cancer-associated mortality, and it exhibits the highest mortality and incidence in developed and developing countries. Non-small cell lung cancer (NSCLC) and SCLC are the 2 main types of lung cancer, with NSCLC contributing to 85% of all lung carcinoma cases. Conventional treatment mainly involves surgery, chemoradiotherapy, and immunotherapy, but has a dismal prognosis for many patients. Therefore, identifying an effective adjuvant therapy is urgent. Historically, traditional herbal medicine has been an essential part of complementary and alternative medicine, due to its numerous targets, few side effects and substantial therapeutic benefits. In China and other East Asian countries, traditional herbal medicine is increasingly popular, and is highly accepted by patients as a clinical adjuvant therapy. Numerous studies have reported that herbal extracts and prescription medications are effective at combating tumors. It emphasizes that, by mainly regulating the P13K/AKT signaling pathway, the Wnt signaling pathway, and the NF-κB signaling pathway, herbal medicine induces apoptosis and inhibits the proliferation and migration of tumor cells. The present review discusses the anti-NSCLC mechanisms of herbal medicines and provides options for future adjuvant therapy in patients with NSCLC.

Identification of genetic polymorphisms in unexplained recurrent spontaneous abortion based on whole exome sequencing.

Background: The precise etiology of approximately 50% of patients with recurrent spontaneous abortion (RSA) is unclear, known as unexplained recurrent spontaneous abortion (URSA). This study identified the genetic polymorphisms in patients with URSA. Methods: Genomic DNA was extracted from 30 couples with URSA and 9 couples with normal reproductive history for whole exome sequencing. Variations in annotation, filtering, and prediction of harmfulness and pathogenicity were examined. Furthermore, predictions of the effects of changes in protein structure, Sanger validation, and functional enrichment analyses were performed. The missense mutated genes with significant changes in protein function, and genes with mutations of premature stop, splice site, frameshift, and in-frame indel were selected as candidate mutated genes related to URSA. Results: In 30 unrelated couples with URSA, 50%, 20%, and 30% had 2, 3, and more than 4 miscarriages, respectively. Totally, 971 maternal and 954 paternal mutations were found to be pathogenic or possibly pathogenic after preliminary filtering. Total variations were not associated with age nor the number of miscarriages. In 28 patients (involving 23 couples), 22 pathogenic or possibly pathogenic variants of 19 genes were found to be strongly associated with URSA, with an abnormality rate of 76.67%. Among these, 12 missense variants showed obvious changes in protein functions, including ANXA5 (c.949G>C; p.G317R), APP (c.1530G>C; p.K510N), DNMT1 (c.2626G>A; p.G876R), FN1 (c.5621T>C; p.M1874T), MSH2 (c.1168G>A; p.L390F), THBS1 (c.2099A>G; p.N700S), KDR (c.2440G>A; p.D814N), POLR2B (c.406G>T; p.G136C), ITGB1 (c.655T>C; p.Y219H), PLK1 (c.1210G>T; p.A404S), COL4A2 (c.4808 A>C; p.H1603P), and LAMA4 (c.3158A>G; p.D1053G). Six other genes with mutations of premature stop, splice site, frameshift, and in-frame indel were also identified, including BUB1B (c.1648C>T; p.R550*) and MMP2 (c.1462_1464delTTC; p.F488del) from the father, and mutations from mother and/or father including BPTF (c.396_398delGGA; p.E138 del and c.429_431GGA; p.E148del), MECP2 (c.21_23delCGC; p.A7del), LAMA2 (HGVS: NA; Exon: NA; SPLICE_SITE, DONOR), and SOX21 (c.640 _641insT; p. A214fs, c.644dupC; p. A215fs and c.644_645ins ACGCGTCTTCTTCCCGCAGTC; p. A215dup). Conclusions: These pathogenic or potentially pathogenic mutated genes may be potential biomarkers for URSA and may play an auxiliary role in the treatment of URSA.

Kuwanon G protects HT22 cells from advanced glycation end product-induced damage.

