Automation and standardisation of a quantitative multiplex PCR assay using PCR.Ai.

BACKGROUND: We previously undertook a prospective clinical study to evaluate PCR.Ai's (www.pcr.ai) accuracy and impact when automating the manual data-analysis and quality control steps associated with routine clinical pathogen testing using a non-quantitative multiplex quantitative real-time PCR (qPCR). In this study we demonstrated 100 % concurrence between our manual routine analysis method and PCR.Ai. This paper expands the evaluation of PCR.Ai's (www.pcr.ai) accuracy and impact using a multiplex quantitative real-time PCR (qPCR). OBJECTIVES: We evaluated the impact of PCR.Ai when used as the final interpretation/verification step for routine in-house multiplex quantitative qPCR tests for CMV, EBV and adenovirus from blood samples for a total of 1350 interpretations. STUDY DESIGN: We compared PCR.Ai to our existing manual interpretation, to determine accuracy and hands on time savings. RESULTS AND CONCLUSIONS: There was 100 % concurrence between validated CMV, EBV and adenovirus detection and quantitation by our manual routine analysis method and PCR.Ai. Furthermore, there were significant routine savings with PCR.Ai of 63 minutes/ run. Our conclusion is that for quantitative tests PCR.Ai is a highly accurate time-saving tool that reduces complexity of qPCR analysis and hence the need for specialists and hands-on time. It demonstrated capabilities to enable us to get results out more quickly with lower costs and less risk of errors.

Three steps towards comparability and standardization among molecular methods for characterizing insect communities.

Molecular methods are currently some of the best-suited technologies for implementation in insect monitoring. However, the field is developing rapidly and lacks agreement on methodology or community standards. To apply DNA-based methods in large-scale monitoring, and to gain insight across commensurate data, we need easy-to-implement standards that improve data comparability. Here, we provide three recommendations for how to improve and harmonize efforts in biodiversity assessment and monitoring via metabarcoding: (i) we should adopt the use of synthetic spike-ins, which will act as positive controls and internal standards; (ii) we should consider using several markers through a multiplex polymerase chain reaction (PCR) approach; and (iii) we should commit to the publication and transparency of all protocol-associated metadata in a standardized fashion. For (i), we provide a ready-to-use recipe for synthetic cytochrome c oxidase spike-ins, which enable between-sample comparisons. For (ii), we propose two gene regions for the implementation of multiplex PCR approaches, thereby achieving a more comprehensive community description. For (iii), we offer guidelines for transparent and unified reporting of field, wet-laboratory and dry-laboratory procedures, as a key to making comparisons between studies. Together, we feel that these three advances will result in joint quality and calibration standards rather than the current laboratory-specific proof of concepts. This article is part of the theme issue 'Towards a toolkit for global insect biodiversity monitoring'.

DEVELOPMENT OF A TRIPLEX REAL-TIME PCR ASSAY TO DETECT ECHINOCOCCUS SPECIES IN CANID FECAL SAMPLES.

Echinococcosis is a zoonotic disease with great significance to public health, and appropriate detection and control strategies should be adopted to mitigate its impact. Most cases of echinococcosis are believed to be transmitted by the consumption of food and/or water contaminated with canid stool containing Echinococcus spp. eggs. Studies assessing Echinococcus multilocularis, Echinococcus granulosus sensu stricto, and Echinococcus shiquicus coinfection from contaminated water-derived, soil-derived, and food-borne samples are scarce, which may be due to the lack of optimized laboratory detection methods. The present study aimed to develop and evaluate a novel triplex TaqMan-minor groove binder probe for real-time polymerase chain reaction (rtPCR) to simultaneously detect the 3 Echinococcus spp. mentioned above from canid fecal samples in the Qinghai-Tibetan Plateau area (QTPA). The efficiency and linearity of each signal channel in the triplex rtPCR assay were within acceptable limits for the range of concentrations tested. Furthermore, the method was shown to have good repeatability (standard deviation ≤0.32 cycle threshold), and the limit of detection was estimated to be 10 copies plasmid/µl reaction. In summary, the evaluation of the present method shows that the newly developed triplex rtPCR assay is a highly specific, precise, consistent, and stable method that could be used in epidemiological investigations of echinococcosis.

