RESUMEN
The begomoviruses are the most economically damaging pathogens that pose a serious risk to India's chilli crop and have been associated with the chilli leaf curl disease (ChiLCD). Chilli cultivars infected with begomovirus have suffered significant decreases in biomass output, negatively impacting their economic characteristics. We used the C-mii tool to predict twenty plant miRNA families from SRA chilli transcriptome data (retrieved from the NCBI and GenBank databases). Five target prediction algorithms, i.e., C-mii, miRanda, psRNATarget, RNAhybrid, and RNA22, were applied to identify and evaluate chilli miRNAs (microRNAs) as potential therapeutic targets against ten begomoviruses that cause ChiLCD. In this study, the top five chilli miRNAs which were identified by all five algorithms were thoroughly examined. Moreover, we also noted strong complementarities between these miRNAs and the AC1 (REP), AC2 (TrAP) and betaC1 genes. Three computational approaches (miRanda, RNA22, and psRNATarget) identified the consensus hybridization site for CA-miR838 at locus 2052. The top predicted targets within ORFs were indicated by CA-miR2673 (a and b). Through Circos algorithm, we identified novel targets and create the miRNA-mRNA interaction network using the R program. Furthermore, free energy calculation of the miRNA-target duplex revealed that thermodynamic stability was optimal for miR838 and miR2673 (a and b). To the best of our knowledge, this was the first instance of miRNA being predicted from chilli transcriptome information that had not been reported in miRbase previously. Consequently, the anticipated biological results substantially assist in developing chilli plants resistant to ChiLCD.
RESUMEN
BACKGROUND: Tomato leaf curl New Delhi virus (ToLCNDV) (family Geminiviridae, genus Begomovirus) is a significant threat to cucumber (Cucumis sativus) production in many regions. Previous studies have reported the genetic mapping of loci related to ToLCNDV resistance, but no resistance genes have been identified. RESULTS: We conducted map-based cloning of the ToLCNDV resistance gene in cucumber accession No.44. Agroinfiltration and graft-inoculation analyses confirmed the resistance of No.44 to ToLCNDV isolates from the Mediterranean and Asian countries. Initial mapping involving two rounds of phenotyping with two independent F2 populations generated by crossing the begomovirus-susceptible cultivar SHF and No.44 consistently detected major quantitative trait loci (QTLs) on chromosomes 1 and 2 that confer resistance to ToLCNDV. Fine-mapping of Cy-1, the dominant QTL on chromosome 1, using F3 populations narrowed the candidate region to a 209-kb genomic segment harboring 24 predicted genes. Among these genes, DFDGD-class RNA-dependent RNA polymerase (CsRDR3), an ortholog of Ty-1/Ty-3 of tomato and Pepy-2 of capsicum, was found to be a strong candidate conferring ToLCNDV resistance. The CsRDR3 sequence of No.44 contained multiple amino acid substitutions; the promoter region of CsRDR3 in No.44 had a large deletion; and the CsRDR3 transcript levels were greater in No.44 than in SHF. Virus-induced gene silencing (VIGS) of CsRDR3 using two chromosome segment substitution lines harboring chromosome 1 segments derived from No.44 compromised resistance to ToLCNDV. CONCLUSIONS: Forward and reverse genetic approaches identified CsRDR3, which encodes a DFDGD-class RNA-dependent RNA polymerase, as the gene responsible for ToLCNDV resistance at the major QTL Cy-1 on chromosome 1 in cucumber. Marker-assisted breeding of ToLCNDV resistance in cucumber will be expedited by using No.44 and the DNA markers developed in this study.
Asunto(s)
Begomovirus , Cucumis sativus , Resistencia a la Enfermedad , Enfermedades de las Plantas , Sitios de Carácter Cuantitativo , ARN Polimerasa Dependiente del ARN , Cucumis sativus/genética , Cucumis sativus/virología , Cucumis sativus/enzimología , Begomovirus/fisiología , Enfermedades de las Plantas/virología , Enfermedades de las Plantas/genética , ARN Polimerasa Dependiente del ARN/genética , ARN Polimerasa Dependiente del ARN/metabolismo , Resistencia a la Enfermedad/genética , Mapeo Cromosómico , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Genes de Plantas , Cromosomas de las Plantas/genéticaRESUMEN
Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.
