GmNAC039 and GmNAC018 activate the expression of cysteine protease genes to promote soybean nodule senescence.

Root nodules are major sources of nitrogen for soybean (Glycine max (L.) Merr.) growth, development, production, and seed quality. Symbiotic nitrogen fixation is time-limited, as the root nodule senesces during the reproductive stage of plant development, specifically during seed development. Nodule senescence is characterized by the induction of senescence-related genes, such as papain-like cysteine proteases (CYPs), which ultimately leads to the degradation of both bacteroids and plant cells. However, how nodule senescence-related genes are activated in soybean is unknown. Here, we identified 2 paralogous NAC transcription factors, GmNAC039 and GmNAC018, as master regulators of nodule senescence. Overexpression of either gene induced soybean nodule senescence with increased cell death as detected using a TUNEL assay, whereas their knockout delayed senescence and increased nitrogenase activity. Transcriptome analysis and nCUT&Tag-qPCR assays revealed that GmNAC039 directly binds to the core motif CAC(A)A and activates the expression of 4 GmCYP genes (GmCYP35, GmCYP37, GmCYP39, and GmCYP45). Similar to GmNAC039 and GmNAC018, overexpression or knockout of GmCYP genes in nodules resulted in precocious or delayed senescence, respectively. These data provide essential insights into the regulatory mechanisms of nodule senescence, in which GmNAC039 and GmNAC018 directly activate the expression of GmCYP genes to promote nodule senescence.

Dynamics of cis-regulatory sequences and transcriptional divergence of duplicated genes in soybean.

Transcriptional divergence of duplicated genes after whole genome duplication (WGD) has been described in many plant lineages and is often associated with subgenome dominance, a genome-wide mechanism. However, it is unknown what underlies the transcriptional divergence of duplicated genes in polyploid species that lack subgenome dominance. Soybean is a paleotetraploid with a WGD that occurred 5 to 13 Mya. Approximately 50% of the duplicated genes retained from this WGD exhibit transcriptional divergence. We developed accessible chromatin region (ACR) datasets from leaf, flower, and seed tissues using MNase-hypersensitivity sequencing. We validated enhancer function of several ACRs associated with known genes using CRISPR/Cas9-mediated genome editing. The ACR datasets were used to examine and correlate the transcriptional patterns of 17,111 pairs of duplicated genes in different tissues. We demonstrate that ACR dynamics are correlated with divergence of both expression level and tissue specificity of individual gene pairs. Gain or loss of flanking ACRs and mutation of cis-regulatory elements (CREs) within the ACRs can change the balance of the expression level and/or tissue specificity of the duplicated genes. Analysis of DNA sequences associated with ACRs revealed that the extensive sequence rearrangement after the WGD reshaped the CRE landscape, which appears to play a key role in the transcriptional divergence of duplicated genes in soybean. This may represent a general mechanism for transcriptional divergence of duplicated genes in polyploids that lack subgenome dominance.

Isolation and Identification of Salinity-Tolerant Rhizobia and Nodulation Phenotype Analysis in Different Soybean Germplasms.

Increasing the soybean-planting area and increasing the soybean yield per unit area are two effective solutions to improve the overall soybean yield. Northeast China has a large saline soil area, and if soybeans could be grown there with the help of isolated saline-tolerant rhizobia, the soybean cultivation area in China could be effectively expanded. In this study, soybeans were planted in soils at different latitudes in China, and four strains of rhizobia were isolated and identified from the soybean nodules. According to the latitudes of the soil-sampling sites from high to low, the four isolated strains were identified as HLNEAU1, HLNEAU2, HLNEAU3, and HLNEAU4. In this study, the isolated strains were identified for their resistances, and their acid and saline tolerances and nitrogen fixation capacities were preliminarily identified. Ten representative soybean germplasm resources in Northeast China were inoculated with these four strains, and the compatibilities of these four rhizobium strains with the soybean germplasm resources were analyzed. All four isolates were able to establish different extents of compatibility with 10 soybean resources. Hefeng 50 had good compatibility with the four isolated strains, while Suinong 14 showed the best compatibility with HLNEAU2. The isolated rhizobacteria could successfully establish symbiosis with the soybeans, but host specificity was also present. This study was a preliminary exploration of the use of salinity-tolerant rhizobacteria to help the soybean nitrogen fixation in saline soils in order to increase the soybean acreage, and it provides a valuable theoretical basis for the application of saline-tolerant rhizobia.

