A novel humanized MUC1 antibody-drug conjugate for the treatment of trastuzumab-resistant breast cancer.

Mucin 1 (MUC1) has been regarded as an ideal target for cancer treatment, since it is overexpressed in a variety of different cancers including the majority of breast cancer. However, there are still no approved monoclonal antibody drugs targeting MUC1. In this study, we generated a humanized MUC1 (HzMUC1) antibody from our previously developed MUC1 mouse monoclonal antibody that only recognizes MUC1 on the surface of tumor cells. Furthermore, an antibody-drug conjugate (ADC) was generated by conjugating HzMUC1 with monomethyl auristatin (MMAE), and the efficacy of HzMUC1-MMAE on the MUC1-positive HER2+ breast cancer in vitro and in 'Xenograft' model was tested. Results from western blot analysis and immunoprecipitation revealed that the HzMUC1 antibody did not recognize cell-free MUC1-N in sera from breast cancer patients. Confocal microscopy analysis showed that HzMUC1 antibody bound to MUC1 on the surface of breast cancer cells. Results from mapping experiments suggested that HzMUC1 may recognize an epitope present in the interaction region between MUC1-N and MUC1-C. Results from colony formation assay and flow cytometry demonstrated that HzMUC1-MMAE significantly inhibited cell growth by inducing G2/M cell cycle arrest and apoptosis in trastuzumab-resistant HER2-positive breast cancer cells. Meanwhile, HzMUC1-MMAE significantly reduced the growth of HCC1954 xenograft tumors by inhibiting cell proliferation and enhancing cell death. In conclusion, our results indicate that HzMUC1-ADC is a novel therapeutic drug that can overcome trastuzumab resistance of breast cancer. HzMUC1-ADC should also be an effective therapeutic drug for the treatment of different MUC1-positive cancers in clinic.

24-Dehydrocholesterol reductase promotes the growth of breast cancer stem-like cells through the Hedgehog pathway.

Cholesterol is a risk factor for breast cancer. However, it is still unclear whether the cholesterol biosynthesis pathway plays any significant role in breast carcinogenesis. 24-Dehydrocholesterol reductase (DHCR24) is a key enzyme in the cholesterol synthesis pathway. Although DHCR24 is reported to have different functions in different cancers, it is not clear whether DHCR24 is involved in breast cancer. In this study, we found that DHCR24 expression was higher in breast cancer especially in luminal and HER2 positive breast cancer tissues compared with normal breast. Changes in DHCR24 expression altered cellular cholesterol content without affecting the adherent growth of breast cancer cells. However, DHCR24 knockdown reduced whereas DHCR24 overexpression enhanced breast cancer stem-like cell populations such as mammosphere and aldehyde dehydrogenase positive cell numbers. In addition, DHCR24 overexpression increased the expression of the Hedgehog pathway-regulated genes. Treating DHCR24 overexpressing breast cancer cell lines with the Hedgehog pathway inhibitor GANT61 blocked DHCR24-induced mammosphere growth and increased mRNA levels of the Hedgehog regulated genes. Furthermore, expression of a constitutively activated mutant of Smoothened, a key hedgehog signal transducer, rescued the decreases in mammosphere growth and Hedgehog regulated gene expression induced by knockdown of DHCR24. These results indicate that DHCR24 promotes the growth of breast cancer stem-like cells in part through enhancing the Hedgehog signaling pathway. Our data suggest that cholesterol contribute to breast carcinogenesis by enhancing Hedgehog signaling and cancer stem-like cell populations. Enzymes including DHCR24 involved in cholesterol biosynthesis should be considered as potential treatment targets for breast cancer.

Ginsenoside Rg1 nanoparticle penetrating the blood-brain barrier to improve the cerebral function of diabetic rats complicated with cerebral infarction.

Diabetic cerebral infarction is with poorer prognosis and high rates of mortality. Ginsenoside Rg1 (Rg1) has a wide variety of therapeutic values for central nervous system (CNS) diseases for the neuron protective effects. However, the blood-brain barrier (BBB) restricts Rg1 in reaching the CNS. In this study, we investigated the therapeutic effects of Rg1 nanoparticle (PHRO, fabricated with γ-PGA, L-PAE (H), Rg1, and OX26 antibody), targeting transferrin receptor, on the diabetes rats complicated with diabetic cerebral infarction in vitro and in vivo. Dynamic light scattering analysis shows the average particle size of PHRO was 79±18 nm and the polydispersity index =0.18. The transmission electron microscope images showed that all NPs were spherical in shape with diameters of 89±23 nm. PHRO released Rg1 with sustained release manner and could promote the migration of cerebrovascular endothelial cells and tube formation and even penetrated the BBB in vitro. PHRO could penetrate the BBB with high concentration in brain tissue to reduce the cerebral infarction volume and promote neuronal recovery in vivo. PHRO was promising to be a clinical treatment of diabetes mellitus with cerebral infarction.