Development and validation of a multiplex real-time qPCR assay using GMP-grade reagents for leprosy diagnosis.

Leprosy is a chronic dermato-neurological disease caused by Mycobacterium leprae, an obligate intracellular bacterium. Timely detection is a challenge in leprosy diagnosis, relying on clinical examination and trained health professionals. Furthermore, adequate care and transmission control depend on early and reliable pathogen detection. Here, we describe a qPCR test for routine diagnosis of leprosy-suspected patients. The reaction simultaneously amplifies two specific Mycobacterium leprae targets (16S rRNA and RLEP), and the human 18S rRNA gene as internal control. The limit of detection was estimated to be 2.29 copies of the M. leprae genome. Analytical specificity was evaluated using a panel of 20 other skin pathogenic microorganisms and Mycobacteria, showing no cross-reactivity. Intra- and inter-operator Cp variation was evaluated using dilution curves of M. leprae DNA or a synthetic gene, and no significant difference was observed between three operators in two different laboratories. The multiplex assay was evaluated using 97 patient samples with clinical and histopathological leprosy confirmation, displaying high diagnostic sensitivity (91%) and specificity (100%). Validation tests in an independent panel of 50 samples confirmed sensitivity and specificity of 97% and 98%, respectively. Importantly, assay performance remained stable for at least five months. Our results show that the newly developed multiplex qPCR effectively and specifically detects M. leprae DNA in skin samples, contributing to an efficient diagnosis that expedites the appropriate treatment.

Diagnostic accuracy of multiplex polymerase chain reaction on tissue biopsies in periprosthetic joint infections.

The diagnosis and treatment of periprosthetic joint infection (PJI) currently relies on cultures, which are time-consuming and often fail. Multiplex PCR assays promise reliable and prompt results, but have been heterogeneously evaluated. In this study, we analyse multiplex PCR in pathogen identification using only tissue biopsies. 42 patients after revision arthroplasty of the hip or knee were evaluated using multiplex PCR to identify microorganisms. The patients were classified according to the diagnostic criteria published by Zimmerli et al. and the results were compared to the respective microbiological cultures. PJI was detected in 15 patients and 27 revisions were aseptic. The multiplex PCR of tissue biopsies had a sensitivity of 0.3 (95% CI 0.12-0.62), a specificity of 1.0 (0.87-1.0), a positive predictive value of 1.0 (0.48-1.0) and a negative predictive value of 0.73 (0.56-0.86). The diagnostic accuracy of multiplex PCR on tissue biopsy samples is low in comparison to routine microbiological cultures. The evaluation of tissue biopsies using multiplex PCR was prone to false negative results. However, multiplex PCR assays have the advantage of rapid pathogen identification. We therefore recommend further investigation of multiplex PCR in the setting of suspected PJI with a careful choice of specimens.

Highly sensitive duplex MSI test and BAT40 germline polymorphism.

Tumors exhibiting DNA mismatch repair (MMR) deficiency and microsatellite instability (MSI) are responsive to immune checkpoint blockade. MSI is frequently diagnosed using five quasimonomorphic mononucleotide (pentaplex) markers; however, the assays have several technical limitations, including the lack of sensitivity of some of the markers. Although markers with increased sensitivity, such as CAT25 and BAT40, have been introduced, the majority of multiplex MSI tests have only been studied in Western populations and require further evaluation in an Asian cohort. This study tested the efficacy of BAT26, CAT25, and BAT40 mononucleotide MSI markers via triplex PCR on 300 samples from patients with advanced cancers from a Korean clinical population. The results were directly compared with those of a pentaplex MSI test and tumor mutation burden (TMB) status, and an additional 60 MSI-H cancers were used for further validation. Four (1.3%) out of 300 advanced tumors were MSI-high (MSI-H). In the pentaplex PCR assay, two colorectal cancers (0.7%) exhibited instability only with the BAT25 mononucleotide marker and were interpreted as MSI-low (MSI-L). In the triplex PCR assay, BAT40 was unstable in 64 cases (21%) and the results did not overlap with those of MSI-L from pentaplex. Given the high frequency of isolated BAT40 instability, we performed the same triplex PCR with DNA obtained from normal controls and found BAT40 polymorphisms in 37 cases (90%). Interestingly, the median TMB of the cases with BAT40 polymorphism was significantly higher (7.0 mt/Mb) than that of BAT40 wild-type cases (5.5 mt/Mb) (p = 0.003). The triplex PCR results from 60 additional MSI-H cancers correlated perfectly (100%) with those of pentaplex PCR, and the results were consistent for two (BAT26 and CAT25) markers. BAT40 germline polymorphism is common in the Korean population and is associated with higher TMB values. The simple duplex (BAT26 and CAT25) MSI test provided the same sensitivity and specificity as pentaplex PCR tests.