The incidence of diabetic encephalopathy is increasing as the population ages. Evidence suggests that formation and accumulation of advanced glycation end products (AGEs) plays a pivotal role in disease progression, but limited research has been carried out in this area. A previous study demonstrated that Kuwanon G (KWG) had significant anti-oxidative stress and anti-inflammatory properties. As AGEs are oxidative products and inflammation is involved in their generation it is hypothesized that KWG may have effects against AGE-induced neuronal damage. In the present study, mouse hippocampal neuronal cell line HT22 was used. KWG was shown to significantly inhibit AGE-induced cell apoptosis in comparison with a control treatment, as determined by both MTT and flow cytometry. Compared with the AGEs group, expression of pro-apoptotic protein Bax was reduced and expression of anti-apoptotic protein Bcl-2 was increased in the AGEs + KWG group. Both intracellular and extracellular levels of acetylcholine and choline acetyltransferase were significantly elevated after KWG administration in comparison with controls whilethe level of acetylcholinesterase decreased. These changes in protein expression were accompanied by increased levels of superoxide dismutase and glutathione peroxidase synthesis and reduced production of malondialdehyde and reactive oxygen species. Intracellular signaling pathway protein levels were determined by western blot and immunocytochemistry. KWG administration was found to prevent AGE-induced changes to the phosphorylation levels of Akt, IκB-α, glycogen synthase kinase 3 (GSK3)-α and ß, p38 MAPK and NF-κB p65 suggesting a potential neuroprotective effect of KWG against AGE-induced damage was via the PI3K/Akt/GSK3αß signaling pathway. The findings of the present study suggest that KWG may be a potential treatment for diabetic encephalopathy.

Spectrum of ß-Thalassemia Mutations in Some Areas of Guangxi Zhuang Autonomous Region of Southern China: A Study on a Pediatric Population Aged 0-15 Years.

ß-Thalassemia (ß-thal), one of the most common form of single-gene inheritable blood diseases in the world, is highly prevalent in southern China, especially in the Guangxi Zhuang Autonomous Region. To update the ß-thal mutation spectrum in this region, we performed hematological and genetic analyses on 888 ß-thal major (ß-TM), ß-thal intermedia (ß-TI) and ß-thal carrier patients, aged 0-15 years old, from different parts of Guangxi Province. We identified 55 genotypes and 18 ß-thal mutations. The codons 41/42 (-TTCT) (HBB: c.126_129delCTTT) (43.97%), codon 17 (A>T) (HBB: c.52A>T) (25.43%), -28(A>G) (HBB: c.-78A>G) (8.18%), IVS-II-654 (C>T) (HBB: c.316-197C>T) (7.85%) and codon 26 (G>A) (HBB: c.79G>A) (5.02%) were the five most common, accounting for more than 90.0%. The results of our study are providing an up-to-date ß-thal mutation spectrum in the 0-15-year-old pediatric population, which will help genetic counseling and prevention of ß-TM in mainland China's most endemic region, Guangxi Zhuang Autonomous Region.

Vagus nerve plays a pivotal role in CD4+ T cell differentiation during CVB3-induced murine acute myocarditis.

Abnormalities in CD4+ T cell (Th cell) differentiation play an important role in the pathogenesis of viral myocarditis (VMC). Our previous studies demonstrated that activation of the cholinergic anti-inflammatory pathway (CAP) alleviated the inflammatory response. In addition, we observed that right cervical vagotomy aggravates VMC by inhibiting CAP. However, the vagus nerve's effect on differentiation of CD4+ T cells has not been studied in VMC mice to date. In this study, we investigated the effects of cervical vagotomy and the α7nAChR agonist pnu282987 on CD4+ T cell differentiation in a murine myocarditis model (BALB/c) infected with coxsackievirus B3 (CVB3). Splenic CD4+ T cells from CVB3-induced mice obtained and cultured to investigate the potential mechanism of CD4+ T cell differentiation. Each Th cell subset was analyzed by flow cytometry. Our results showed that right cervical vagotomy increased proportions of Th1 and Th17 cells and decreased proportions of Th2 and Treg cells in the spleen. Vagotomy-induced upregulation of T-bet, Ror-γ, IFN-γ, and IL-17 expression while downregulating the expression of Gata3, Foxp3, and IL-4 in the heart. In addition, we observed upregulated levels of proinflammatory cytokines, aggravated myocardial lesions and cellular infiltration, and worsened cardiac function in VMC mice. Pnu282987 administration reversed these outcomes. Furthermore, vagotomy inhibited JAK2-STAT3 activation and enhanced NF-κB activation in splenic CD4+ T cells. The CD4+ T cell differentiation was related to JAK2-STAT3 and NF-κB signal pathways. In conclusion, vagus nerve modulates the inflammatory response by regulating CD4+ T cell differentiation in response to VMC.

Molecular Dynamics Simulations of Mite Aquaporin DerfAQP1 from the Dust Mite Dermatophagoides farinae (Acariformes: Pyroglyphidae).