Sinomenine inhibits the inflammatory responses of human fibroblast-like synoviocytes via the TLR4/MyD88/NF-κB signaling pathway in rheumatoid arthritis.

Rheumatoid arthritis (RA) is a systemic autoimmune disorder mainly characterized by inflammation of the synovial tissue that can lead to destruction of bone and cartilage. Sinomenine is an alkaloid extracted from the stem of the Chinese medicinal plant Sinomenium acutum. It has been reported that sinomenine has immunosuppressive and anti-inflammatory properties. However, the molecular mechanism underlying the effect of sinominine on IL-1ß-induced human RA fibroblast-like synoviocytes (RAFLS) is poorly understood. Therefore, in this study, we investigated the effect of sinomenine on the expression of inflammatory cytokines in IL-1ß-treated human RAFLS in vitro and the underlying mechanism. RAFLS viability was evaluated using the MTS assay after sinomenine treatment. The levels of inflammatory cytokines were measured with ELISA, RT-PCR and western blot, respectively. The levels of TLR4 and its downstream signaling targets were determined by western blot analysis. We found that sinomenine suppressed not only NO and PGE2 production but also iNOS and COX-2 expression in IL-1ß-induced RAFLS. It also inhibited the expression of TNF-α and IL-6 in IL-1ß-stimulated RAFLS. Furthermore, sinomenine prevented IL-1ß-induced TLR4, MyD88 and p-NF-κB p65 expression. Taken together, these results demonstrated that sinomenine prevented IL-1ß-induced inflammation in human RAFLS at least in part by inhibiting the TLR4/MyD88/NF-κB signaling pathway, suggesting that sinomenine could be a potential agent in the treatment of RA.

Curcumin inhibits osteoclastogenic potential in PBMCs from rheumatoid arthritis patients via the suppression of MAPK/RANK/c-Fos/NFATc1 signaling pathways.

The aim of the present study was to determine the effects of curcumin on the osteoclastogenic potential of peripheral blood mononuclear cells (PBMCs) obtained from patients with rheumatoid arthritis (RA), and to investigate the underlying molecular mechanisms. PBMCs from patients with RA (n=12) and healthy controls (n=10) were cultured to assess osteoclastogenic potential. The number of tartrate­resistant acid phosphatase­positive osteoclasts differentiated from PBMCs isolated from patients with RA was significantly increased compared with that of the healthy controls. In addition, the osteoclast number in patients with RA was correlated with the clinical indicators, Sharp score (r=0.810; P=0.001) and lumbar T­score (r=­0.685; P=0.014). Furthermore, the resorption area was increased in the RA group compared with the healthy controls. The mRNA and protein expression levels in PBMC­derived osteoclasts treated with curcumin were measured by reverse transcription­quantitative polymerase chain reaction and western blotting, respectively. Curcumin inhibited the osteoclastogenic potential of PBMCs, potentially by suppressing activation of extracellular signal­regulated kinases 1 and 2, p38 and c­Jun N­terminal kinase, and inhibiting receptor activator of nuclear factor κB (RANK), c­Fos and nuclear factor of activated T cells (NFATc1) expression. The results of the present study demonstrated that curcumin may inhibit the osteoclastogenic potential of PBMCs from patients with RA through the suppression of the mitogen­activated protein kinase/RANK/c­Fos/NFATc1 signaling pathways, and that curcumin may be a potential novel therapeutic agent for the treatment of bone deterioration in inflammatory diseases such as RA.

Synthesis and anti-BVDV activity of novel δ-sultones in vitro: implications for HCV therapies.

In this study we report the synthesis and activity against bovine viral diarrhea virus (BVDV) of a novel series of bicycle δ-sultones containing γ-lactones. BVDV is responsible for major losses in cattle. Some of the synthesized δ-sultones showed pronounced anti-BVDV activity with EC50 values of 0.12-1.0µM and no significant cytotoxicity. Among them, the ortho bromosubstituted derivative 4f (EC50=0.12µM) showed better antiviral activity than other derivatives and was 10 fold more that of than positive control ribavirin (EC50=1.3µM). BVDV is also considered to be a valuable surrogate for the hepatitis C virus (HCV) in antiviral drug studies. The above results provided a novel candidate for the development of anti-HCV agents.

Sinomenine decreases MyD88 expression and improves inflammation-induced joint damage progression and symptoms in rat adjuvant-induced arthritis.