Development and clinical evaluation of a new multiplex PCR assay for a simultaneous diagnosis of tuberculous and nontuberculous mycobacteria.

BACKGROUND: The prevalence of non-tuberculous mycobacteria (NTM) has been increasing worldwide in both developed and developing countries. NTM infection is clinically indistinguishable from tuberculosis and therefore poses significant challenges in patient management, especially in patients chronically treated for pulmonary TB. In this study, we evaluated a new highly sensitive Multiplex MTB/NTM assay that can differentiate M. tuberculosis complex (MTBC) from all NTM, including the treatable and most common NTM, M. avium complex (MAC). METHODS: We developed and optimized a new open- Multiplex MTB/NTM assay with two gene-targets for MTBC (IS6110/senX3-regX3) and two targets for MAC (IS1311/DT1) with samples spiked with stored strains and testing 20 replicates. Patients with presumptive TB and NTM were enrolled at the Respiratory Disease Department of The University Teaching Hospital of Point G, in Mali. FINDINGS: In the development stage, the new assay showed a high analytic performance with 100% detections of MTBC and MAC at only 5 colony forming units (CFUs). Overall, without the treatment failure cases, the Multiplex assay and the Xpert showed a sensitivity, specificity, PPV and NPV of 83·3% [66·4-92·6], 96·6% [88·6-99·0], 92·5% [82·3-96·5] and 92·2% [82·7-96·5] and the Xpert had values of 96·7% [83·3-99·4], 80·0% [68·2-88·1], 70·7 [55·5-82·3] and 97·9% [89·3-99·6], respectively. The Multiplex assay successfully detected all (5/5) the MAC cases. INTERPRETATION: Our new Multiplex assay demonstrates better specificity than Xpert for all group studied, in addition to detecting potential NTM cases. The assay could therefore complement the widely used Xpert assay and enhance discrimination of TB and NTM infections. FUNDING: This work was supported by the National Institutes of Health (R03AI137674, U54EB027049, D43TW010350 and UM1AI069471) and Northwestern University's Institute for Global Health Catalyzer Fund.

Diagnostic accuracy of the BioFire FilmArray blood culture identification panel when used in critically ill patients with sepsis.

Sepsis accounts for high mortality rates in critical care units. Prompt and accurate identification of causative pathogens and initiation of appropriate antimicrobial therapy is critical for the appropriate management of patients in order to optimise clinical outcomes. The BioFire FilmArray blood culture identification (BCID) panel is a US Food and Drug Administration (FDA) approved rapid, multiplex polymerase chain reaction (PCR) assay that is able to identify a variety of bacteria, fungi and antimicrobial resistance determinants directly from positive blood cultures. The aim of this study was to evaluate the diagnostic performance of the BioFire FilmArray BCID panel against the gold standard of blood cultures. Seventy-eight positive blood cultures obtained from critically ill patients suspected of having sepsis were included in the study. Each bottle was processed with the BioFire FilmArray BCID panel as well as conventional culture methods. Diagnostic accuracy of the BioFire FilmArray BCID panel was determined. The assay demonstrated a high sensitivity and specificity for pathogen identification of 96.5% (95% CI, 91.3-99.0) and 99.7% (95% CI, 99.3-99.9), respectively. The findings of this study support the role of the BioFire FilmArray BCID panel in the management of critically ill patients with sepsis.

