An All-Zirconia Crown Discovered 2 Years Following Aspiration.

Accidental aspiration or ingestion can occur in dental treatment, as most procedures are performed with the patient in a supine position or semi-recumbent position. Aspiration of foreign bodies commonly causes acute symptoms such as violent coughing, choking, and dyspnea; however, if foreign bodies are stuck distally to the lower lobe bronchi or the bronchus intermedius, acute presentation can be rare. This clinical report documents a 68-year-old male patient who accidentally aspirated an all-zirconia crown during the try-in procedure. The case was initially surmised as ingestion. The crown remained in the lower lobe of the left lung for about 2 years without any significant symptoms. This report cautions the importance of airway protection during dental procedures.

Encapsulation of Nucleic Acids into Giant Unilamellar Vesicles by Freeze-Thaw: a Way Protocells May Form.

Protocells are believed to consist of a lipid membrane and encapsulated nucleic acid. As the lipid membrane is impermeable to macromolecules like nucleic acids, the processes by which nucleic acids become encapsulated inside lipid membrane compartments are still unknown. In this paper, a freeze-thaw method was modified and applied to giant unilamellar vesicles (GUVs) and deoxyribonucleic acid (DNA) in mixed solution resulting in the efficient encapsulation of 6.4 kb plasmid DNA and similar length linear DNA into GUVs. The mechanism of encapsulation was followed by observing the effect of freeze-thaw temperatures on GUV morphological change, DNA encapsulation and ice crystal formation, and analyzing their correlation. Following ice crystal formation, the shape of spherical GUVs was altered and membrane integrity was damaged and this was found to be a necessary condition for encapsulation. Heating alone had no effects on DNA encapsulation, but was helpful for restoring the spherical shape and membrane integrity of GUVs damaged during freezing. These results suggested that freeze-thaw could promote the encapsulation of DNA into GUVs by a mechanism: the vesicle membrane was breached by ice crystal formation during freezing, DNA entered into damaged GUVs through these membrane gaps and was encapsulated after the membrane was resealed during the thawing process. The process described herein therefore describes a simple way for the encapsulation of nucleic acids and potentially other macromolecules into lipid vesicles, a process by which early protocells might have formed.

A 3D porous polymer monolith-based platform integrated in poly(dimethylsiloxane) microchips for immunoassay.

In this work, we demonstrate the immunocapture and on-line fluorescence immunoassay of protein and virus based on porous polymer monoliths (PPM) in microfluidic devices. Poly(glycidyl methacrylate-co-ethylene glycol dimethacrylate) [poly(GMA-co-EGDMA)] monoliths were successfully synthesized in the polydimethylsiloxane (PDMS) microfluidic channels by in situ UV-initiated free radical polymerization. After surface modification, PPM provides a high-surface area and specific affinity 3D substrate for immunoassays. Combining with well controlled microfluidic devices, the direct immunoassay of IgG and sandwich immunoassay of inactivated H1N1 influenza virus using 5 µL sample has been accomplished, with detection limits of 4 ng mL(-1) and less than 10 pg mL(-1), respectively. The enhanced detection sensitivity is due to both high surface area of PPM and flow-through design. The detection time was obviously decreased mainly due to the shortened diffusion distance and improved convective mass transfer inside the monolith, which accelerates the reaction kinetics between antigen and antibody. This work provides a novel microfluidic immunoassay platform with high efficiency thereby enabling fast and sensitive immunoassay.

Swelling and glyphosate-controlled release behavior of multi-responsive alginate-g-P(NIPAm-co-NDEAm)-based hydrogel.

Intelligent controlled release systems (ICRS) displayed great achievement in agriculture by enhancing the utilization efficiency of agrochemicals. In this work, an intelligent graft copolymer (Alg-g-P(NIPAm-co-NDEAm)) with alginate (Alg) backbone and thermo-responsive poly(N-isopropyl acrylamide-co-N,N-diethylacrylamide) (P(NIPAm-co-NDEAm)) side chain was constructed as the matrix of ICRS through redox copolymerization, and its thermo-induced responsive property was studied. Then, the copolymer was mixed with a promising photothermal material semi-coke (SC) to form hydrogel beads (Ca-Alg-g-P(NIPAm-co-NDEAm)/SC) by ion crosslinking. The water absorbency of beads under different stimuli (pH, temperature, and light) presented outstanding responsive performance and the swelling mechanism was analyzed through coupling theory. Furthermore, the release of glyphosate (Gly) from Ca-Alg-g-P(NIPAm-co-NDEAm)/SC under environmental stimuli displayed regulatable behaviors. This multi-responsive hydrogel bead shows bright prospect in the sustainable advancement of crop production.

Synthesis and characterization of dopamine-modified Ca-alginate/poly(N-isopropylacrylamide) microspheres for water retention and multi-responsive controlled release of agrochemicals.

The multi-responsive controlled-release system could enhance crop yield while improving utilization efficiency of agrochemicals, and minimize environmental pollution caused by agrochemicals overuse. This work reports a novel Ca-alginate/Poly(N-isopropylacrylamide)@polydopamine (Ca-alginate/PNIPAm@PDA) microsphere to control the agrochemicals release. Microsphere with a semi-interpenetrating network, which contained pH-sensitive Ca-alginate, temperature-sensitive poly(N-isopropylacrylamide) (PNIPAm), and sunlight-sensitive polydopamine (PDA), was characterized by thermogravimetric analysis, zeta potential, Fourier transform infrared spectroscopy, and scanning electron microscopy to prove the successful synthesis. Moreover, the comprehensive performances, including photothermal conversion, water absorbency, water retention, and controlled-release agrochemicals behaviors, were systematically investigated. The results indicated that the composite microsphere was a prosperous water and agrochemicals manager to effectively retain water and control the release of agrochemicals by external stimulation. Consequently, the Ca-alginate/PNIPAm@PDA microsphere with outstanding water-retention and controlled-release capacities is economical and eco-friendly and thus is promising for utilization as water and agrochemicals controlled-release carrier material in agriculture applications.