Sinomenine (SIN) is the active principle of the Chinese medical plant Sinomenium acutum which is widely used for the treatment of rheumatoid arthritis (RA) in China. Recently, several groups indicated that myeloid differentiation primary response protein 88 (MyD88) might be associated with disease progression of RA. Here, we observed the effect of SIN on MyD88 expression and showed its therapeutic role in RA. First, immunohistochemical staining in clinical specimens showed that MyD88 was mainly located in characteristic pathological structures of RA synovial tissues. Second, we found that MyD88 was overexpressed in the synovial tissues of the rats with adjuvant-induced arthritis (AIA). Treatment with SIN markedly decreased the expression of MyD88 in AIA rats. Finally, we provided evidences that SIN suppressed inflammation response and inflammation-induced joint destructive progression and arthritis symptoms in AIA rats. Therefore, SIN is an effective therapeutic agent for RA. Targeting MyD88 signaling may provide new methods for the treatment of RA.

A facile synthesis, antibacterial activity of pulvinone and its derivatives.

Pulvinone and several 3-fluoro-4-morpholino substituted pulvinone derivatives were synthesized in five steps from a common precursor, phenyl acetic acid. Most of synthetic morpholine substituted pulvinones showed inhibitory activity against Esherichia coli. For the first time, the inhibition of pulvinone and its derivatives against Gram-negative bacteria was reported.

[Effect of acupuncture on serum leptin level in patients with type II diabetes mellitus].

OBJECTIVE: To study the relationship between serum leptin and insulin resistance, and to analyze the effect of acupuncture on serum leptin level in patients with type-II diabetes mellitus (DM). METHODS: A total of 80 type-II DM patients were randomized into acupuncture and medication groups. Acupuncture was applied to Yishu (EX), Feishu (BL13), Pishu (BL 20), etc. according to syndrome identification. The treatment was given once every other day for 12 weeks. For patients in the medication group, Glibenclamide (2.5-7.5 mg/time, 1-2 times/d according to blood sugar level) was given for 12 weeks. Fasting blood glucose (FBG), fasting insulin (FINS) and fasting leptin (FLP) were detected by using glucose oxidase method, radioimmunoassay and ELISA, respectively. Insulin sensitivity index (ISI) and homeostasis model assessment-insulin resistance (HOMA-IR) were calculated. RESULTS: In comparison with pre-treatment, FBG levels and HOMA-IR in both acupuncture and medication groups, and FINS and FLP levels in the acupuncture group were decreased significantly (P < 0.01), while ISI in both acupuncture and medication groups, and FINS level in the medication group were increased remarkably after the treatment (P < 0.01). Comparison between two groups showed that after the treatment, FINS and FLP levels, and HOMA-IR of the acupuncture group were considerably lower than those of the medication group (P < 0.01), while ISI of the acupuncture group was significantly higher than that of the medication group (P < 0.01). CONCLUSION: Acupuncture therapy is effective in lowering FLP level, which may contribute to its clinical effect in improving type-II DM.

Two-step hydrothermal conversion of Pubescens to obtain furans and phenol compounds separately.

The stepwise hydrothermal conversion of Pubescens selectively to furans and phenol compounds was investigated in a sealed autoclave reactor. The influence of reaction temperature and reaction time on the product distribution was studied. The results were compared to those from direct pyrolysis process. The residues from Pubescens via hydrothermal route and pyrolytic route were characterized by SEM and component analysis. A new method for obtaining furans and phenols separately through a two-step process was proposed. The first step was suggested performing at a moderate temperature for a shorter time to obtain liquid product with high furan content, while the second step was designed proceeding at a higher temperature for a comparatively longer time to produce more phenol compounds.

[Relationship between lupus headache and headache due to internal injury in traditional Chinese medicine].

In 1999, the nomenclature and case definitions for neuropsychiatric lupus syndromes were published by American College of Rheumatology (ACR), and the cognition of neuropsychiatric damage of systemic lupus erythematosus (SLE) was gradually unified and standardized. Lupus headache is an intractable problem in SLE, especially in SLE patients complicated with multiple organ injury. In general, vascular headache is common in most SLE patients, and a small number of SLE patients complicated with nervous headache are found in clinic. Moreover, its pathophysiological mechanism is far from being understood. Although early diagnosis is essential for good outcomes, the diagnosis method is rather confused in the world. There still exist some limitations in the proposal of clinical classification of headache from ACR and International Headache Society (IHS), and the proposal does not mention the classification of headache related to psychiatric damage. Current therapeutic regimens are almost exclusively based on empirical evidence. Treatment approaches include symptomatic treatment, immunosuppressive, anticoagulant and anti-aggregant therapies. It provides enormous and hopeful space in research of combined therapy strategy, especially in the field of traditional Chinese medicine. The authors discussed the relationship between lupus headache and headache due to internal injury in the view of integrated traditional Chinese and Western medicine, and suggested that the treatment strategy for lupus headache should be made in argument with the headache due to internal injury. Syndrome differentiation treatment according to deficiency in the root and excess in the branch and the therapy for activating blood to dredge collaterals maybe have great advantages in treatment of the headache in SLE.

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.