Evaluation of the Genmark ePlex® and QIAstat-Dx® respiratory pathogen panels in detecting bacterial targets in lower respiratory tract specimens.

BACKGROUND: The ePlex® and QIAstat-Dx® respiratory pathogen panels detect multiple respiratory pathogens, mainly viruses but also Legionella pneumophila, Mycoplasma pneumoniae and Bordetella pertussis. The assays have been marketed for use in nasopharyngeal swab specimens. For diagnosing bacterial pneumonia, lower respiratory tract (LRT) specimens are indicated. Aim of this study was to evaluate the performance of these syndromic panels for these three bacterial targets in samples from the LRT. Fifty-six specimens were collected from our repositories, five negative samples and fifty-one samples which had been previously tested positive with the routine diagnostic real-time PCR assays for Legionella spp. (N = 20), Bordetella spp. (N = 16) or M. pneumoniae (N = 15). RESULTS: The QIAstat-Dx Respiratory Panel V2 (RP) assay detected all of the L. pneumophila and B. pertussis positive samples but only 11/15 (73.3 %) of the M. pneumoniae targets. The ePlex Respiratory Pathogen Panel (RPP) assay detected 10/14 (71.4 %) of the L. pneumophila targets, 8/12 (66.7 %) of the B. pertussis positive samples and 13/15 (86.7 %) of the M. pneumoniae targets. CONCLUSIONS: No false-positive results were reported for all three bacterial pathogens by both assays. The clinical performance of both assays depended highly on the bacterial load in the sample and the type of specimen under investigation.

Multiplex RT-PCR provides improved diagnosis of skin and nail dermatophyte infections compared to microscopy and culture: a laboratory study and review of the literature.

Dermatophytes are the most common cause of superficial mycosis, estimated to affect 20% to 25% of the general population. We assessed the performance of a novel real-time polymerase chain reaction (RT-PCR) multiplex assay for diagnosis of dermatophytosis. To evaluate sensitivity and specificity, 10 known bacteria and 10 known fungi commonly found on skin, as well as 105 samples with culture confirmed dermatophytosis were tested using Dermatophyte and Fungi assay (AusDiagnostics, Sydney, Australia), a novel multiplex assay for diagnosis of dermatophytosis in skin and nail. This was followed by prospective evaluation of 195 clinical samples for dermatophytosis by both conventional methods and RT-PCR. RT-PCR showed almost two-fold higher sensitivity and high specificity in the diagnosis of skin and nail dermatophytosis compared to traditional microscopy and culture. In addition, RT-PCR demonstrated markedly reduced turnaround time from 4 to 6 weeks to 4 to 6 hours and ability for high throughput.

Endpoint PCR coupled with capillary electrophoresis (celPCR) provides sensitive and quantitative measures of environmental DNA in singleplex and multiplex reactions.

The use of sensitive methods is key for the detection of target taxa from trace amounts of environmental DNA (eDNA) in a sample. In this context, digital PCR (dPCR) enables direct quantification and is commonly perceived as more sensitive than endpoint PCR. However, endpoint PCR coupled with capillary electrophoresis (celPCR) potentially embodies a viable alternative as it quantitatively measures signal strength after PCR in Relative Fluorescence Units (RFU). Provided comparable levels of sensitivity are reached, celPCR permits the development of cost-efficient multiplex reactions, enabling the simultaneous detection of several target taxa. Here, we compared the sensitivity of singleplex and multiplex celPCR to dPCR for species-specific primer pairs amplifying mitochondrial DNA (COI) of fish species occurring in European freshwaters by analyzing dilution series of tissue extracts as well as field-collected water samples. Both singleplex and multiplex celPCR and dPCR displayed comparable sensitivity with reliable positive amplifications starting at two to 10 target DNA copies per µl extract. celPCR was suitable for quantifying target DNA and direct inference of copy numbers from RFU was possible after accounting for primer effects in linear mixed-effects models and calibration via dPCR. Furthermore, multiplex celPCR and dPCR were successfully used for the detection and quantification of fish-eDNA in field-collected water samples, confirming the results of the dilution series experiment and exemplifying the high sensitivity of the two approaches. The possibility of detection and quantification via multiplex celPCR is appealing for the cost-efficient screening of high sample numbers. The present results confirm the sensitivity of this approach thus enabling its application for future eDNA-based monitoring efforts.