Aquaporins are a large family of transmembrane channel proteins that facilitate the passive but highly selective transport of water and other small solutes across biological membranes. House dust mite (Dermatophagoides farinae) is the major source of household immunogens, and we have recently reported six cDNA sequence encoding aquaporins from this mite species. To better understand the structure and role of mite aquaporin, we constructed a tertiary structure for DerfAQP1 by homology modeling from the X-ray structure of malaria aquaporin PfAQP (Protein Data Bank code No. 3C02) and conducted molecular dynamics simulation. The simulation arranged seven water molecules in a single file through the pores of the DerfAQP1. Further, two conserved Asn-Pro-Ala motifs were located on Asn203 and Asn77; residues Arg206, Trp57, Met190, Gly200, and Asp207 constituted an extracellular vestibule of the pore; and residues His75, Val80, Ile65, and Ile182 constituted the cytoplasmic portions. The overall free energy profile for water transport through DerfAQP1 revealed an energy barrier of ~2.5 kcal/mol. These results contribute to the understanding of mite physiology and pathology.

Association between CYP2B6 polymorphism and acute leukemia in a Han population of Northwest China.

BACKGROUND: The aim of this study was to investigate potential associations between CYP2B6 c.516G>T polymorphism and the occurrence and prognosis of acute leukemias (AL) in the Han population of Northwest China. METHODS: The CYP2B6 gene polymorphism was analyzed by PCR-RFLP and Sanger DNA sequencing in 126 patients with AL and 161 healthy controls. RESULTS: Compared with controls, there were significantly higher frequencies of GT and TT genotypes and T alleles in AL patients (p < .05), particularly in fusion gene-positive AL patients. There was no significant difference in CYP2B6 polymorphic genotypes and T alleles between AL patients with complete remission after the first course of chemotherapy and controls (p > .05), while the frequencies in AL patients with partial remission and no remission were significantly higher. The CYP2B6 allele frequency in Han Chinese in Northwest China was significantly different to that reported in Han Chinese and other ethnic minorities in southern China, Uygur Chinese, Vietnamese, African, German, British, Spanish, Turkish, and Argentinian populations; however, there was no significant difference compared with allele frequencies reported in Tibetan and Mongolian Chinese, Japanese, Korean, and American populations. CONCLUSION: Our findings show a strong correlation of the CYP2B6 c.516G>T polymorphism in the Han population of Northwest China with AL, especially fusion gene-positive AL, and indicate a poor prognosis after the first course of chemotherapy. Our findings also implicate the T allele in AL susceptibility and indicate the existence of racial and geographical differences in allele frequencies of CYP2B6 c.516G>T polymorphism.

[Extraction of land-cover and wetland area in Bohai Rim region based on Google Earth Engine.] / 基于Google Earth Engine的环渤海地区土地覆盖分类.

The land cover of Bohai Rim region has changed greatly due to urbanization and economic development. Monitoring the land cover with high accuracy and real time is the most important basis for relevant researches. Traditional single-machine processing mode is difficult to realize rapid monitoring for large-scale and long-time series. The emergence of remote sensing big data makes it possible to combine computing platform and massive data. The land cover maps of study area were interpreted based on Google Earth Engine (GEE) platform with decision tree (CART) method from 2000 to 2019. The land cover change was analyzed, and the interpretation results using different data sources were compared. The results showed that the GEE platform could realize the rapid land cover interpretation in a large area, which interpreted coastal wetlands and other cover types with high accuracy over 80% comparing the surveyed points. Compared with Landsat images, the Sentinel-2A images interpretation results had a great improvement in accuracy, which increased from 85% to 95%, and thus more detailed surface information could be reflected. In 2000, the area of wetland, build-up area, farmland, forest, and water in the study area were 1612.5, 5734.9, 32074.8, 11853 and 3504.3 km2, accounting for 2.9%, 10.5%, 58.6%, 21.6% and 6.4% respectively. By 2019, wetlands had been reduced by 775.1 km2, with a decline of 40.1%; built-up area increased by 5310.5 km2 with an increasing rate of 92.6%. The area of farmland, forestland and water area decreased 1841.6, 1823.5 and 870.3 km2, with a decreasing rate of 5.7%, 24.8% and 48.1%, respectively. The coastal urbanization process caused the occupation of built-up area to other land use types, which was the main driving force of land cover change in the study area.

Effect of CXCL12/CXCR4 on migration of decidua-derived mesenchymal stem cells from pregnancies with preeclampsia.