RESUMEN
Begomoviruses, transmitted by the whitefly Bemisia tabaci, pose significant threats to global agriculture due to their severe impact on various crops. Among the satellite molecules associated with begomoviruses, betasatellites play a crucial role in enhancing disease severity and yield losses. The spread and association of these molecules with helper viruses in host plants are thus matters of concern. Here, we focus on the propagation of betasatellites and, more specifically, on their transfer between different helper viruses and hosts through vector transmission. Our results show that the cotton leaf curl Gezira betasatellite (CLCuGeB), initially acquired with its helper virus cotton leaf curl Gezira virus (CLCuGeV) from an okra plant, can be transmitted and assisted by a different helper virus, tomato yellow leaf curl virus (TYLCV), in a different host plant (tomato plant). The new association can be formed whether TYLCV and CLCuGeB encounter each other in a host plant previously infected with TYLCV or in whiteflies having acquired the different components separately. Our findings reveal two pathways by which betasatellites can be transferred between helper viruses and host plants and highlight the ability of betasatellites to spread in begomovirus-infected environments.
Asunto(s)
Begomovirus , ADN Satélite , Virus Helper , Hemípteros , Insectos Vectores , Enfermedades de las Plantas , Animales , Begomovirus/genética , Hemípteros/virología , Insectos Vectores/virología , Virus Helper/genética , Virus Helper/fisiología , Enfermedades de las Plantas/virología , ADN Satélite/genética , Solanum lycopersicum/virología , Abelmoschus/virología , Virus Satélites/genéticaRESUMEN
BACKGROUND: Begomoviruses are major constraint in the production of many crops. Upon infection, begomoviruses may substantially modulate plant biological processes. While how monopartite begomoviruses interact with their plant hosts has been investigated extensively, bipartite begomoviruses-plant interactions are understudied. Moreover, as one of the major groups of hosts, cucurbitaceous plants have been seldom examined in the interaction with begomoviruses. RESULTS: We profiled the zucchini transcriptomic changes induced by a bipartite begomovirus squash leaf curl China virus (SLCCNV). We identified 2275 differentially-expressed genes (DEGs), of which 1310 were upregulated and 965 were downregulated. KEGG enrichment analysis of the DEGs revealed that many pathways related to primary and secondary metabolisms were enriched. qRT-PCR verified the transcriptional changes of twelve selected DEGs induced by SLCCNV infection. Close examination revealed that the expression levels of all the DEGs of the pathway Photosynthesis were downregulated upon SLCCNV infection. Most DEGs in the pathway Plant-pathogen interaction were upregulated, including some positive regulators of plant defenses. Moreover, the majority of DEGs in the MAPK signaling pathway-plant were upregulated. CONCLUSION: Our findings indicates that SLCCNV actively interact with its cucurbitaceous plant host by suppressing the conversion of light energy to chemical energy and inducing immune responses. Our study not only provides new insights into the interactions between begomoviruses and host plants, but also adds to our knowledge on virus-plant interactions in general.
Asunto(s)
Begomovirus , Perfilación de la Expresión Génica , Interacciones Huésped-Patógeno , Enfermedades de las Plantas , Begomovirus/genética , Interacciones Huésped-Patógeno/genética , Enfermedades de las Plantas/virología , Enfermedades de las Plantas/genética , Transcriptoma , Regulación de la Expresión Génica de las Plantas , Cucurbita/virología , Cucurbita/genéticaRESUMEN
Tomato yellow leaf curl virus (TYLCV) is a begomovirus (genus Begomovirus, family Geminiviridae) transmitted persistently by the whitefly Bemisia tabaci. It causes tomato yellow leaf curl disease (TYLCD), resulting in significant yield losses worldwide. TYLCD is controlled mainly by using F1 hybrid tomato cultivars harboring the TYLCV resistance gene Ty-1. However, infected Ty-1-bearing tomato plants accumulate viral DNA, which may eventually lead to the emergence of a resistance-breaking TYLCV variant. Recently, a B. tabaci-resistant tomato line derived from the introgression of type IV leaf glandular trichomes and acylsucrose secretion from wild tomato (Solanum pimpinellifolium) was shown to effectively control the spread of TYLCV. In this study, we combined B. tabaci resistance and Ty-1-based TYLCV resistance to increase the robustness and durability of the TYLCD resistance mediated by Ty-1 in tomato plants. Specifically, we characterized and used a Group 2-like isolate of the Israel strain of TYLCV (TYLCV-IL-G2) that contributes to TYLCD epidemics in southeastern Spain. A comparison with isolates of the previously identified TYLCV variant revealed TYLCV-IL-G2 has a similar host range, but it induces a slightly more severe TYLCD in Ty-1-bearing tomato plants. Moreover, we demonstrated that acylsucrose-producing B. tabaci-resistant tomato plants can limit the spread of TYLCV-IL-G2 better than a near-isogenic line lacking type IV trichomes and unable to secrete acylsucrose. Pyramiding Ty-1-based TYLCV resistance and B. tabaci resistance provided by type IV glandular trichomes helped to decrease the effects of TYLCV on Ty-1-bearing tomato plants as well as the likelihood of TYLCV evolution in infected plants.
