A 3D porous polymer monolith-based platform integrated in poly(dimethylsiloxane) microchips for immunoassay.

In this work, we demonstrate the immunocapture and on-line fluorescence immunoassay of protein and virus based on porous polymer monoliths (PPM) in microfluidic devices. Poly(glycidyl methacrylate-co-ethylene glycol dimethacrylate) [poly(GMA-co-EGDMA)] monoliths were successfully synthesized in the polydimethylsiloxane (PDMS) microfluidic channels by in situ UV-initiated free radical polymerization. After surface modification, PPM provides a high-surface area and specific affinity 3D substrate for immunoassays. Combining with well controlled microfluidic devices, the direct immunoassay of IgG and sandwich immunoassay of inactivated H1N1 influenza virus using 5 µL sample has been accomplished, with detection limits of 4 ng mL(-1) and less than 10 pg mL(-1), respectively. The enhanced detection sensitivity is due to both high surface area of PPM and flow-through design. The detection time was obviously decreased mainly due to the shortened diffusion distance and improved convective mass transfer inside the monolith, which accelerates the reaction kinetics between antigen and antibody. This work provides a novel microfluidic immunoassay platform with high efficiency thereby enabling fast and sensitive immunoassay.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

Start-up of completely autotrophic nitrogen removal over nitrite enhanced by hydrophilic-modified carbon fiber.

In order to assess the effects of the surface hydrophilicity of supports on the biofilm formation and evaluate the performance of completely autotrophic nitrogen removal over nitrite (CANON) process in a sequencing batch biofilm reactor (SBBR), unmodified activity carbon fibers (ACFs) and ACFs hydrophilic modified by heat treatment were used as supports. CANON process was initiated in a SBBR from conventional activated sludge. An operation temperature of 32 ± 2 °C, dissolved oxygen (DO) level at 1.5 mg L⁻¹ and free ammonia (FA) concentration with 3.98-15.93 mg L⁻¹ were maintained in the SBBR. Fourier transform infrared (FT-IR) spectra and Boehm's neutralizing titration exhibited that modified ACFs had more oxygen-containing groups than unmodified ACFs. Larger biofilm growth on the modified surfaces examined by scanning electron microscopy and biofilm's total dry weight, and the biofilm on the modified surfaces were more active, compared with those on the unmodified surfaces. This study demonstrates the hydrophilic-modified ACFs have better biological affinity than unmodified ACFs. Maximal total nitrogen removal rate of 0.088 k g N m⁻³ day⁻¹ was achieved for the CANON process on day 80, indicating the CANON process was successfully started up. Apart from supports, the strategies of DO supplying and controlling FA concentration were also keys in starting up the CANON process within a shorter period.