PROBLEM: Systemic immuno-inflammatory response caused by maternal immune imbalance is central to the pathogenesis of preeclampsia (PE). We hypothesized that changes in the number of decidual mesenchymal stem cells (dMSCs) may be associated with maternal immune imbalance. We aimed to evaluate the expression of CXCL12/CXCR4 axis in patients with PE and its influence on the migration behavior of dMSCs, to further clarify the pathogenesis of PE. METHOD OF STUDY: Fourteen women with PE and 11 controls were included. DMSCs were extracted from decidual tissue by type II collagenase digestion and adherence. ELISA and immunohistochemistry analysis were used to measure serum and tissue levels of CXCL12. Q-PCR and Western blotting were used to detect CXCR4 expression on dMSCs, whereas transwell assay was used to measure the migration ability of dMSCs. RESULTS: Decidual mesenchymal stem cells from women with PE showed higher expressions of CXCR4 and HIF-1α than the dMSCs of controls did. Tissues from women with PE showed the highest CXCL12 levels in the decidua, followed by the placenta and umbilical cord, whereas tissues from controls showed the highest CXCL2 levels in the umbilical cord, followed by the placenta and decidua. dMSCs from women with PE showed possibly higher migration ability than that of dMSCs from controls, under the induction of CXCL12, whereas dMSCs showed a decreasing trend in hypoxic than in normoxic environment. CONCLUSION: Decidual mesenchymal stem cells from women with PE can migrate to the decidua layer with the concentration gradient of CXCL12, which may play a role in the occurrence and development of PE.

Fatigue in chronic hepatitis B patients is significant and associates with autonomic dysfunction.

BACKGROUND: Fatigue is an important clinical finding in patients with chronic hepatitis virus infection. However, studies assessing fatigue in patients with chronic hepatitis B (CHB) are very limited. This study aimed to quantify the severity of fatigue in patients with CHB, to determine whether perceived fatigue reflects impairment of functional ability, and to explore potential causes. METHODS: A total of 133 patients with histologically proven CHB and 59 community controls were assessed using the fatigue impact scale (FIS). RESULTS: The degree of fatigue was significantly higher in patients with CHB than in controls (mean (range) FIS 24.9 (0-91) vs. 15.7 (0-31), p < 0.001). Fatigue experienced by patients with CHB was similar to that in primary biliary cirrhosis (PBC) (n = 20) (FIS 22.2 vs. 20.9, p = 0.28). No association was found between FIS and biochemistry and histological parameters of liver disease severity. Significant associations were found between fatigue severity and cognitive impairment (r = 0.39, p < 0.001), daytime somnolence (r = 0.32, p < 0.001), scores of the Chronic Liver Disease Questionnaire (r = - 0.31, p < 0.001), and autonomic symptoms (r = 0.43, p < 0.001). The level of autonomic symptom was the only factor independently associated with the degree of fatigue. CONCLUSION: Fatigue is a significant problem of functional ability impairment in CHB and similar in degree to that in PBC patients. Fatigue in patients with CHB appears to be unrelated to the severity of liver disease but is associated with significant autonomic symptoms.

Discovery and Validation of a Serologic Autoantibody Panel for Early Diagnosis of Esophageal Squamous Cell Carcinoma.

BACKGROUND: Esophageal squamous cell carcinoma (ESCC) accounts for the highest incidence rate worldwide and is responsible for the fourth leading cause of cancer-related death. Currently, serologic biomarkers for early ESCC diagnosis are needed for timely treatment. METHODS: The performance of a four-autoantibody panel (i.e., anti-TP53, HRAS, CTAG1A, and NSG1) was evaluated by ELISA for the early diagnosis of ESCC with 569 retrospective serum samples. A training set comprising 129 patients with early-stage ESCC, 130 patients with esophageal benign lesion (EBL), and 150 healthy controls (HC) was used to develop an early ESCC predictive model. Data obtained from an independent validation set were used to evaluate and validate the predictive model to distinguish the early ESCC from the controls (EBL+HC). Finally, a multiplexed assay based on the Luminex xMAP technology platform was developed to enable simultaneous detection of the four-autoantibody panel using the validation set. RESULTS: The four-autoantibody panel significantly discriminated early ESCC cases from the controls with 62.8% sensitivity at 88.9% specificity in the training set and with 58.0% sensitivity at 90.0% specificity in the independent validation set. The results of the multiplexed assay using xMAP technology for early ESCC showed a significant correlation with that of the ELISA assays with 66.0% sensitivity at 90.9% specificity. CONCLUSIONS: A four-autoantibody panel showed good performance for early ESCC diagnosis with ELISA and could be further developed into a multiplex assay using the Luminex xMAP technology. IMPACT: The four-autoantibody panel could be used for serologic screening for early ESCC.

