Alternative TSS use is widespread in Cryptococcus fungi in response to environmental cues and regulated genome-wide by the transcription factor Tur1.

Alternative transcription start site (TSS) usage regulation has been identified as a major means of gene expression regulation in metazoans. However, in fungi, its impact remains elusive as its study has thus far been restricted to model yeasts. Here, we first re-analyzed TSS-seq data to define genuine TSS clusters in 2 species of pathogenic Cryptococcus. We identified 2 types of TSS clusters associated with specific DNA sequence motifs. Our analysis also revealed that alternative TSS usage regulation in response to environmental cues is widespread in Cryptococcus, altering gene expression and protein targeting. Importantly, we performed a forward genetic screen to identify a unique transcription factor (TF) named Tur1, which regulates alternative TSS (altTSS) usage genome-wide when cells switch from exponential phase to stationary phase. ChiP-Seq and DamID-Seq analyses suggest that at some loci, the role of Tur1 might be direct. Tur1 has been previously shown to be essential for virulence in C. neoformans. We demonstrated here that a tur1Δ mutant strain is more sensitive to superoxide stress and phagocytosed more efficiently by macrophages than the wild-type (WT) strain.

A deep cut into early cryptococcal pathogenesis.

Dissemination from one organ system to another is common to many pathogens and often the key process separating simple illness from fatal infection. The pathogenic Cryptococcus species offer a prime example. Cryptococcal infection is thought to begin in the lungs, as a mild or asymptomatic pneumonia. However, bloodborne dissemination from the lungs to the brain is responsible for the most devastating forms of infection. As with other disseminating infections, the transition likely depends on rare but crucial events, such as the crossing of a tissue barrier. By their nature, these events are difficult to study. Francis et al. (mBio 15:e03078-23, 2024, https://doi.org/10.1128/mbio.03078-23) have addressed this difficulty by developing a powerful imaging pipeline to scan through unprecedented volumes of tissue from mice infected with Cryptococcus at multiple stages of infection. Their observations challenge some of our basic assumptions about cryptococcal pathogenesis, including when and how the organism reaches the bloodstream and the central nervous system.

Comparative genomics of the closely related fungal genera Cryptococcus and Kwoniella reveals karyotype dynamics and suggests evolutionary mechanisms of pathogenesis.

In exploring the evolutionary trajectories of both pathogenesis and karyotype dynamics in fungi, we conducted a large-scale comparative genomic analysis spanning the Cryptococcus genus, encompassing both global human fungal pathogens and nonpathogenic species, and related species from the sister genus Kwoniella. Chromosome-level genome assemblies were generated for multiple species, covering virtually all known diversity within these genera. Although Cryptococcus and Kwoniella have comparable genome sizes (about 19.2 and 22.9 Mb) and similar gene content, hinting at preadaptive pathogenic potential, our analysis found evidence of gene gain (via horizontal gene transfer) and gene loss in pathogenic Cryptococcus species, which might represent evolutionary signatures of pathogenic development. Genome analysis also revealed a significant variation in chromosome number and structure between the 2 genera. By combining synteny analysis and experimental centromere validation, we found that most Cryptococcus species have 14 chromosomes, whereas most Kwoniella species have fewer (11, 8, 5, or even as few as 3). Reduced chromosome number in Kwoniella is associated with formation of giant chromosomes (up to 18 Mb) through repeated chromosome fusion events, each marked by a pericentric inversion and centromere loss. While similar chromosome inversion-fusion patterns were observed in all Kwoniella species with fewer than 14 chromosomes, no such pattern was detected in Cryptococcus. Instead, Cryptococcus species with less than 14 chromosomes showed reductions primarily through rearrangements associated with the loss of repeat-rich centromeres. Additionally, Cryptococcus genomes exhibited frequent interchromosomal translocations, including intercentromeric recombination facilitated by transposons shared between centromeres. Overall, our findings advance our understanding of genetic changes possibly associated with pathogenicity in Cryptococcus and provide a foundation to elucidate mechanisms of centromere loss and chromosome fusion driving distinct karyotypes in closely related fungal species, including prominent global human pathogens.