Natural variation in Fatty Acid 9 is a determinant of fatty acid and protein content.

Soybean is one of the most economically important crops worldwide and an important source of unsaturated fatty acids and protein for the human diet. Consumer demand for healthy fats and oils is increasing, and the global demand for vegetable oil is expected to double by 2050. Identification of key genes that regulate seed fatty acid content can facilitate molecular breeding of high-quality soybean varieties with enhanced fatty acid profiles. Here, we analysed the genetic architecture underlying variations in soybean seed fatty acid content using 547 accessions, including mainly landraces and cultivars from northeastern China. Through fatty acid profiling, genome re-sequencing, population genomics analyses, and GWAS, we identified a SEIPIN homologue at the FA9 locus as an important contributor to seed fatty acid content. Transgenic and multiomics analyses confirmed that FA9 was a key regulator of seed fatty acid content with pleiotropic effects on seed protein and seed size. We identified two major FA9 haplotypes in 1295 resequenced soybean accessions and assessed their phenotypic effects in a field planting of 424 accessions. Soybean accessions carrying FA9H2 had significantly higher total fatty acid contents and lower protein contents than those carrying FA9H1 . FA9H2 was absent in wild soybeans but present in 13% of landraces and 26% of cultivars, suggesting that it may have been selected during soybean post-domestication improvement. FA9 therefore represents a useful genetic resource for molecular breeding of high-quality soybean varieties with specific seed storage profiles.

Single-Cell RNA-Sequencing of Soybean Reveals Transcriptional Changes and Antiviral Functions of GmGSTU23 and GmGSTU24 in Response to Soybean Mosaic Virus.

Soybean mosaic virus (SMV) stands as a prominent and widespread threat to soybean (Glycine max L. Merr.), the foremost legume crop globally. Attaining a thorough comprehension of the alterations in the transcriptional network of soybeans in response to SMV infection is imperative for a profound insight into the mechanisms of viral pathogenicity and host resistance. In this investigation, we isolated 50 294 protoplasts from the newly developed leaves of soybean plants subjected to both SMV infection and mock inoculation. Subsequently, we utilized single-cell RNA sequencing (scRNA-seq) to construct the transcriptional landscape at a single-cell resolution. Nineteen distinct cell clusters were identified based on the transcriptomic profiles of scRNA-seq. The annotation of three cell types-epidermal cells, mesophyll cells, and vascular cells-was established based on the expression of orthologs to reported marker genes in Arabidopsis thaliana. The differentially expressed genes between the SMV- and mock-inoculated samples were analyzed for different cell types. Our investigation delved deeper into the tau class of glutathione S-transferases (GSTUs), known for their significant contributions to plant responses against abiotic and biotic stress. A total of 57 GSTU genes were identified by a thorough genome-wide investigation in the soybean genome G. max Wm82.a4.v1. Two specific candidates, GmGSTU23 and GmGSTU24, exhibited distinct upregulation in all three cell types in response to SMV infection, prompting their selection for further research. The transient overexpression of GmGSTU23 or GmGSTU24 in Nicotiana benthamiana resulted in the inhibition of SMV infection, indicating the antiviral function of soybean GSTU proteins.

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Tandem mass tag-based proteomics reveals the antiepileptic mechanism of steroidal saponins from Anemarrhena asphodeloides in Kainic acid induced epileptic rat model.