RESUMEN
Chili pepper cultivation in the Indian subcontinent is severely affected by viral diseases, prompting the need for environmentally friendly disease control methods. To achieve this, it is essential to understand the molecular mechanisms of viral resistance in chili pepper. The NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) genes are known to provide broad-spectrum resistance to various phytopathogens by activating systemic acquired resistance (SAR). An in-depth understanding of NPR1 gene expression during begomovirus infection and its correlation with different biochemical and physiological parameters is crucial for enhancing resistance against begomoviruses in chili pepper. Nevertheless, limited information on chili CaNPR genes and their role in biotic stress constrains their potential in breeding for biotic stress resistance. By employing bioinformatics for genome mining, we identify 5 CaNPR genes in chili. The promoter regions of 1,500 bp of CaNPR genes contained cis-elements associated with biotic stress responses, signifying their involvement in biotic stress responses. Furthermore, these gene promoters harbored components linked to light, development, and hormone responsiveness, suggesting their roles in plant hormone responses and development. MicroRNAs played a vital role in regulating these five CaNPR genes, highlighting their significance in the regulation of chili genes. Inoculation with the begomovirus "cotton leaf curl Khokhran virus (CLCuKV)" had a detrimental effect on chili plant growth, resulting in stunted development, fibrous roots, and evident virus symptoms. The qRT-PCR analysis of two local chili varieties inoculated with CLCuKV, one resistant (V1) and the other susceptible (V2) to begomoviruses, indicated that CaNPR1 likely provides extended resistance and plays a role in chili plant defense mechanisms, while the remaining genes are activated during the early stages of infection. These findings shed light on the function of chili's CaNPR in biotic stress responses and identify potential genes for biotic stress-resistant breeding. However, further research, including gene cloning and functional analysis, is needed to confirm the role of these genes in various physiological and biological processes. This in-silico analysis enhances our genome-wide understanding of how chili CaNPR genes respond during begomovirus infection.
RESUMEN
The traditional understanding of begomovirus transmission exclusively through the whitefly Bemisia tabaci (Gennadius) has shifted with findings of seed transmission in some begomoviruses over the last decade. We investigated the seed transmissibility of cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus that has recently emerged as a severe constraint for yellow squash (Cucurbita pepo L.) production in the southeastern United States. We found high concentration of CuLCrV in male and female flower tissues of infected squash, including pollen and ovules. The virus infiltrated the fruit tissues including the endocarp and funiculus, which are anatomically positioned adjacent to the seeds. In seeds, CuLCrV was detected in the endosperm and embryo where there are no vascular connections, in addition to the seed coat. The virus was detected in the radicle, plumule, cotyledonary leaves, and true leaves of seedlings grown from seeds collected from infected fruits. In the grow-out test conducted, CuLCrV infections ranged from 17-56% of the progeny plants. To ensure that partial viral genome fragments were not being mistaken for replicative forms of the virus, we performed RCA ̶ PCR and amplified complete DNA-A and DNA-B of CuLCrV from seed tissues, seedlings, progeny plants of CuLCrV infected squash. Near complete DNA-A and DNA-B sequences of CuLCrV were recovered from a progeny plant, further validating our findings. Our results demonstrate that CuLCrV can translocate from vegetative to reproductive tissues of yellow squash, persist within the seeds, and subsequently induce infection in progeny plants, confirming its capacity for seed transmission.