Recomendaciones para el diagnóstico y tratamiento de la infección por Cryptococcus spp / Recommendations for the diagnosis and treatment of infection by Cryptococcus spp

Las infecciones por levaduras del género Cryptococcus pueden causar un abanico amplio de manifestaciones clínicas, dependiendo de si se trata de una infección invasora o no. Los pacientes susceptibles, especialmente de las formas invasoras, comparten el compromiso de la inmunidad celular, ya sea por afecciones primarias o secundarias. El grupo más estudiado es el de personas que viven con VIH. La mortalidad es alta, especialmente en entornos de recursos reducidos. El esquema de tratamiento es en fases, inicialmente combinado, para luego continuar con monoterapia por un periodo prolongado, dependiendo de la duración del factor de riesgo subyacente. Hacemos una revisión de la evidencia y recomendaciones actualizadas.

Infection by yeast of the Cryptococcus genus can cause a wide range of clinical manifestations, depending on whether it is an invasive infection or not. Susceptible patients, especially those with invasive forms, share the compromise of cellular immunity, either due to primary or secondary conditions. The most studied group is that of people living with HIV. Mortality is high, especially in resource-poor settings. The treatment scheme is in phases, initially combined, to then continue with monotherapy for a prolonged period, depending on the duration of the underlying risk factor. We review the evidence and update recommendations.

Epistatic genetic interactions govern morphogenesis during sexual reproduction and infection in a global human fungal pathogen.

Cellular development is orchestrated by evolutionarily conserved signaling pathways, which are often pleiotropic and involve intra- and interpathway epistatic interactions that form intricate, complex regulatory networks. Cryptococcus species are a group of closely related human fungal pathogens that grow as yeasts yet transition to hyphae during sexual reproduction. Additionally, during infection they can form large, polyploid titan cells that evade immunity and develop drug resistance. Multiple known signaling pathways regulate cellular development, yet how these are coordinated and interact with genetic variation is less well understood. Here, we conducted quantitative trait locus (QTL) analyses of a mapping population generated by sexual reproduction of two parents, only one of which is unisexually fertile. We observed transgressive segregation of the unisexual phenotype among progeny, as well as a large-cell phenotype under mating-inducing conditions. These large-cell progeny were found to produce titan cells both in vitro and in infected animals. Two major QTLs and corresponding quantitative trait genes (QTGs) were identified: RIC8 (encoding a guanine-exchange factor) and CNC06490 (encoding a putative Rho-GTPase activator), both involved in G protein signaling. The two QTGs interact epistatically with each other and with the mating-type locus in phenotypic determination. These findings provide insights into the complex genetics of morphogenesis during unisexual reproduction and pathogenic titan cell formation and illustrate how QTL analysis can be applied to identify epistasis between genes. This study shows that phenotypic outcomes are influenced by the genetic background upon which mutations arise, implicating dynamic, complex genotype-to-phenotype landscapes in fungal pathogens and beyond.

CCR2 Signaling Promotes Brain Infiltration of Inflammatory Monocytes and Contributes to Neuropathology during Cryptococcal Meningoencephalitis.