Epilepsy (EP) is one of the most common neurological diseases in the world. Anemarrhena asphodeloides Bunge. (AA), as a typical heat-cleaning medicine, has been proven to possess the antiepileptic effect in clinical and experimental studies. Anemarrhena asphodeloides steroidal saponins (AAS) are main components. However, the therapeutic effects and underlying mechanisms of AAS against EP are not been fully elucidated. In this study, 63 steroidal saponins were discovered in AAS by UPLC-Q-TOF/MS analysis. Pharmacological and behavioral analysis demonstrated that AAS could significantly lower the Racine classification and reduce the frequency of generalized spike rhythm the rate of tetanic seizures in kainic acid-induced epileptic rats. Hematoxylin and eosin and Nissl staining-indicated AAS could significantly improve hippocampal injury and neuron loss in epileptic rats. TMT proteomic analysis discovered 26 different expressed proteins (DEPs), which were identified as the rescue proteins. After bioinformatic analysis, Heat Shock Protein 90 Alpha Family Class B Member 1 (Hsp90ab1) and Tyrosine 3-Monooxygenase (Ywhab) were screened as key DEPs and verified by western blotting. AAS could significantly inhibited the up-regulation of Hsp90ab1 and Ywhab in EP rats; these two proteins might be the key targets of AAS in treating EP.

Genetic Analysis of Soybean Flower Size Phenotypes Based on Computer Vision and Genome-Wide Association Studies.

The dimensions of organs such as flowers, leaves, and seeds are governed by processes of cellular proliferation and expansion. In soybeans, the dimensions of these organs exhibit a strong correlation with crop yield, quality, and other phenotypic traits. Nevertheless, there exists a scarcity of research concerning the regulatory genes influencing flower size, particularly within the soybean species. In this study, 309 samples of 3 soybean types (123 cultivar, 90 landrace, and 96 wild) were re-sequenced. The microscopic phenotype of soybean flower organs was photographed using a three-eye microscope, and the phenotypic data were extracted by means of computer vision. Pearson correlation analysis was employed to assess the relationship between petal and seed phenotypes, revealing a strong correlation between the sizes of these two organs. Through GWASs, SNP loci significantly associated with flower organ size were identified. Subsequently, haplotype analysis was conducted to screen for upstream and downstream genes of these loci, thereby identifying potential candidate genes. In total, 77 significant SNPs associated with vexil petals, 562 significant SNPs associated with wing petals, and 34 significant SNPs associated with keel petals were found. Candidate genes were screened by candidate sites, and haplotype analysis was performed on the candidate genes. Finally, the present investigation yielded 25 and 10 genes of notable significance through haplotype analysis in the vexil and wing regions, respectively. Notably, Glyma.07G234200, previously documented for its high expression across various plant organs, including flowers, pods, leaves, roots, and seeds, was among these identified genes. The research contributes novel insights to soybean breeding endeavors, particularly in the exploration of genes governing organ development, the selection of field materials, and the enhancement of crop yield. It played a role in the process of material selection during the growth period and further accelerated the process of soybean breeding material selection.

QTL Mapping and Data Mining to Identify Genes Associated with Soybean Epicotyl Length Using Cultivated Soybean and Wild Soybean.

Soybean (Glycine max) plants first emerged in China, and they have since been established as an economically important oil crop and a major source of daily protein for individuals throughout the world. Seed emergence height is the first factor that ensures seedling adaptability to field management practices, and it is closely related to epicotyl length. In the present study, the Suinong 14 and ZYD00006 soybean lines were used as parents to construct chromosome segment substitution lines (CSSLs) for quantitative trait loci (QTL) identification. Seven QTLs were identified using two years of epicotyl length measurement data. The insertion region of the ZYD00006 fragment was identified through whole genome resequencing, with candidate gene screening and validation being performed through RNA-Seq and qPCR, and Glyma.08G142400 was ultimately selected as an epicotyl length-related gene. Through combined analyses of phenotypic data from the study population, Glyma.08G142400 expression was found to be elevated in those varieties exhibiting longer epicotyl length. Haplotype data analyses revealed that epicotyl data were consistent with haplotype typing. In summary, the QTLs found to be associated with the epicotyl length identified herein provide a valuable foundation for future molecular marker-assisted breeding efforts aimed at improving soybean emergence height in the field, with the Glyma.08G142400 gene serving as a regulator of epicotyl length, offering new insight into the mechanisms that govern epicotyl development.