RESUMEN
The present study reports the complete genome of a novel monopartite begomovirus, named tentatively as "Citharexylum leaf curl virus" (CitLCuV), associated with leaf curl disease of Citharexylum spinosum in India. CitLCuV genome (2767 nucleotide) contained the typical genome organization of Old World begomoviruses and shared the maximum nucleotide sequence identity of 89.7% with a papaya leaf crumple virus (PaLCrV) isolate. In addition, two small non-canonical open reading frames (C5 and C6) were determined in the complementary strand of CitLCuV genome. Phylogenetic analysis revealed the relatedness of CitLCuV to PaLCrV and rose leaf curl virus. Recombination analysis detected a possible recombination event in CitLCuV genome. Based on begomovirus species demarcation criteria, CitLCuV can be regarded as a novel begomoviral species.
Asunto(s)
Begomovirus , Genoma Viral , Filogenia , Enfermedades de las Plantas , Begomovirus/genética , Begomovirus/aislamiento & purificación , Begomovirus/clasificación , Enfermedades de las Plantas/virología , Genoma Viral/genética , India , Sistemas de Lectura Abierta , ADN Viral/genética , Hojas de la Planta/virología , Análisis de Secuencia de ADNRESUMEN
Cotton, a key source of income for Pakistan, has suffered significantly by cotton leaf curl disease (CLCuD) since 1990. This disease is caused by a complex of phylogenetically-related begomovirus (genus Begomovirus, family Geminiviridae) species and a specific betasatellite (genus Betasatellite, family Tolecusatellitidae), cotton leaf curl Multan betasatellite. Additionally, another DNA satellite called alphasatellite (family Alphasatellitidae), is also frequently associated. All these virus components are vectored by a single species of whitefly (Bemisia tabaci). While many factors affect cotton productivity, including cotton variety, sowing time, and environmental cues such as temperature, humidity, and rainfall, CLCuD is a major biotic constraint. Although the understanding of begomoviruses transmission by whiteflies has advanced significantly over the past three decades, however, the in-field seasonal dynamics of the viruses in the insect vector remained an enigma. This study aimed to assess the levels of virus and betasatellite in whiteflies collected from cotton plants throughout the cotton growing season from 2014 to 2016. Notably, begomovirus levels showed no consistent pattern, with minimal variations, ranging from 0.0017 to 0.0074 ng.µg-1 of the genomic DNA in 2014, 0.0356 to 0.113 ng.µg-1 of the genomic DNA in 2015, and 0.0517 to 0.0791 ng.µg-1 of the genomic DNA in 2016. However, betasatellite levels exhibited a distinct pattern. During 2014 and 2015, it steadily increased throughout the sampling period (May to September). While 2016 showed a similar trend from the start of sampling (July) to September but a decline in October (end of sampling). Such a study has not been conducted previously, and could potentially provide valuable insights about the epidemiology of the virus complex causing CLCuD and possible means of controlling losses due to it.
RESUMEN
Tomato interveinal chlorosis virus (ToICV; Begomovirus solanumintervenae, genus Begomovirus, family Geminiviridae) has been described infecting tomato (Solanum lycopersicum) and Macroptilium lathyroides in Northeastern (NE) Brazil for more than a decade (Albuquerque et al., 2012; Silva et al., 2012). During a survey in 2020, plants of the leguminous weed Rhynchosia minima exhibiting virus-like symptoms such as mosaic and interveinal chlorosis were observed in the state of Alagoas, NE Brazil. Symptomatic leaf samples of R. minima were randomly collected (n=15; supplementary figure 1). Total DNA from each sample was used as a template for PCR amplification of partial begomoviral DNA-A sequences using the degenerate primer pair PAL1v1978 and PAR1c496, universal for geminiviruses (Rojas et al., 1993). Amplicons of ~1.2 kbp were observed from 12 samples, although this should not be considered as incidence since only symptomatic plants were collected. To identify the begomovirus associated with R. minima, viral genomes were amplified from PCR-positive samples using rolling circle amplification (RCA) (Inoue-Nagata et al., 2004). The RCA products were digested with HindIII, cloned into the pBluescript II KS+ plasmid vector and bidirectionally Sanger-sequenced (Macrogen Inc., Seoul). BLASTn searches indicated that the clones (n=4) reported here corresponded to a begomovirus