Rapid Multiplex Loop-Mediated Isothermal Amplification (m-LAMP) Assay for Differential Diagnosis of Leprosy and Post-Kala-Azar Dermal Leishmaniasis.

Leprosy and post-kala-azar dermal leishmaniasis (PKDL) are co-endemic neglected tropical diseases often misdiagnosed because of close resemblance in their clinical manifestations. The test that aids in differential diagnosis of leprosy and PKDL would be useful in endemic areas. Here, we report development of a multiplex loop-mediated isothermal amplification (m-LAMP) assay for differential detection of Mycobacterium leprae and Leishmania donovani using a real-time fluorometer. The m-LAMP assay was rapid with a mean amplification time of 15 minutes, and analytical sensitivity of 1 fg for L. donovani and 100 fg for M. leprae. The distinct mean Tm values for M. leprae and L. donovani allowed differentiation of the two organisms in the m-LAMP assay. Diagnostic sensitivity of the assay was evaluated by using confirmed cases of leprosy (n = 40) and PKDL (n = 40) (tissue and slit aspirate samples). All the leprosy and PKDL samples used in this study were positive by organism-specific QPCR and loop-mediated isothermal amplification assays. The diagnostic sensitivity of the m-LAMP assay was 100% (95% CI: 91.2-100.0%) for detecting PKDL and 95% for leprosy (95% CI: 83.1-99.4%). Our m-LAMP assay was successfully used to detect both M. leprae and L. donovani in a patient coinfected with leprosy and macular PKDL. The m-LAMP assay is rapid, accurate, and applicable for differential diagnosis of leprosy versus PKDL, especially in endemic areas.

Development of multiplex real-time RT-PCR assay for the detection of SARS-CoV-2.

The outbreak of the new human coronavirus SARS-CoV-2 (also known as 2019-nCoV) continues to increase globally. The real-time reverse transcription polymerase chain reaction (rRT-PCR) is the most used technique in virus detection. However, possible false-negative and false-positive results produce misleading consequences, making it necessary to improve existing methods. Here, we developed a multiplex rRT-PCR diagnostic method, which targets two viral genes (RdRP and E) and one human gene (RP) simultaneously. The reaction was tested by using pseudoviral RNA and human target mRNA sequences as a template. Also, the protocol was validated by using 14 clinical SARS-CoV-2 positive samples. The results are in good agreement with the CDC authorized Cepheid`s Xpert® Xpress SARS-CoV-2 diagnostic system (100%). Unlike single gene targeting strategies, the current method provides the amplification of two viral regions in the same PCR reaction. Therefore, an accurate SARS-CoV-2 diagnostic assay was provided, which allows testing of 91 samples in 96-well plates in per run. Thanks to this strategy, fast, reliable, and easy-to-use rRT-PCR method is obtained to diagnose SARS-CoV-2.

Development and application of a novel multiplex PCR assay for the differentiation of four haemosporidian parasites in the chicken Gallus gallus domesticus.

Haemosporidian infections in domestic chickens (Gallus gallus domesticus) are not only widely prevalent but also cause economic loss. Diagnosis is usually made by microscopic examination; however, the method has several drawbacks such as requiring an experienced microscopist, being unreliable when parasitemia is low and being unable to accurately differentiate between co-infections from multiple parasite species. Therefore, the current extent of haemosporidian infections might be underestimated and neglected. We have developed a novel multiplex PCR assay to simultaneously detect and differentiate between four haemosporidian parasites: Leucocytozoon caulleryi, Leucocytozoon sabrazesi, Plasmodium juxtanucleare and Plasmodium gallinaceum. Primers in the present study specifically amplified the corresponding targets with no cross-species amplification detected. The multiplex PCR exhibited a significantly greater detection rate when compared with microscopic examination (p = 0.0001). The results demonstrate that the detection rate of multiplex PCR for L. sabrazesi, P. juxtanucleare, and P. gallinaceum are all greater than that of microscopic examination with p = 0.002, 0.0001 and 0.004, respectively. Co-infections were also detected more effectively by multiplex PCR. We applied the current method to field samples originating from Nan, Prachinburi, and Chachoengsao Provinces. The current study revealed that positive rates of haemosporidian parasites in chickens in the three study sites ranging from 39.5%-93.8%. The present assay offers a timesaving option for molecular diagnosis instead of using singleplex PCRs for detecting the parasites individually. Within a single reaction, this assay would be a useful tool for the detection of avian haemosporidian parasites either single or under co-infection conditions and for large-scale epidemiology studies.