Multi-Omics Analysis of a Chromosome Segment Substitution Line Reveals a New Regulation Network for Soybean Seed Storage Profile.

Soybean, a major source of oil and protein, has seen an annual increase in consumption when used in soybean-derived products and the broadening of its cultivation range. The demand for soybean necessitates a better understanding of the regulatory networks driving storage protein accumulation and oil biosynthesis to broaden its positive impact on human health. In this study, we selected a chromosome segment substitution line (CSSL) with high protein and low oil contents to investigate the underlying effect of donor introgression on seed storage through multi-omics analysis. In total, 1479 differentially expressed genes (DEGs), 82 differentially expressed proteins (DEPs), and 34 differentially expressed metabolites (DEMs) were identified in the CSSL compared to the recurrent parent. Based on Gene Ontology (GO) term analysis and the Kyoto Encyclopedia of Genes and Genomes enrichment (KEGG), integrated analysis indicated that 31 DEGs, 24 DEPs, and 13 DEMs were related to seed storage functionality. Integrated analysis further showed a significant decrease in the contents of the seed storage lipids LysoPG 16:0 and LysoPC 18:4 as well as an increase in the contents of organic acids such as L-malic acid. Taken together, these results offer new insights into the molecular mechanisms of seed storage and provide guidance for the molecular breeding of new favorable soybean varieties.

A highly efficient soybean transformation system using GRF3-GIF1 chimeric protein.

Expression of GRF3-GIF1 chimera significantly enhanced regeneration and transformation efficiency in soybean, increasing the number of transformable cultivars. Moreover, GmGRF3-GIF1 can be combined with CRISPR/Cas9 for highly effective gene editing.

CBX3 promotes clear cell renal carcinoma through PI3K/AKT activation and aberrant immunity.

BACKGROUND: A chromobox homologue 3 (CBX3) is elevated in various cancers and significantly contributes to the promotion of malignant behavior; despite this, its exact involvement in clear cell renal cell carcinoma (ccRCC) is yet unknown. METHODS: The Cancer Genome Atlas database served to evaluate CBX3 production and its connection to survival in patients with ccRCC. Our team evaluated the effects of knockdown of CBX3 levels in ccRCC cell populations using in vitro together with in vivo models. CBX3, proteins related to death, and epithelial-to-mesenchymal transition (EMT)-related proteins were measured in ccRCC cells using western blotting and immunohistochemical assays. Through the analysis of Kyoto Encyclopedia of Genes and Genomes (KEGG) and GeneOntology (GO) and Gene Set Enrichment Analysis (GSEA), the biological processes and signal pathways related to CBX3 expression were identified. Immune-related activity reduced by CBX3 was assessed using various online tools. RESULTS: Both genomic and protein expression showed that CBX3 was upregulated in ccRCC. Further functional analyses revealed that CBX3 played a crucial role in enhancing cell growth, migration, and EMT in vitro along with in vivo. Moreover, the study results provided distinct mechanistic evidence that CBX3 exerts its pathological functions in ccRCC by activating the PI3K/AKT pathway. Finally, immunoassays revealed that CBX3, a possible biomarker of ccRCC, was significantly associated with immunity. CONCLUSIONS: Our results suggest that the overexpression of CBX3 promotes ccRCC advancement through PI3K/AKT activation and even immunological dysregulation, making it a potentially viable and beneficial therapeutic target.