DNA-A component, and pairwise comparisons showed that they shared the highest identity with ToICV, at 92.4-94.7% nucleotide sequence identity. Based on the species demarcation criteria of ≥91% nucleotide identity for the genus Begomovirus (Brown et al., 2015), the begomoviruses obtained from R. minima are new isolates of ToICV. The new DNA-A sequences of 2,619-2,623 nt in length were deposited in GenBank under accession numbers PP639092 to PP639095. Multiple nucleotide sequence alignments were prepared using the MUSCLE algorithm implemented in MEGA v.11 (Kumar et al., 2018), and a maximum likelihood (ML) tree was reconstructed in RaxML-NG (Kozlov et al., 2019), assuming a general time reversible (GTR) nucleotide substitution model with a gamma (G) model of rate heterogeneity and 1,000 bootstrap replicates. The DNA-A-based tree showed that the ToICV sequences clustered into a monophyletic group, additionally supporting these isolates as members of the species Begomovirus solanumintervenae. At least two independent interspecies recombination events were predicted among the ToICV isolates, with breakpoints located in the Rep-encoding region and ToICV (GenBank Accession JF803253), tomato mottle leaf curl virus (JF803248) and soybean blistering mosaic virus (MN486865) detected as putative parents. To the best of our knowledge, this is the first report of ToICV infecting R. minima worldwide, expanding the host range of this begomovirus. Non-cultivated plants such as R. minima play a crucial role as reservoirs and sources of inoculum for begomoviruses (Paz-Carrasco et al., 2014), reinforcing their relevance to socioeconomically important crops.
RESUMEN
In tropical countries, combating leaf curl disease in hot peppers has become important in improvement programs. Leaf curl disease is caused by whitefly (Bemisia tabaci) transmitted begomoviruses, which mainly include chilli leaf curl virus (ChiLCV). However, multiple begomoviruses have also been found to be associated with this disease. The Capsicum annuum line, DLS-Sel-10, was found to be a tolerant source against this disease during field screening. In this study, we characterized the resistance of DLS-sel-10 against chilli leaf curl virus (ChiLCV) in comparison to the susceptible cultivar Phule Mukta (PM), focusing on the level, stage, and nature of resistance. Comprehensive investigations involved screening of DLS-Sel-10 against the whitefly vector ChiLCV. The putative tolerant line displayed reduced virus infection at the seedling stage, with increasing resistance during vegetative, flowering, and fruiting stages. Both DLS-Sel-10 and PM could be infected with ChiLCV, although DLS-Sel-10 remained symptomless. Insect feeding assays revealed DLS-Sel-10 as a less preferred host for whiteflies compared to PM. In conclusion, DLS-Sel-10 demonstrated tolerance not only to ChiLCV but also served as an unfavorable host for the whitefly vector. The study highlighted an age-dependent increase in tolerance within DLS-Sel-10, showcasing its potential for effective leaf curl disease management in chilli.
RESUMEN
Deployment of different natural disease resistance alleles is the most sustainable and eco-friendly way for multiple disease management in tomato. Diagnostic molecular markers are indispensible in this effort as they offer early generation identification of resistance alleles in an environment-independent manner. Moreover, optimized multiplex polymerase chain reaction (PCR) for detecting different disease resistance alleles in a single reaction can speed-up the selection process with cost and labour-effectiveness. Here we report the optimized multiplex detection and stacking of leaf curl disease resistance alleles Ty-2 and Ty-3 along with late blight disease resistance allele Ph-3 in tomato genotypes and F2 segregants. The triplex assay could be replaced by a duplex assay (for Ty-2 and Ty-3 resistance alleles) followed by analysis at Ph-3 locus to achieve further cost-effectiveness. We identified two plants in F2 populations derived from the Arka Samrat (F1) x Kashi Chayan combination to carry the Ty-2, Ty-3 and Ph-3 resistance alleles in homozygous condition. Early generation genotyping also allowed us to identify a few morphologically better segregants, where further marker assisted selection (MAS) should identify superior multiple disease resistant lines. Thus we advocate the utility of multiplex PCR in MAS to address multiple disease resistance breeding in tomato.