Cryptococcal meningoencephalitis (CM) is a leading cause of central nervous system (CNS) infection-related mortality worldwide, with surviving patients often developing neurological deficiencies. While CNS inflammation has been implicated in the pathogenesis of CM, little is known about the relative contribution of the specific inflammatory/immune pathways to CNS pathology versus fungal clearance. Increased cerebrospinal fluid level of C-C chemokine receptor 2 (CCR2) ligand CCL2 is associated with disease deterioration in patients with CM. Using a murine model, we investigated the role of the CCR2 pathway in the development of CNS inflammation and pathology during CM. We found that CCR2-deficient mice exhibited improved 28-day survival and alleviated neurological disease scores despite a brain fungal burden higher than that of the WT mice. Reduced CM pathology in CCR2-deficient mice was accompanied by markedly decreased neuronal cell death around cryptococcal microcysts and restored expression of genes involved in neurotransmission, connectivity, and neuronal cell structure in the brains. Results show that CCR2 axis is the major pathway recruiting CD45hiCD11b+Ly6C+ inflammatory monocyte to the brain and indirectly modulates the accumulation of CD4+ T cells and CD8+ T cells. In particular, CCR2 axis promotes recruitment of interferon gamma (IFN-γ)-producing CD4+ T cells and classical activation of myeloid cells. In this context, CCR2 deletion limits the immune network dysregulation we see in CM and attenuates neuropathology. Thus, the CCR2 axis is a potential target for interventions aimed to limit inflammatory CNS pathology in CM patients. IMPORTANCE Cryptococcal meningoencephalitis (CM) causes nearly 200,000 deaths worldwide each year, and survivors frequently develop long-lasting neurological sequelae. The high rate of mortality and neurologic sequelae in CM patients indicate that antifungal therapies alone are often insufficient to control disease progression. Here, we reveal that CM disease progression in mice is accompanied by inflammatory monocytes infiltration at the periphery of the infected foci that overlap locally perturbed neuronal function and death. Importantly, we identified that CCR2 signaling is a critical pathway driving neuroinflammation, especially inflammatory monocyte recruitment, as well as CNS pathology and mortality in CM mice. Our results imply that targeting the CCR2 pathway may be beneficial as a therapy complementary to antifungal drug treatment, helping to reduce CNS damage and mortality in CM patients.

Fungal pneumonia in kidney transplant recipients.

Fungal pneumonia is a dreaded complication encountered after kidney transplantation, complicated by increased mortality and often associated with graft failure. Diagnosis can be challenging because the clinical presentation is non-specific and diagnostic tools have limited sensitivity and specificity in kidney transplant recipients and must be interpreted in the context of the clinical setting. Management is difficult due to the increased risk of dissemination and severity, multiple comorbidities, drug interactions and reduced immunosuppression which should be applied as an important adjunct to therapy. This review will focus on the main causes of fungal pneumonia in kidney transplant recipients including Pneumocystis, Aspergillus, Cryptococcus, mucormycetes and Histoplasma. Epidemiology, clinical presentation, laboratory and radiographic features, specific characteristics will be discussed with an update on diagnostic procedures and treatment.

High burden of cryptococcal antigenemia and meningitis among patients presenting at an emergency department in Maputo, Mozambique.

BACKGROUND: Cryptococcal meningitis is a leading cause of HIV-related mortality in sub-Saharan Africa, however, screening for cryptococcal antigenemia has not been universally implemented. As a result, data concerning cryptococcal meningitis and antigenemia are sparse, and in Mozambique, the prevalence of both are unknown. METHODS: We performed a retrospective analysis of routinely collected data from a point-of-care cryptococcal antigen screening program at a public hospital in Maputo, Mozambique. HIV-positive patients admitted to the emergency department underwent CD4 count testing; those with pre-defined abnormal vital signs or CD4 count ≤ 200 cells/µL received cryptococcal antigen testing and lumbar punctures if indicated. Patients with CM were admitted to the hospital and treated with liposomal amphotericin B and flucytosine; their 12-week outcomes were ascertained through review of medical records or telephone contact by program staff made in the routine course of service delivery. RESULTS: Among 1,795 patients screened for cryptococcal antigenemia between March 2018-March 2019, 134 (7.5%) were positive. Of patients with cryptococcal antigenemia, 96 (71.6%) were diagnosed with CM, representing 5.4% of all screened patients. Treatment outcomes were available for 87 CM patients: 24 patients (27.6%) died during induction treatment and 63 (72.4%) survived until discharge; of these, 38 (60.3%) remained in care, 9 (14.3%) died, and 16 (25.3%) were lost-to follow-up at 12 weeks. CONCLUSIONS: We found a high prevalence of cryptococcal antigenemia and meningitis among patients screened at an emergency department in Maputo, Mozambique. High mortality during and after induction therapy demonstrate missed opportunities for earlier detection of cryptococcal antigenemia, even as point-of-care screening and rapid assessment in an emergency room offer potential to improve outcomes.