Parallel selection of loss-of-function alleles of Pdh1 orthologous genes in warm-season legumes for pod indehiscence and plasticity is related to precipitation.

Pod dehiscence facilitates seed dispersal in wild legumes but results in yield loss in cultivated legumes. The evolutionary genetics of the legume pod dehiscence trait remain largely elusive. We characterized the pod dehiscence of chromosome segment substitution lines of Glycine max crossed with Glycine soja and found that the gene underlying the predominant quantitative trait locus (QTL) of soybean pod-shattering trait was Pod dehiscence 1 (Pdh1). A few rare loss-of-function (LoF) Pdh1 alleles were identified in G. soja, while only an allele featuring a premature stop codon was selected for pod indehiscence in cultivated soybean and spread to low-precipitation regions with increased frequency. Moreover, correlated interactions among Pdh1's haplotype, gene expression, and environmental changes for the developmental plasticity of the pod dehiscence trait were revealed in G. max. We found that orthologous Pdh1 genes specifically originated in warm-season legumes and their LoF alleles were then parallel-selected during the domestication of legume crops. Our results provide insights into the convergent evolution of pod dehiscence in warm-season legumes, facilitate an understanding of the intricate interactions between genetic robustness and environmental adaptation for developmental plasticity, and guide the breeding of new legume varieties with pod indehiscence.

A novel compound heterozygous PEX1 variant in Heimler syndrome.

Heimler syndrome (HS) is a rare autosomal recessive hereditary disease that is caused by biallelic variants in peroxisomal biogenic factor 1 gene (PEX1), peroxisomal biogenic factor 6 gene (PEX6) or peroxisomal biogenic factor 26 gene (PEX26), resulting in intracellular peroxisomal dysfunction (PBDs). We report a patient with HS with a new compound heterozygous PEX1 variant. Exon sequencing was used to screen pathologic variants in the patient. Retinal characteristics and serum metabolome alterations were evaluated. Scanning laser ophthalmoscope showed a large area of retinal choroidal atrophy at the posterior pole of the retina, with scattered patchy subretinal pigmentation. Optical coherence tomography showed fovea atrophy accompanied by retinal retinoschisis in the right eye and macular retinoschisis and edema in the left eye. The electroretinogram showed obviously reduced amplitudes of a-waves and b-waves under photopic and scotopic conditions in both eyes. Visual field tests showed a reduced central visual field in both eyes. Exon sequencing identified the compound heterozygous variant including c.2966T > C and c.1670+1G > T of the PEX1 gene, with the latter being novel. Nontargeted determination of total lipid metabolites and targeted determination of medium- and long-chain fatty acids in the serum of the patient and his healthy sibling were tested. This study identified a new compound heterozygous PEX1 variant, expanding our understanding of phenotypes in HS.

The impact of GmTSA and GmALS on soybean salt tolerance: uncovering the molecular landscape of amino acid and secondary metabolism pathways.

KEY MESSAGE: GmTSA and GmALS were screened out for salt stress in soybean and explore the poteintial amino acid secondary metabolism pathways. Soybean (Glycine max L.) is an oil and protein crop of global importance, and salinity has significant effects on soybean growth. Here, a population of soybean chromosome segment substitution lines was screened to identify highly salt-tolerant lines. In total, 24 quantitative trait loci (QTLs) on seven chromosomes were associated with salt tolerance, and CSSL_R71 was selected for further analysis. Although numerous genes were differentially expressed in CSSL_R71 in response to salt statically no differently, transcript levels of classical salt-response genes, including those of the salt overly sensitive pathway. Rather, salt tolerance in CSSL_R71 was associated with changes in amino acid and lipid metabolism. In particular, changes in p-coumaric acid, shikimic acid, and pyrrole-2-carboxylic acid levels accompanied salt tolerance in CSSL_R71. Eleven differentially expressed genes (DEGs) related to amino acid and secondary metabolism were identified as candidate genes on the substituted chromosome fragment. Six of these showed differences in coding sequence between the parental genotypes. Crucially, overexpression of GmTSA (Glyma.03G158400, tryptophan synthase) significantly enhanced salt tolerance in soybean hairy roots, whereas overexpression of GmALS (Glyma.13G241000, acetolactate synthase) decreased salt tolerance. Two KASP markers were developed for GmALS and used to genotype salt-tolerant and salt-sensitive lines in the CSSL population. Non-synonymous mutations were directly associated with salt tolerance. Taken together, these data provide evidence that changes in amino acid and secondary metabolism have the potential to confer salt tolerance in soybean.