RESUMEN
Tomato yellow leaf curl virus (TYLCV) and tomato spotted wilt virus (TSWV) are well-known examples of the begomovirus and orthotospovirus genera, respectively. These viruses cause significant economic damage to tomato crops worldwide. Weeds play an important role in the ongoing presence and spread of several plant viruses, such as TYLCV and TSWV, and are recognized as reservoirs for these infections. This work applies a comprehensive approach, encompassing field surveys and molecular techniques, to acquire an in-depth understanding of the interactions between viruses and their weed hosts. A total of 60 tomato samples exhibiting typical symptoms of TYLCV and TSWV were collected from a tomato greenhouse farm in Nonsan, South Korea. In addition, 130 samples of 16 different weed species in the immediate surroundings of the greenhouse were collected for viral detection. PCR and reverse transcription-PCR methodologies and specific primers for TYLCV and TSWV were used, which showed that 15 tomato samples were coinfected by both viruses. Interestingly, both viruses were also detected in perennial weeds, such as Rumex crispus, which highlights their function as viral reservoirs. Our study provides significant insights into the co-occurrence of TYLCV and TSWV in weed reservoirs, and their subsequent transmission under tomato greenhouse conditions. This project builds long-term strategies for integrated pest management to prevent and manage simultaneous virus outbreaks, known as twindemics, in agricultural systems.
RESUMEN
Sweet potato leaf curl virus (SPLCV) is a whitefly-transmitted begomovirus infecting sweetpotato and other morning glory (Convolvulaceae) species worldwide. The virus is widespread at the USDA, ARS, U.S. Vegetable Laboratory (USVL), and testing of germplasm maintained in the breeding program indicates nearly 100% infection in storage roots of materials propagated for at least four years. Prior to the public release of new germplasm, viruses must be eliminated via laborious and time-consuming meristem-tip culture. The identification of virus-free seedlings early in the selection process can offer an alternative to meristem-tip culture. In this study, we investigated the transmission of SPLCV over two years of consecutive field plantings (early and late) of sweetpotato. While SPLCV is endemic at the USVL, virus transmission pressure over the typical cultivation season is unknown, and avoidance of virus transmission paired with the selection and maintenance of clean material may be a viable alternative to virus elimination. In 2022, the storage roots of 39 first-year seedling (FYS) selections were tested for SPLCV after early-season cultivation, revealing a single selection (2.6%) with a positive test. Similar testing was conducted in 2023 with no SPLCV-positive FYS selections detected. To further assess SPLCV acquisition in the field, replicated late-season plantings of each selected FYS (n = 37) were monitored from planting to harvest. Testing was conducted at 60 and 120 days after planting (DAP). Approximately 35% of the bulk samples were infected at 60 DAP, and infection increased to 52.3% by 120 DAP. Testing of individuals within selected positive bulked samples did not support 100% infection at harvest. Altogether, these results demonstrate that SPLCV transmission during early planting is sufficiently low to facilitate the maintenance of virus-free selections, offering an alternative to virus cleaning and a cultivation strategy that may be leveraged for production.
RESUMEN
Begomoviruses (family Geminiviridae) are known for causing devastating diseases in fruit, fibre, pulse, and vegetable crops throughout the world. Begomoviruses are transmitted in the field exclusively through insect vector whitefly (Bemisia tabaci), and the frequent outbreaks of begomoviruses are attributed largely due to the abundance of whitefly in the agri-ecosystem. Begomoviruses being phloem-borne were known not be transmitted through seeds of the infected plants. The recent findings of seed transmission of begomoviruses brought out a new dimension of begomovirus perpetuation and dissemination. The first convincing evidence of seed transmission of begomoviruses was known in 2015 for sweet potato leaf curl virus followed by several begomoviruses, like bhendi yellow vein mosaic virus, bitter gourd yellow mosaic virus, dolichos yellow mosaic virus, mungbean yellow mosaic virus, mungbean yellow mosaic India virus, pepper yellow leaf curl Indonesia virus, tomato leaf curl New Delhi virus, tomato yellow leaf curl virus, tomato yellow leaf curl Sardinia virus, and okra yellow mosaic Mexico virus. These studies brought out two perspectives of seed-borne nature of begomoviruses: (i) the presence of begomovirus in the seed tissues derived from the infected plants but no expression of disease symptoms in the progeny seedlings and (ii) the seed infection successfully transmitted the virus to cause disease to the progeny seedlings. It seems that the seed transmission of begomovirus is a feature of a specific combination of host-genotype and virus strain, rather than a universal phenomenon. This review comprehensively describes the seed transmitted begomoviruses reported in the last 9 years and the possible mechanism of seed transmission. An emphasis is placed on the experimental results that proved the seed transmission of various begomoviruses, factors affecting seed transmission and impact of begomovirus seed transmission on virus circulation, outbreak of the disease, and management strategies.