Pegylated-interferon consolidation treatment versus nucleos(t)ide analogue consolidation treatment in non-cirrhotic hepatitis B patients with hepatitis B e antigen seroconversion: an open-label pilot trial.

BACKGROUND: The safety of nucleos(t)ide analogue (NA) treatment cessation remains one of the most controversial topics in the management of chronic hepatitis B (CHB) patients. This study investigated the efficiency of 48-week pegylated-interferon (peg-IFN) alfa-2a consolidation therapy on viral relapse after discontinued NA treatment in CHB patients who achieved hepatitis B e antigen (HBeAg) seroconversion for > 1 year. METHODS: NA-treated HBeAg-positive patients who achieved the standard of discontinued NA treatment (i.e. time of HBeAg seroconversion > 1 year) were randomly assigned to receive peg-IFN consolidation (n = 24) treatment or continue original NA therapy (n = 24) for 48 weeks. The treatments were then discontinued, and the patients were observed up to 144 weeks. The primary endpoint was the proportion of patients with viral relapse at week 144 among those who received at least one dose of study drug or had at least one study visit [modified intention-to-treat population (mITT)]. RESULTS: Of the 24 patients who received peg-IFN treatment, 6 (25%) experienced viral relapse and 8 (36.3%) showed HBsAg loss during 96 weeks of treatment-free follow-up. Of the patients who underwent NA consolidation treatment, only 1 (4.3%) of 23 patients showed HBsAg loss and 14 (58.3%) of 24 patients experienced viral relapse during follow-up. HBsAg level decline < 0.25 log10 IU/mL at week 96 was significantly associated with viral relapse. CONCLUSION: A 48-week peg-IFN alfa-2a consolidation therapy increased the rate of HBsAg loss and sustained viral replication suppression in HBeAg-positive patients who achieved HBeAg seroconversion for > 1 year after NA treatment discontinuation.

Greatly Enhanced Faradic Capacities of 3D Porous Mn3O4/G Composites as Lithium-Ion Anodes and Supercapacitors by C-O-Mn Bonding.

Through C-O-Mn bonding, graphene nanosheets are homogeneously dispersed in porous Mn3O4 to take full advantages of porous Mn3O4 and graphene nanosheets, making the as-formed three-dimensional porous Mn3O4/reduced graphene oxide (rGO) composite exhibit good electrochemical performance. Besides, C-O-Mn bonding is demonstrated to greatly promote the Faradic reactions of the composite, resulting in the enhancement of its real capacity in supercapacitor (SC) electrodes as well as lithium-ion battery (LIB) anodes. By simply fine-tuning the content of graphene (<7 wt %), the composite with 2.8 wt % of rGO delivers a high capacitance of 315 F g-1 at 0.5 A g-1 with a high rate capability of 64.7% at 30 A g-1 and an excellent cycling stability of 105% (5 A g-1, 5000 cycles) as an SC electrode. Also, the one with 6.9 wt % rGO can present a reversible capacity of more than 1500 mAh g-1 at 0.05 A g-1 as the LIB anode, the highest value reported to date, which remains 561 mAh g-1 at 1 A g-1.

Neurological manifestations of atrial myxoma: A retrospective analysis.

Atrial myxoma is the most common type of primary cardiac tumor and it is closely associated with stroke in adults. Early diagnosis and treatment of atrial myxomas is essential for the prevention of embolic events. The aim of the present study was to assess neurological complications associated with atrial myxoma. The neurological signs of atrial myxoma were retrospectively assessed in individuals who underwent treatment at West China Hospital (Chengdu, China) and The Affiliated Hospital of Hainan Medical University (Haikou, China), between March 2003 and February 2015. A total of 130 patients with atrial myxoma were included and 22 (17%) exhibited neurologic signs. These patients were aged 39.9±12.6 years (range, 13-78 years) and there were 13 female and 9 male patients. Ischemic cerebral infarct constituted the dominant clinical symptom (68.2%) and 3 patients exhibited concomitant cardiac manifestations. Atrial myxoma was diagnosed by echocardiography in all patients. Irregular surface of atrial myxomas was associated with a high risk of embolic events. The patients with myxoma successfully underwent surgery with no mortality recorded. In conclusion, atrial myxomas frequently manifest as cerebral infarction in individuals without cardiovascular risk factors. These tumors more commonly affect the middle cerebral artery. Irregular surface of myxomas appears to be associated with embolic events. Echocardiography may improve the diagnosis and early treatment of atrial myxomas.