Efficacy of cecal retroflexion observed on adenoma missing of ascending colon during colonoscopy: A prospective, randomized, pilot trial.

BACKGROUND: Although colonoscopic retroflexion has been proved effective in reducing missed adenomas, there is still a lack of comprehensive and in-depth research focused on the ascending colon. We aimed to conduct a randomized controlled trial and tandem colonoscopy to investigate whether cecal retroflexion observed during colonoscopy can reduce missed adenomas in the ascending colon. METHODS: Men and women required to be between 45 and 80 years of age were screened for enrollment in the trial. Patients were randomly assigned according to a 1:1 ratio to either the trial group or control group. Patients in the trial group underwent 2 forward examination and a cecal retroflexion observed in the ascending colon, while patients in the control group underwent only 2 forward examinations in the ascending colon. The primary outcome was adenoma miss rate. The secondary outcomes contained adenoma detection rate, polyp miss rate, polyp detection rate, insertion time and withdrawal time. Differences between groups in the primary outcome and in the other categorical indicators were tested using chi-squared test and Fisher exact test. For the comparison of continuous outcomes, the Student t test was applied. RESULTS: A total of 60 subjects were eligible for the study between April to June 2020, of which 55 were randomized and eligible for analysis (26 to the control group and 29 to the trial group). The characteristics of patients were no significant differences statistically between the trial group and the control group. Similarly, the characteristics of the colonoscopy procedures included cecal insertion distance, the length of cecum and ascending colon, insertion time, withdrawal time, quality of bowel preparation, numerical rating scale for pain, polyps detected, and adenomas detected, and there were no significant differences statistically between the 2 groups (P = .864, P = .754, P = .700, P = .974, P = .585, P = .835, P = .373, P = .489). The characteristics of the polyps were also no significant differences statistically between the 2 groups. CONCLUSION: This pilot trial failed to show benefit of cecal retroflexion observed on adenoma missing of ascending colon during colonoscopy; however, further conclusions require a prospective study with a higher level of evidence. (NCT03355443).

Re-recognition of BMPR1A-related polyposis: beyond juvenile polyposis and hereditary mixed polyposis syndrome.

Background: Bone morphogenetic protein receptor type 1A (BMPR1A) is responsible for two individual Mendelian diseases: juvenile polyposis syndrome and hereditary mixed polyposis syndrome 2, which have overlapping phenotypes. This study aimed to elucidate whether these two syndromes are just two subtypes of a single syndrome rather than two isolated syndromes. Methods: We sequenced the BMPR1A gene in 186 patients with polyposis and colorectal cancer, and evaluated the clinicopathological features and phenotypes of the probands and their available relatives with BMPR1A mutations. Results: BMPR1A germline mutations were found in six probands and their three available relatives. The numbers of frameshift, nonsense, splice-site, and missense mutations were one, one, two, and two, respectively; two of the six mutations were novel. Typical juvenile polyps were found in only three patients. Two patients had colorectal cancer rather than any polyps. Conclusions: Diseases in BMPR1A germline mutation carriers vary from mixed polyposis to sole colorectal cancer, and typical juvenile polyps do not always occur in these carriers. The variety of phenotypes reflected the features of BMPR1A-mutation carriers, which should be recognized as a spectrum of one syndrome. Genetic testing may be a good approach to identifying BMPR1A-related syndromes.

Delayed diagnosis of Peutz-Jeghers syndrome due to pathological information loss or mistake in family/personal history.

OBJECTIVE: To report Peutz-Jeghers syndrome (PJS) cases with non-definitive clues in the family or personal history and finally diagnosed through pathological examination and STK11 gene mutation test. CLINICAL PRESENTATION AND INTERVENTION: PJS was suspected in 3 families with tortuous medical courses. Two of them had relatives departed due to polyposis or colon cancer without pathological results, and the other one had been diagnosed as hyperplastic polyposis before. Diagnosis of PJS was confirmed by endoscopy and repeated pathological examinations, and the STK11 mutation test finally confirmed the diagnosis at genetic level, during which 3 novel mutation were detected (536C > A, 373_374insA, 454_455insGGAGAAGCGTTTCCCAGTGTGCC). CONCLUSION: Early diagnosis of PJS is important and may be based on a family history with selective features among family members, and the pathological information is the key. The novel mutations also expand the STK11 variant spectrum.

Juvenile polyposis syndrome might be misdiagnosed as familial adenomatous polyposis: a case report and literature review.

BACKGROUND: Juvenile polyposis syndrome (JPS) is a rare disorder characterized by the presence of multiple juvenile polyps in the gastrointestinal tract, and germline mutations in SMAD4 or BMPR1A. Due to its rarity and complex clinical manifestation, misdiagnosis often occurs in clinical practice. CASE PRESENTATION: A 42-year-old man with multiple pedunculated colorectal polyps and concomitant rectal adenocarcinoma was admitted to our hospital. His mother had died of colon cancer. He was diagnosed with familial adenomatous polyposis (FAP) and underwent total proctocolectomy and ileal pouch anal anastomosis. Two polyps were selected for pathological examination. One polyp had cystically dilated glands with slight dysplasia. The other polyp displayed severe dysplasia and was diagnosed as adenoma. Three years later, his 21-year-old son underwent a colonoscopy that revealed more than 50 pedunculated colorectal juvenile polyps. Both patients harbored a germline pathogenic mutation in BMPR1A. Endoscopic resection of all polyps was attempted but failed. Finally, the son received endoscopic resection of polyps in the rectum and sigmoid colon, and laparoscopic subtotal colectomy. Ten polyps were selected for pathological examination. All were revealed to be typical juvenile polyps, with cystically dilated glands filled with mucus. Thus, the diagnosis of JPS was confirmed in the son. A review of the literatures revealed that patients with JPS can sometimes have adenomatous change. Most polyps in patients with JPS are benign hamartomatous polyps with no dysplasia. A review of 767 colorectal JPS polyps demonstrated that 8.5% of the polyps contained mild to moderate dysplasia, and only 0.3% had severe dysplasia or cancer. It is difficult to differentiate juvenile polyps with dysplasia from adenoma, which could explain why juvenile polyps have been reported to have adenomatous changes in patients with JPS. Therefore, patients with JPS, especially those with concomitant dysplasia and adenocarcinoma, might be easily diagnosed as FAP in clinical practice. CONCLUSIONS: Juvenile polyp with dysplasia is often diagnosed as adenoma, which might lead to the misdiagnosis of JPS as FAP. The differential diagnosis of JPS versus FAP, should be based on comprehensive evaluation of clinical presentation, endoscopic appearance and genetic investigations; not on the presence or absence of adenoma.

Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.

STK11 gene analysis reveals a significant number of splice mutations in Chinese PJS patients.

BACKGROUND: The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. AIMS: To test the efficacy of the combination in Chinese patients with PJS. METHODS: PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. RESULTS: We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. CONCLUSION: The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance.

Adenoma miss rate determined by very shortly repeated colonoscopy: Retrospective analysis of data from a single tertiary medical center in China.

Adenoma miss rate (AMR) has been calculated in several tandem colonoscopy studies, but it costs overmuch to carry out a clinical trial.We aimed to put forward AMR by taking advantage of retrospective data, and to judge the comparability between AMRs from prospective and retrospective data.Data of the patients accepting repeated colonoscopies during January to September 2016 was retrospectively collected and analyzed. Information was recorded, including bowel preparation quality of the first colonoscopy, size, location, histology and whether missed within the first colonoscopy of each single adenoma. AMR was compared by different risk factors through χ test and multivariable logistic regression.Around 267 adenomas were detected during 309 pairs of repeated colonoscopies, of which 66 were missed during the first colonoscopies. AMRs of the lesions small in size, nonadvanced in histology, in poor bowel preparation context and located in the proximal colon, were significantly higher than the opposite ones, and old age and male were related to adenoma missing (P < .05). In multivariable logistic regression analysis, adenoma-related factors (diminutive in size, poor bowel preparation and located in ascending colon, transverse colon or sigmoid colon), and patient-related factors (older than 60 years, male and poor bowel preparation) were found to be independently associated with missing adenomas (P < .05).AMR of retrospective data is comparable to that of tandem studies. Several risk factors influence AMR dramatically, which should be paid attention to.

The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.

Close and regular surveillance is key to prevent severe complications for Peutz-Jeghers syndrome patients without gastrointestinal polyps: case report of a novel STK11 mutation (c.471_472delCT) in a Chinese girl.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.

A novel germline mutation (c.A527G) in STK11 gene causes Peutz-Jeghers syndrome in a Chinese girl: A case report.

RATIONALE: Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Detection and miss rates of autofluorescence imaging of adenomatous and polypoid lesions during colonoscopy: a systematic review and meta-analysis.

BACKGROUND AND STUDY AIMS: Autofluorescence imaging (AFI) is an endoscopic imaging technique used to increase the detection of premalignant gastrointestinal lesions, and it has gradually become popular in recent years. This meta-analysis was performed to examine whether AFI provides greater efficacy in the detection of adenomatous and polypoid lesions and can even prevent the failure to detect a single adenoma or polyp. The aim of the study was to systematically review the efficacy of AFI in increasing detection rates and decreasing miss rates. METHODS: Pertinent articles were identified through a search of databases up to December 2013 that included patients who had undergone two same-day colonoscopies (AFI and white light endoscopy [WLE]), followed by polypectomy. Fixed and random effects models were used to detect significant differences between AFI and WLE in regard to adenoma detection rate (ADR), polyp detection rate (PDR), adenoma miss rate (AMR), polyp miss rate (PMR), and procedural time. RESULTS: A total of 1199 patients from six eligible studies met the inclusion criteria. No significant differences were found in ADR (odds ratio [OR] 1.01; 95 % confidence interval [95 %CI] 0.74 - 1.37), PDR (OR 0.86; 95 %CI 0.57 - 1.30), or advanced ADR (OR 1.22; 95 %CI 0.69 - 2.17). The AMR (OR 0.62; 95 %CI 0.44 - 0.86) and PMR (OR 0.64; 95 %CI 0.48 - 0.85) by AFI were significantly lower than those by WLE. The procedural time of AFI was significantly longer than that of WLE (mean 8.00 minutes; 95 %CI 1.59 - 14.41). Subgroup meta-analysis for the other characteristics was not performed because of insufficiency of the primary data. CONCLUSIONS: AFI decreases AMR and PMR significantly compared with WLE but does not improve ADR or PDR. AMR and PMR may be decreased by using AFI in flat and small lesions or when less experienced endoscopists perform the procedure.

[Primary coloduodenal fistula].

Coloduodenal fistula (CDF) is uncommon, and it is often secondary to other colon and duodenal diseases that are benign or malignant. The clinical manifestations of CDF are variable, and upper abdominal pain, feculent vomiting and diarrhea are the common symptoms. Digestive tract contrast radiography and enhanced CT imaging are very helpful for diagnosing CDF, and gastrointestinal endoscopy can give more information about the fistula. Procedure selection should depend on whether the primary disease is malignant and the extent of the lesion. Because the duodenum has complicated anatomic relationship with its adjacent organs including bile duct system and pancreas, procedure for this clinical entity is a challenging task. Decision-making and experienced surgical skills are critical.