Clinical features and Outcomes of Cryptococcemia patients with and without HIV infection.

BACKGROUND: The effects of cryptococcemia on patient outcomes in those with or without HIV remain unclear. METHODS: One hundred and seventy-nine cryptococcemia patients were enrolled in this retrospective study. Demographic characteristics, blood test results and outcome were compared between the two groups. RESULTS: The diagnosis time of Cryptococcus infection was 2.0(0-6.0) days for HIV-infected patients, 5.0 (1.5-8.0) days for HIV-uninfected patients (p = .008), 2.0 (1.0-6.0) days for cryptococcal meningitis (CM) patients and 6.0 (5.0-8.0) days for non-CM patients (p < .001). HIV infection [adjusted odds ratio (AOR) (95% confidence interval): 6.0(2.3-15.9)], CRP < 15 mg/L [AOR:3.7(1.7-8.1)) and haemoglobin > 110 g/L [AOR:2.5(1.2-5.4)] were risk factors for CM development. Forty-six (25.7%) patients died within 90 days. ICU stay [AOR:2.8(1.1-7.1)], hypoalbuminemia [AOR:2.7(1.4-5.3)], no anti-cryptococcal treatment [AOR:4.7(1.9-11.7)] and altered consciousness [AOR:2.4(1.0-5.5)] were independent risk factors for 90-day mortality in all patients. HIV infection did not increase the 90-day mortality of cryptococcemia patients when anti-Cryptococcus treatment was available. Non-Amphotericin B treatment [AOR:3.4(1.0-11.2)] was associated with 90-day mortality in HIV-infected patients, but age ≥ 50.0 years old [AOR:2.7(1.0-2.9)], predisposing disease [AOR:4.1(1.2-14.2)] and altered consciousness [AOR:3.7(1.1-12.9)] were associated with 90-day mortality in HIV-uninfected patients who accepted anti-Cryptococcus treatment. CONCLUSION: HIV infection increased the incidence of CM rather than mortality in cryptococcemia patients. The predictive model was completely divergent in HIV-infected and HIV-uninfected patients, suggesting that novel strategies for diagnosis and treatment algorithms are urgently needed.

Epigenetic regulation of virulence and the transcription of ribosomal protein genes involves a YEATS family protein in Cryptococcus deneoformans.

Epigenetic marks or post-translational modifications on histones have important regulatory roles in gene expression in eukaryotic organisms. The epigenetic regulation of gene expression in the pathogenic yeast Cryptococcus deneoformans remains largely undetermined. The YEATS domain proteins are readers of crotonylated lysine residues in histones. Here, we reported the identification of a single-copy gene putatively coding for a YEATS domain protein (Yst1) in C. deneoformans. To define its function, we created a mutant strain, yst1Δ, using CRISPR-Cas9 editing. yst1Δ exhibited defects in phenotype, for instance, it was hypersensitive to osmotic stress in the presence of 1.3 M NaCl or KCl. Furthermore, it was hypersensitive to 1% Congo red, suggesting defects in the cell wall. Interestingly, RNA-seq data revealed that Yst1p was critical for the expression of genes encoding the ribosomal proteins, that is, most were expressed with significantly lower levels of mRNA in yst1Δ than in the wild-type strain. The mutant strain was hypersensitive to low temperature and anti-ribosomal drugs, which we putatively attribute to the impairment in ribosomal function. In addition, the yst1Δ strain was less virulent to Galleria mellonella. These results generally suggest that Yst1, as a histone modification reader, might be a key coordinator of the transcriptome of this human pathogen. Yst1 could be a potential target for novel antifungal drugs, which might lead to significant developments in the clinical treatment of cryptococcosis.