RESUMEN
The tomato yellow leaf curl disease (TYLCD) caused by whitefly (Bemisia tabaci)-transmitted begomoviruses (Geminiviridae) has constrained tomato production in Taiwan since 1981. Lisianthus enation leaf curl virus (LELCV), tomato leaf curl Taiwan virus (ToLCTV), and tomato yellow leaf curl Thailand virus (TYLCTHV) were the major viruses associated with TYLCD. In 2019 to 2020, we investigated TYLCD throughout Taiwan, with a 10 to 100% incidence on tomato fields. Begomovirus sequences were detected in 321 out of 506 collected samples by PCR with primers PAL1v1978B and PAR1c715H. In 2015 to 2016, 59 out of 99 samples collected in Hualien-Taitung areas were also found to have begomovirus sequences. Based on the analysis of 68 viral genomic sequences, six begomoviruses were identified, including LELCV, ToLCTV, TYLCTHV, tomato leaf curl Hsinchu virus, and two new begomoviruses, tentatively named tomato leaf curl Chiayi virus (ToLCCYV) and tomato leaf curl Nantou virus (ToLCNTV). Various isolates of LELCV and TYLCTHV were grouped into four and two strains, respectively. Recombinants were detected in LELCV-A, -C, and -D, ToLCCYV, ToLCNTV, and TYLCTHV-F. Based on virus-specific detection, the majority of TYLCD-associated viruses were mixed-infected by TYLCTHV-B with TYLCTHV-F, LELCV-A, -B, or -D, and/or ToLCTV. Meanwhile, viral DNA-B was mostly associated with TYLCTHV, and all identified DNA-Bs were highly homologous with previous TYLCTHV DNA-B. The pathogenicity of selected begomoviruses was confirmed through agroinfection and whitefly transmission. All tomato plants carrying Ty-1/3 and Ty-2 resistant genes were infected by all LELCV strains and ToLCCYV, although they appeared symptomless, suggesting these viruses could be managed through the use of the resistance pyramid.
Asunto(s)
Begomovirus , Variación Genética , Filogenia , Enfermedades de las Plantas , Solanum lycopersicum , Begomovirus/genética , Begomovirus/patogenicidad , Begomovirus/aislamiento & purificación , Begomovirus/clasificación , Solanum lycopersicum/virología , Enfermedades de las Plantas/virología , Taiwán , Hemípteros/virología , Genoma Viral/genética , Virulencia/genética , ADN Viral/genética , AnimalesRESUMEN
Plants can respond to insect infestation and virus infection by inducing plant defenses, generally mediated by phytohormones. Moreover, plant defenses alter host quality for insect vectors with consequences for the spread of viruses. In agricultural settings, other organisms commonly interact with plants, thereby inducing plant defenses that could affect plant-virus-vector interactions. For example, plant defenses induced by omnivorous insects can modulate insect behavior. This study focused on tomato yellow leaf curl virus (TYLCV), a plant virus of the family Geminiviridae and genus Begomovirus. It is transmitted in a persistent circulative manner by the whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae), posing a global threat to tomato production. Mirids (Hemiptera: Miridae) are effective biological control agents of B. tabaci, but there is a possibility that their omnivorous nature could also interfere with the process of virus transmission. To test this hypothesis, this study first addressed to what extent the mirid bug Dicyphus hesperus Knight induces plant defenses in tomato. Subsequently, the impact of this plant-omnivore interaction on the transmission of TYLCV was evaluated. Controlled cage experiments were performed in a greenhouse setting to evaluate the impact of mirids on virus transmission and vector acquisition by B. tabaci. While we observed a reduced number of whiteflies settling on plants exposed to D. hesperus, the plant defenses induced by the mirid bug did not affect TYLCV transmission and accumulation. Additionally, whiteflies were able to acquire comparable amounts of TYLCV on mirid-exposed plants and control plants. Overall, the induction of plant defenses by D. hesperus did not influence TYLCV transmission by whiteflies on tomato.