Detection of type III effector-induced transcription factors that regulate phytohormone content during symbiosis establishment in soybean.

Soybean is a pivotal protein and oil crop that utilizes atmospheric nitrogen via symbiosis with rhizobium soil bacteria. Rhizobial type III effectors (T3Es) are essential regulators during symbiosis establishment. However, how the transcription factors involved in the interaction between phytohormone synthesis and type III effectors are connected is unclear. To detect the responses of phytohormone and transcription factor genes to rhizobial type III effector NopAA and type III secretion system, the candidate genes underlying soybean symbiosis were identified using RNA sequencing (RNA-seq) and phytohormone content analysis of soybean roots infected with wild-type Rhizobium and its derived T3E mutant. Via RNA-seq analysis the WRKY and ERF transcription factor families were identified as the most differentially expressed factors in the T3E mutant compared with the wild-type. Next, qRT-PCR was used to confirm the candidate genes Glyma.09g282900, Glyma.08g018300, Glyma.18g238200, Glyma.03g116300, Glyma.07g246600, Glyma.16g172400 induced by S. fredii HH103, S. fredii HH103ΩNopAA, and S. fredii HH103ΩRhcN. Since the WRKY and ERF families may regulate abscisic acid (ABA) content and underlying nodule formation, we performed phytohormone content analysis at 0.5 and 24 h post-inoculation (hpi). A significant change in ABA content was found between wild Rhizobium and type III effector mutant. Our results support that NopAA can promote the establishment of symbiosis by affecting the ABA signaling pathways by regulating WRKY and ERF which regulate the phytohormone signaling pathway. Specifically, our work provides insights into a signaling interaction of prokaryotic effector-induced phytohormone response involved in host signaling that regulates the establishment of symbiosis and increases nitrogen utilization efficiency in soybean plants.

NopC/T/L Signal Crosstalk Gene GmPHT1-4.

Symbiotic nodulation between leguminous plants and rhizobia is a critical biological interaction. The type III secretion system (T3SS) employed by rhizobia manipulates the host's nodulation signaling, analogous to mechanisms used by certain bacterial pathogens for effector protein delivery into host cells. This investigation explores the interactive signaling among type III effectors HH103ΩNopC, HH103ΩNopT, and HH103ΩNopL from SinoRhizobium fredii HH103. Experimental results revealed that these effectors positively regulate nodule formation. Transcriptomic analysis pinpointed GmPHT1-4 as the key gene facilitating this effector-mediated signaling. Overexpression of GmPHT1-4 enhances nodulation, indicating a dual function in nodulation and phosphorus homeostasis. This research elucidates the intricate regulatory network governing Rhizobium-soybean (Glycine max (L.) Merr) interactions and the complex interplay between type III effectors.

Identifications of QTLs and Candidate Genes Associated with Pseudomonas syringae Responses in Cultivated Soybean (Glycine max) and Wild Soybean (Glycine soja).