Titan cell formation is unique to Cryptococcus species complex.

Members of the Cryptococcus species complex stand out by unique virulence factors that allowed evolutionary transition to pathogenesis. Among the factors contributing to cryptococcosis is a morphological transformation into giant (Titan) cells. It remains unclear whether species outside of the C. neoformans/C. gattii species complex are capable of titanization. We utilized two recently developed protocols that allow obtaining Titan cells in vitro to test if titanization occurs in non-C. neoformans/C. gattii species. We find that none of the tested strains, representing 10 species of basidiomycetous yeasts and the ascomycetous yeast Saccharomyces cerevisiae, undergo significant titanization under conditions that promote robust Titan cell formation in C. neoformans/C. gattii species complex. C. terreus formed occasional enlarged cells through a mechanism potentially similar to that of titanization. Our findings suggest that titanization is a rare phenomenon among basidiomycetous yeasts that occurs mostly in members of the C. neoformans/C. gattii species complex.

Pathogen and host genetics underpinning cryptococcal disease.

Cryptococcosis is a severe fungal disease causing 220,000 cases of cryptococcal meningitis yearly. The etiological agents of cryptococcosis are taxonomically grouped into at least two species complexes belonging to the genus Cryptococcus. All of these yeasts are environmentally ubiquitous fungi (often found in soil, leaves and decaying wood, tree hollows, and associated with bird feces especially pigeon guano). Infection in a range of animals including humans begins following inhalation of spores or aerosolized yeasts. Recent advances provide fundamental insights into the factors from both the pathogen and its hosts which influence pathogenesis and disease. The complex interactions leading to disease in mammalian hosts have also updated from the availability of better genomic tools and datasets. In this review, we discuss recent genetic research on Cryptococcus, covering the epidemiology, ecology, and evolution of Cryptococcus pathogenic species. We also discuss the insights into the host immune response obtained from the latest genetic modified host models as well as insights from monogenic disorders in humans. Finally we highlight outstanding questions that can be answered in the near future using bioinformatics and genomic tools.

Landmark clinical observations and immunopathogenesis pathways linked to HIV and Cryptococcus fatal central nervous system co-infection.

Cryptococcal meningitis remains one of the leading causes of death among HIV-infected adults in the fourth decade of HIV era in sub-Saharan Africa, contributing to 10%-20% of global HIV-related deaths. Despite widespread use and early induction of ART among HIV-infected adults, incidence of cryptococcosis remains significant in those with advanced HIV disease. Cryptococcus species that causes fatal infection follows systemic spread from initial environmental acquired infection in lungs to antigenaemia and fungaemia in circulation prior to establishment of often fatal disease, cryptococcal meningitis in the CNS. Cryptococcus person-to-person transmission is uncommon, and deaths related to blood infection without CNS involvement are rare. Keen to the persistent high mortality associated with HIV-cryptococcal meningitis, seizures are common among a third of the patients, altered mental status is frequent, anaemia is prevalent with ensuing brain hypoxia and at autopsy, brain fibrosis and infarction are evident. In addition, fungal burden is 3-to-4-fold higher in those with seizures. And high immune activation together with exacerbated inflammation and elevated PD-1/PD-L immune checkpoint expression is immunomodulated phenotypes elevated in CSF relative to blood. Lastly, though multiple Cryptococcus species cause disease in this setting, observations are mostly generalised to cryptococcal infection/meningitis or regional dominant species (C neoformans or gattii complex) that may limit our understanding of interspecies differences in infection, progression, treatment or recovery outcome. Together, these factors and underlying mechanisms are hypotheses generating for research to find targets to prevent infection or adequate therapy to prevent persistent high mortality with current optimal therapy.