Double-layer cellulose hydrogel solar steam generation for high-efficiency desalination.

Solar steam generation is one of the most promising technologies for desalination. In order to further promote the development of solar steam generation, a double-layer cellulose hydrogel (DCH) was designed and used as solar steam generation for seawater desalination. Under one sun illumination intensity (1 kW·m-2), the average evaporation rate and the steam evaporation efficiency reaches 1.582 kg·m-2 h-1 and 91.4 %, respectively. The durability test was performed to verify the long-time durability and antifouling property. Outdoor experiment was carried out to prove the high steam evaporation efficiency and desalination performance of DCH. This paves a way for the cellulose-based hydrogel as a biodegradable, low-cost and promising solar steam generation.

Focused characteristics and effects of light reflected from spherical lipid membrane of giant unilamellar vesicles.

Lipid vesicle is spherical membranous structure with a concave surface on the inside. When a beam of light illuminates a lipid vesicle, the light reflected from the vesicular concave membrane can be focused to have higher intensity and generate enhanced effects. By observing and simulating light reflected from giant unilamellar vesicles (GUVs), the intensity distribution of the light reflected from a spherical concave lipid membrane was investigated. The reflected light had focused characteristics. Its intensity was concentrated 10,000 times and even exceeded the intensity of incident light in a confined region, creating another effective light source in the lipid vesicle. The fluorescence quenching of sulfo-Cy5 encapsulated in spherical GUVs was stronger than that of the outside solution when irradiated by a 632.8 nm laser. When irradiated with ultraviolet light C (UVC), the damage to plasmid DNA encapsulated with spherical GUVs was greater than that of pure plasmid DNA solution and plasmid DNA mixed with lipid membrane fragments. Therefore, in addition to the effects of incident light, the focused light reflected from GUVs could generate incremental effects on encapsulated photoreactive materials if the spherical structure of the lipid membrane was maintained. These results proved that concave lipid membranes of spherical vesicles can focus light and utilize it to generate enhanced effects. The capability of light focusing and its influence on DNA may provide new insights for understanding the function of lipid membranes in cellular life.

Preparation and characterization of temperature-responsive capillary electrochromatographic column using poly(N-isopropylacrylamide).

Poly(N-isopropylacrylamide) is a temperature-responsive polymer, which is hydrophilic at low temperature but hydrophobic at high temperature. Using this characteristic, the polymer was bonded to the inner surface of fused-silica capillary to prepare a temperature-responsive column to study the separation behavior in electrochromatography.

Recent advances in the construction of functionalized covalent organic frameworks and their applications to sensing.

Covalent organic frameworks (COFs), as an emerging class of porous crystalline polymers, are built by the combination of the light elements through the strong covalent bonds. In the past decade, COFs have been reported to show plenty of unique properties (such as ordered channels, large specific surface area, highly tunable porosity, optional building blocks, predictable and stable structure, and abundant functional groups), and have been widely applied in multiple fields. Recently, to further improve the potential performances of COFs and extend their applicability, a number of COFs with various functionalities have been successfully developed through the functionalization modification. In this review, we summarized the advanced design and construction of functionalized COFs, including COFs with post-synthetic modification, COFs-based composites (e.g. COFs-metal nanoparticles composites, COFs-metal oxide nanoparticles composites, COFs-MOFs composites, and COFs-enzyme composites), and molecularly imprinted COFs. Impressively, the applications of functionalized COFs to sensing also have been comprehensively summarized, including colorimetric sensing, fluorescent sensing, electrochemical sensing, and other sensing (such as quartz crystal microbalance (QCM) sensing, photoelectrochemical sensing, and humidity sensing). In the end, future opportunities and challenges in this promising field are tentatively proposed.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

Start-up of completely autotrophic nitrogen removal over nitrite enhanced by hydrophilic-modified carbon fiber.

In order to assess the effects of the surface hydrophilicity of supports on the biofilm formation and evaluate the performance of completely autotrophic nitrogen removal over nitrite (CANON) process in a sequencing batch biofilm reactor (SBBR), unmodified activity carbon fibers (ACFs) and ACFs hydrophilic modified by heat treatment were used as supports. CANON process was initiated in a SBBR from conventional activated sludge. An operation temperature of 32 ± 2 °C, dissolved oxygen (DO) level at 1.5 mg L⁻¹ and free ammonia (FA) concentration with 3.98-15.93 mg L⁻¹ were maintained in the SBBR. Fourier transform infrared (FT-IR) spectra and Boehm's neutralizing titration exhibited that modified ACFs had more oxygen-containing groups than unmodified ACFs. Larger biofilm growth on the modified surfaces examined by scanning electron microscopy and biofilm's total dry weight, and the biofilm on the modified surfaces were more active, compared with those on the unmodified surfaces. This study demonstrates the hydrophilic-modified ACFs have better biological affinity than unmodified ACFs. Maximal total nitrogen removal rate of 0.088 k g N m⁻³ day⁻¹ was achieved for the CANON process on day 80, indicating the CANON process was successfully started up. Apart from supports, the strategies of DO supplying and controlling FA concentration were also keys in starting up the CANON process within a shorter period.