Soybeans (Glycine max) are a key food crop, serving as a valuable source of both oil and plant-derived protein. Pseudomonas syringae pv. glycinea (Psg) is among the most aggressive and prevalent pathogens affecting soybean production, causing a form of bacterial spot disease that impacts soybean leaves and thereby reduces crop yields. In this study, 310 natural soybean varieties were screened for Psg resistance and susceptibility. The identified susceptible and resistant varieties were then used for linkage mapping, BSA-seq, and whole genome sequencing (WGS) analyses aimed at identifying key QTLs associated with Psg responses. Candidate Psg-related genes were further confirmed through WGS and qPCR analyses. Candidate gene haplotype analyses were used to explore the associations between haplotypes and soybean Psg resistance. In addition, landrace and wild soybean plants were found to exhibit a higher degree of Psg resistance as compared to cultivated soybean varieties. In total, 10 QTLs were identified using chromosome segment substitution lines derived from Suinong14 (cultivated soybean) and ZYD00006 (wild soybean). Glyma.10g230200 was found to be induced in response to Psg, with the Glyma.10g230200 haplotype corresponding to soybean disease resistance. The QTLs identified herein can be leveraged to guide the marker-assisted breeding of soybean cultivars that exhibit partial resistance to Psg. Moreover, further functional and molecular studies of Glyma.10g230200 have the potential to offer insight into the mechanistic basis for soybean Psg resistance.

Identifying the Soybean microRNAs Related to Phytophthora sojae Based on RNA Sequencing and Bioinformatics Analysis.

Phytophthora root rot in soybeans is caused by a pathogen called Phytophthora sojae (P. sojae), which results in a significant decrease in soybean production within affected regions. MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that play a key post-transcriptional regulatory role in eukaryotes. In this paper, the miRNAs that respond to P. sojae were analyzed from the gene level to complement the study of molecular resistance mechanisms in soybean. The study utilized high-throughput sequencing of soybean data to predict miRNAs that respond to P. sojae, analyze their specific functions, and verify regulatory relationships using qRT-PCR. The results showed that the miRNAs in soybean respond to P. sojae infection. MiRNAs can be transcribed independently, suggesting the presence of transcription factor binding sites in the promoter regions. Additionally, we performed an evolutionary analysis on conserved miRNAs that respond to P. sojae. Finally, we investigated the regulatory relationships among miRNAs, genes, and transcription factors, and identified five regulatory patterns. These findings lay the groundwork for future studies on the evolution of miRNAs responsive to P. sojae.

NopAA and NopD Signaling Association-Related Gene GmNAC27 Promotes Nodulation in Soybean (Glycine max).

Rhizobia secrete effectors that are essential for the effective establishment of their symbiotic interactions with leguminous host plants. However, the signaling pathways governing rhizobial type III effectors have yet to be sufficiently characterized. In the present study, the type III effectors, NopAA and NopD, which perhaps have signaling pathway crosstalk in the regulation of plant defense responses, have been studied together for the first time during nodulation. Initial qRT-PCR experiments were used to explore the impact of NopAA and NopD on marker genes associated with symbiosis and defense responses. The effects of these effectors on nodulation were then assessed by generating bacteria in which both NopAA and NopD were mutated. RNA-sequencing analyses of soybean roots were further utilized to assess signaling crosstalk between NopAA and NopD. NopAA mutant and NopD mutant were both found to repress GmPR1, GmPR2, and GmPR5 expression in these roots. The two mutants also significantly reduced nodules dry weight and the number of nodules and infection threads, although these changes were not significantly different from those observed following inoculation with double-mutant (HH103ΩNopAA&NopD). NopAA and NopD co-mutant inoculation was primarily found to impact the plant-pathogen interaction pathway. Common differentially expressed genes (DEGs) associated with both NopAA and NopD were enriched in the plant-pathogen interaction, plant hormone signal transduction, and MAPK signaling pathways, and no further changes in these common DEGs were noted in response to inoculation with HH103ΩNopAA&NopD. Glyma.13G279900 (GmNAC27) was ultimately identified as being significantly upregulated in the context of HH103ΩNopAA&NopD inoculation, serving as a positive regulator of nodulation. These results provide new insight into the synergistic impact that specific effectors can have on the establishment of symbiosis and the responses of host plant proteins.