Etiology and prognosis of encephalitis in French Guianese children: a retrospective record-based study.

Acute encephalitis is an important cause of mortality and morbidity in children. We retrospectively identified children (≤15 years of age) admitted with suspected encephalitis at the Intensive Care Unit of the Pediatric Department of Cayenne Hospital between January 2007 and December 2018. A total of 30 children with acute encephalitis were identified. The incidence rate varied from 0 to 10.40 cases/100000 children under 15 years. Proven encephalitis was diagnosed in 73% of patients. Nine cases of acute disseminated encephalomyelitis were diagnosed. The causes of infection (44%) were Haemophilus influenzae, followed by Cryptococcus spp and Varicella Zoster Virus. Four children (13%) died: one case of Streptococcus pneumoniae, one of Haemophilus influenzae, one of Mycobacterium tuberculosis and one with no identified cause. Seventeen percent of children had moderate to severe neurological sequelae. The only factor associated with poor outcome was young age at the time of hospitalization (p = 0.03). Conclusion: This study highlights both vaccine-preventable pathogens and acute disseminated encephalomyelitis as the leading causes of childhood encephalitis in French Guiana.

Reduction of Human DNA Contamination in Clinical Cerebrospinal Fluid Specimens Improves the Sensitivity of Metagenomic Next-Generation Sequencing.

Metagenomics next-generation sequencing (mNGS) is increasingly available for the detection of obscure infectious diseases of the central nervous system. However, human DNA contamination from elevated white cells, one of the characteristic cerebrospinal fluid (CSF) features in meningitis patients, greatly reduces the sensitivity of mNGS in the pathogen detection. Currently, effective approaches to selectively reduce host DNA contamination from clinical CSF samples are still lacking. In this study, a total of 20 meningitis patients were enrolled, including 10 definitively diagnosed tuberculous meningitis (TBM) and 10 definite cryptococcal meningitis (CM) cases. To evaluate the effect of reduced human DNA in the sensitivity of mNGS detection, three specimen-processing protocols were performed: (i) To remove human DNA, saponin, a nonionic surfactant, was used to selectively lyse white cells in CSF followed by DNase treatment prior to the extraction of DNA; (ii) to reduce host DNA, CSF was centrifuged to remove human cells, and the supernatant was collected for DNA extraction; and (iii) DNA extraction from the unprocessed specimens was set as the control. We found that saponin processing significantly elevated the NGS unique reads for Cryptococcus (P < 0.01) compared with the control but had no effects for Mycobacterium tuberculosis (P > 0.05). However, detection of centrifuged supernatants improved the NGS unique reads for both TBM and CM compared with controls (P < 0.01). Our results demonstrate that the use of mNGS of centrifuged supernatants from clinical CSF samples in patients with TBM and CM is a simple and effective method to improve the sensitivity of pathogen detection.

Repurposing the thrombopoietin receptor agonist eltrombopag as an anticryptococcal agent.

In this study, a Food and Drug Administration (FDA)-approved drug with previously unreported antifungal activity was investigated for suitability for use as an anticryptococcal agent. First, we screened a compound library of 1018 FDA-approved drugs against Cryptococcus neoformans. Of 52 drugs possessing anti-Cryptococcus activity, eltrombopag was chosen due to its novel activity. The susceptibility of Cryptococcus against eltrombopag was then studied by determining the minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC), while the synergy of eltrombopag with other drugs was tested by fractional inhibitory concentration index (FICI). Eltrombopag had a limited spectrum of antifungal activity against C. neoformans/C. gattii species complex (MICs of 0.125 mg/l), Candida glabrata (MIC, 0.25 mg/l), and Trichophyton rubrum (MIC, 0.5 mg/l). Eltrombopag affected cryptococcal virulence factors, including capsule and biofilm formation, melanin production, and growth ability at 37°C. Further, RNA sequencing and deletion mutant library screening experiments revealed that genes involved in the calcineurin pathway, lipid biosynthesis, membrane component, and transporter genes were associated with eltrombopag. In addition, eltrombopag showed synergism with the calcineurin inhibitor FK506 (FICI < 0.5) against Cryptococcus species. In conclusion, eltrombopag exhibited excellent antifungal activity against Cryptococcus species potentially via a mode of action which interferes with virulence factors and the calcineurin pathway, indicating that eltrombopag might be usefully repurposed as an antifungal agent for treating cryptococcosis.