Research Note: Simultaneous detection of infectious laryngotracheitis virus, fowlpox virus, and reticuloendotheliosis virus in chicken specimens.

Infectious laryngotracheitis (ILT), fowlpox (FP), and reticuloendotheliosis are important poultry diseases caused by gallid herpesvirus 1 (ILTV), fowlpox virus (FWPV), and reticuloendotheliosis virus (REV), respectively. Coinfections with ILTV and FWPV occur naturally in chickens, and FP in its more virulent wet form is characterized by diphtheritic lesions and easily confused with ILT. Moreover, the insertion of only partial REV-LTR or a nearly full-length REV into the FWPV genome, located between the ORF 201 and ORF 203, has increased recently in wild-type field FWPV isolates. Therefore, it is critical to detect ILTV, FWPV, REV-integrated FWPV, and REV early and accurately. In this study, we successfully developed a multiplex PCR assay for the simultaneous detection of ILTV, FWPV, REV-integrated FWPV, and REV, and the detection limits was 1 × 54 copies/tube. When used to test clinical samples, the results of the multiplex PCR were in 100% agreement with singleplex PCRs and sequencing. This new multiplex PCR is a simple, rapid, sensitive, specific, and cost-effective method for detection of 4 viruses in clinical specimens.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Validation of multiplex PCR sequencing assay of SIV.

BACKGROUND: The generation of accurate and reproducible viral sequence data is necessary to understand the diversity present in populations of RNA viruses isolated from clinical samples. While various sequencing methods are available, they often require high quality templates and high viral titer to ensure reliable data. METHODS: We modified a multiplex PCR and sequencing approach to characterize populations of simian immunodeficiency virus (SIV) isolated from nonhuman primates. We chose this approach with the aim of reducing the number of required input templates while maintaining fidelity and sensitivity. We conducted replicate sequencing experiments using different numbers of quantified viral RNA (vRNA) or viral cDNA as input material. We performed assays with clonal SIVmac239 to detect false positives, and we mixed SIVmac239 and a variant with 24 point mutations (SIVmac239-24X) to measure variant detection sensitivity. RESULTS: We found that utilizing a starting material of quantified viral cDNA templates had a lower rate of false positives and increased reproducibility when compared to that of quantified vRNA templates. This study identifies the importance of rigorously validating deep sequencing methods and including replicate samples when using a new method to characterize low frequency variants in a population with a small number of templates. CONCLUSIONS: Because the need to generate reproducible and accurate sequencing data from diverse viruses from low titer samples, we modified a multiplex PCR and sequencing approach to characterize SIV from populations from non-human primates. We found that increasing starting template numbers increased the reproducibility and decreased the number of false positives identified, and this was further seen when cDNA was used as a starting material. Ultimately, we highlight the importance of vigorously validating methods to prevent overinterpretation of low frequency variants in a sample.

Effectiveness of rapid multiplex polymerase chain reaction for early diagnosis and treatment of pertussis.