Asunto(s)
Begomovirus , Hemípteros , Insectos Vectores , Enfermedades de las Plantas , Solanum lycopersicum , Begomovirus/fisiología , Solanum lycopersicum/virología , Animales , Enfermedades de las Plantas/virología , Hemípteros/virología , Hemípteros/fisiología , Insectos Vectores/virología , Heterópteros/virología , Heterópteros/fisiología , Defensa de la Planta contra la HerbivoriaRESUMEN
Papaya leaf curl disease (PaLCuD) is widespread and classified in the genus begomovirus (Geminiviridae), disseminated by the vector whitefly Bemisia tabaci. RNA interference (RNAi)-based antiviral innate immunity stands as a pivotal defense mechanism and biological process in limiting viral genomes to manage plant diseases. The current study aims to identify and analyze Carica Papaya locus-derived capa-microRNAs with predicted potential for targeting divergent begomovirus species-encoded mRNAs using a 'four integrative in silico algorithms' approach. This research aims to experimentally activate the RNAi catalytic pathway using in silico-predicted endogenous capa-miRNAs and create papaya varieties capable of assessing potential resistance against begomovirus species and monitoring antiviral capabilities. This study identified 48 predicted papaya locus-derived candidates from 23 miRNA families, which were further investigated for targeting begomovirus genes. Premised all the four algorithms combined, capa-miR5021 was the most anticipated miRNA followed by capa-miR482, capa-miR5658, capa-miR530b, capa-miR3441.2, and capa-miR414 'effective' papaya locus-derived candidate capa-miRNA and respected putative binding sites for targets at the consensus nucleotide position. It was predicted to bind and target mostly to AC1 gene of the complementary strand and the AV1 gene of the virion strand of different begomovirus isolates, which were associated with replication-associated protein and encapsidation, respectively, during PaLCuD. These miRNAs were also found targeting betaC1 gene of betasatellite which were associated with retardation in leaf growth and developmental abnormalities with severe symptoms during begomovirus infection. To validate target prediction accuracy, we created an integrated Circos plot for comprehensive visualization of host-virus interaction. In silico-predicted papaya genome-wide miRNA-mediated begomovirus target gene regulatory network corroborated interactions that permit in vivo analysis, which could provide biological material and valuable evidence, leading to the development of begomovirus-resistant papaya plants. The integrative nature of our research positions it at the forefront of efforts to ensure the sustainable cultivation of papaya, particularly in the face of evolving pathogenic threats. As we move forward, the knowledge gained from this study provides a solid foundation for continued exploration and innovation in the field of papaya virology, and to the best of our knowledge, this study represents a groundbreaking endeavor, undertaken for the first time in the context of PaLCuD research.
RESUMEN
A begomovirus isolated from whiteflies (Bemisia tabaci) and tomato, sweet potato in China was found to be representative of a distinct begomovirus species, for which the name tomato yellow leaf curl Chuxiong virus (TYLCCxV) is proposed. The results of genomic identification and sequence comparison showed that TYLCCxV shares the highest complete nucleotide sequence identity (88.3%) with croton yellow vein mosaic virus (CroYVMV), and may have originated from the recombination between synedrella leaf curl virus (SyLCV) and squash leaf curl Yunnan virus (SLCuYV). Agrobacterium-mediated inoculation showed that TYLCCxV is highly infectious for a range of plant species, producing upward leaf curling, leaf crumpling, chlorosis, distortion, and stunt symptoms in Solanum lycopersicum plants. The results of Southern blot indicated that TYLCCxV is capable of efficiently replicating two heterologous betasatellites. The inoculation of PVX::C4 on Nicotiana benthamiana induced upward leaf curling and stem elongation symptoms, suggesting that TYLCCxV C4 functions as a symptom determinant. TYLCCxV V2 is an important virulence factor that induces downward leaf curling symptoms, elicits systemic necrosis, and suppresses local and systemic GFP silencing in co-agroinfiltrated N. benthamiana and transgenic 16c plants. Considering the multifunctional virulence proteins V2 and C4, the possibility of TYLCCxV causing devastating epidemics on tomato in China is discussed.