Cerebrospinal fluid pleocytosis in immunocompromised patients: Can it be Cryptococcus.

Cryptococcal meningitis commonly affects immunocompromised cases and can have varied presentation. In some instances, the presence of a plethora of inflammatory cells on cerebrospinal fluid (CSF) in an immunosuppressed patient can lead to further investigations, which unravel the presence of cryptococcal meningitis. The aim of this retrospective study was to analyze the spectrum of CSF findings of immunosuppressed patients who were diagnosed to have cryptococcal meningitis. Retrospective analysis of CSF cytospin slides exhibiting pleocytosis and belonging to immunocompromised patients was performed, and these cases were found to have cryptococcal meningitis. Out of 932 cases of CSF (January 2016-July 2017), 10 had pleocytosis and 5 of these 10 cases demonstrated spores of Cryptococcus. Male-to-female ratio was 1:1.5. All the patients were immunocompromised and had CSF leukocytosis. Lymphocytes and monocytes were present in all samples while only one case showed plasma cells. Spores of Cryptococcus were also noted in all the cases and highlighted on India Ink Preparation and Gomori Methenamine Silver stain. All the cases were positive for agglutination-based cryptococcal antigen assay, except one where the test was not done. All immunosuppressed patients having pleocytosis in CSF were found to have cryptococcal infection. Therefore, pleocytosis in CSF in any immunosuppressed patient should raise the suspicion of cryptococcal meningitis. The pathologist and the clinician need to be vigilant in such scenarios to rule out any opportunistic infection and investigate the patient thoroughly for any underlying immunosuppression.

Cryptococcosis in Patients following Kidney Transplantation: A 9-Year Retrospective Clinical Analysis at a Chinese Tertiary Hospital.

BACKGROUND: Cryptococcosis following kidney transplantation (KT) is rare but is associated with considerably increased risk of mortality. At present, data on the association between cryptococcosis and KT in mainland China remain relatively limited. OBJECTIVES: This study aims to review our experience related to the management of cryptococcosis following KT at a Chinese tertiary hospital. METHODS: All patients with cryptococcosis following KT admitted to our hospital from January 2010 to December 2018 were reviewed. RESULTS: A total of 37 patients with cryptococcosis were enrolled (males: 62.2%). The mean age of the patients was 49.5 ± 9.38 (20-64) years. The average time to infection following KT was 7.0 ± 5.50 years (5 months to 21 years), and 30 patients (81.1%) had cryptococcosis onset >2 years following transplantation. The most common site of infection was the central nervous system, followed by the pulmonary system and skin. Most patients received fluconazole or voriconazole with or without flucytosine as their initial treatment regimen at our hospital. The 2-week mortality rate was 8.1% (3/37), and five patients (13.5%) died within 6 months of being diagnosed with cryptococcosis. Remarkably, all patients who received high-dose fluconazole (800 mg daily) or voriconazole ± flucytosine survived. CONCLUSIONS: Cryptococcosis in kidney transplant recipients is typically a late-occurring infection, with most patients having cryptococcosis onset >2 years following KT at our hospital. The central nervous system, pulmonary system, and skin are the main sites of infection. Voriconazole or high-dose fluconazole can be used as an alternative therapy for post-KT cryptococcosis.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.