BACKGROUND: Pertussis, is an infectious respiratory disease caused by Bordetella pertussis. The incidence of pertussis has been increasing in South Korea to due to waning vaccine-induced immunity. Culture has a low sensitivity and a long turnaround time (TAT). Recently, a rapid multi-polymerase chain reaction (mPCR) test with a TAT of about 1 h was developed for the detection of respiratory pathogens (17 viruses and three bacteria), including B. pertussis. This study aimed to investigate the effectiveness of mPCR for early diagnosis and treatment of pertussis. METHODS: We performed a retrospective study of patients with pertussis diagnosed from May 2017 to June 2019 at a university hospital in South Korea. Nasopharyngeal swab specimens were tested using mPCR. Data were extracted from medical records. RESULTS: A total of 27 patients with a median age of 48.9 years (range: 3.3-82.2 years) were diagnosed with pertussis, of whom 9 (33.3%) were male. Eleven (40.7%) had fever, 12 (44.4%) had dyspnea, three (11.1%) had paroxysmal cough, and nine (33.3%) had inspiratory whooping. The median interval from symptom onset to diagnosis was 9.0 days (range: 1-31 days). Twenty-four patients (81.5%) were diagnosed within 2 weeks from symptom onset. All but one patient was prescribed macrolide antibiotics. Twenty-two patients (81.5%) required hospitalization, including three (11.1%) who required intensive care unit care for ventilation. CONCLUSION: Testing patients with respiratory symptoms using mPCR can improve early diagnosis of pertussis, ensure proper treatment, and may help with outbreak control.

Detection of copy-number variations from NGS data using read depth information: a diagnostic performance evaluation.

The detection of copy-number variations (CNVs) from NGS data is underexploited as chip-based or targeted techniques are still commonly used. We assessed the performances of a workflow centered on CANOES, a bioinformatics tool based on read depth information. We applied our workflow to gene panel (GP) and whole-exome sequencing (WES) data, and compared CNV calls to quantitative multiplex PCR of short fluorescent fragments (QMSPF) or array comparative genomic hybridization (aCGH) results. From GP data of 3776 samples, we reached an overall positive predictive value (PPV) of 87.8%. This dataset included a complete comprehensive QMPSF comparison of four genes (60 exons) on which we obtained 100% sensitivity and specificity. From WES data, we first compared 137 samples with aCGH and filtered comparable events (exonic CNVs encompassing enough aCGH probes) and obtained an 87.25% sensitivity. The overall PPV was 86.4% following the targeted confirmation of candidate CNVs from 1056 additional WES. In addition, our CANOES-centered workflow on WES data allowed the detection of CNVs with a resolution of single exons, allowing the detection of CNVs that were missed by aCGH. Overall, switching to an NGS-only approach should be cost-effective as it allows a reduction in overall costs together with likely stable diagnostic yields. Our bioinformatics pipeline is available at: https://gitlab.bioinfo-diag.fr/nc4gpm/canoes-centered-workflow .

Enhanced Detection of Community-Acquired Pneumonia Pathogens With the BioFire® Pneumonia FilmArray® Panel.

BACKGROUND: Although most observational studies identify viral or bacterial pathogens in 50% or less of patients hospitalized with community-acquired pneumonia (CAP), we previously demonstrated that a multi-test bundle (MTB) detected a potential pathogen in 73% of patients. This study compares detection rates for potential pathogens with the MTB versus the Biofire® Pneumonia FilmArray® panel (BPFA) multiplex PCR platform and presents an approach for integrating BPFA results as a foundation for subsequent antibiotic stewardship (AS) activities. METHODS: Between January 2017 to March 2018, all patients admitted for CAP were enrolled. Patients were considered evaluable if all elements of the MTB and the BPFA were completed, and they met other a priori inclusion criteria. The primary endpoint was the percentage of potential pathogens detected using the MTB (8 viral and 6 bacterial targets) versus the BPFA (8 viral and 18 bacterial targets). Blood and sputum cultures were performed on all patients. Two or more procalcitonin (PCT) levels assisted clinical assessments as to whether detected bacteria were invading or colonizing. RESULTS: Of 585 enrolled patients, 274 were evaluable. A potential viral pathogen was detected in 40.5% with MTB versus 60.9% of patients with BPFA with an odds ratio (95% CI) of 9.00 (4.12 to 23.30) p<0.01. A potential bacterial pathogen was identified in 66.4% with the MTB vs 75.5% with the BPFA odds ratio (95% CI) of 2.09 (1.24 to 3.59), p 0.003). Low PCT levels helped identify detected bacteria as colonizers.