Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 187
Filtrar
Más filtros

Banco de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Biochem Biophys Res Commun ; 692: 149325, 2024 Jan 15.
Artículo en Inglés | MEDLINE | ID: mdl-38056161

RESUMEN

BACKGROUND: Protein S-palmitoylation is a reversible posttranslational modification widely involved in tumor progression. Nevertheless, the function of palmitoylation metabolism in prognosis and tumor microenvironment characteristics in liver hepatocellular carcinoma (LIHC) patients is not fully understood. METHODS: mRNA and clinical data of LIHC patients were obtained from the TCGA and ICGC databases. Consensus clustering was used to construct palmitoylation metabolism-related clusters. Univariate Cox and Lasso regression analyses were employed to establish a palmitoylation metabolism-related signature (PMS). ssGSEA was applied to evaluate the immune cell score in each LIHC sample. Functional enrichments were accessed through GO, KEGG and GSVA. Drug sensitivity data were downloaded from the GDSC database. RESULTS: Three palmitoylation metabolism-related clusters with different prognostic and immune infiltration characteristics were constructed in LIHC. We identified PMS with distinct survival, clinical, and tumor immune microenvironment characteristics. The high PMS group had a poorer prognosis, higher infiltration of immunosuppressive cells and higher expression of immune checkpoints. ZDHHC20 exerted a tumor-promoting role in LIHC and was significantly associated with immunosuppressive cells and immunosuppressive checkpoints. Additionally, in HepG-2 and SMCC-7721 cells, si-ZDHHC20 boosted apoptosis but decreased proliferation and migration when compared to si-NC. CONCLUSION: Our research revealed that PMS may accurately predict the prognosis and immune characteristics of LIHC patients. ZDHHC20 has significant clinical and immune relevance in LIHC and may contribute to the formulation of new targets for LIHC immunotherapy.


Asunto(s)
Carcinoma Hepatocelular , Neoplasias Hepáticas , Humanos , Carcinoma Hepatocelular/genética , Lipoilación , Neoplasias Hepáticas/genética , Apoptosis , Inmunosupresores , Microambiente Tumoral
2.
Biochem Biophys Res Commun ; 695: 149401, 2024 Feb 05.
Artículo en Inglés | MEDLINE | ID: mdl-38154264

RESUMEN

Human calcium sensing receptor (CaSR) senses calcium ion concentrations in vivo and is an important class of drug targets. Mutations in the receptor can lead to disorders of calcium homeostasis, including hypercalcemia and hypocalcemia. Here, 127 CaSR-targeted nanobodies were generated from camels, and four nanobodies with inhibitory function were further identified. Among these nanobodies, NB32 can effectively inhibit the mobilization of intracellular calcium ions (Ca2+i) and suppress the G12/13 and ERK1/2 signaling pathways downstream of CaSR. Moreover, it enhanced the inhibitory effect of the calcilytics as a negative allosteric modulator (NAM). We determined the structure of complex and found NB32 bound to LB2 (Ligand-binding 2) domain of CaSR to prevent the interaction of LB2 domains of two protomers to stabilize the inactive state of CaSR.


Asunto(s)
Hipercalcemia , Hipocalcemia , Anticuerpos de Dominio Único , Humanos , Receptores Sensibles al Calcio/metabolismo , Calcio/metabolismo , Hipocalcemia/genética , Hipercalcemia/genética
3.
J Res Adolesc ; 2024 Mar 13.
Artículo en Inglés | MEDLINE | ID: mdl-38480475

RESUMEN

Adolescents' family obligation is a cultural strength that shows enduring prevalence in China. Given that the meaning of family obligation has undergone rapid changes in recent decades, it is crucial to examine the role of family obligation in adolescent adjustment in contemporary China. More importantly, although past research has investigated the consequences of family obligation on adolescents' adjustment, little is known about the antecedents of Chinese adolescents' family obligation. Using a two-wave longitudinal sample of 450 Chinese adolescents (mean age = 13.78 years, SD = .71 years; 49% female) and their parents, the current research explored two questions. First, this study examined the role of family obligation in adolescents' academic achievement, externalizing problems, and internalizing problems over early adolescence. Second, this study explored the role of parents in predicting Chinese adolescents' family obligation, specifically whether parental expectations or parental acceptance was predictive of adolescents' family obligation over time. Third, this study investigated whether family obligation is an underlying mechanism between parenting and Chinese adolescents' adjustment. Results showed that Chinese adolescents' family obligation was longitudinally associated with increased academic achievement and reduced externalizing problems. Moreover, perceived parental acceptance, but not parental expectations, was longitudinally associated with Chinese adolescents' greater family obligation. Notably, family obligation mediated the longitudinal effect of parental acceptance on Chinese adolescents' externalizing problems. By studying both the consequences and antecedents of Chinese adolescents' family obligation, this study helps provide a comprehensive understanding of this cultural strength.

4.
J Environ Manage ; 358: 120911, 2024 May.
Artículo en Inglés | MEDLINE | ID: mdl-38631164

RESUMEN

Dissolved organic matter (DOM) is important in determining the drinking water treatment and the supplied water quality. However, a comprehensive DOM study for the whole water supply system is lacking and the potential effects of secondary water supply are largely unknown. This was studied using dissolved organic carbon (DOC), absorption spectroscopy, and fluorescence excitation-emission matrices-parallel factor analysis (EEM-PARAFAC). Four fluorescent components were identified, including humic-like C1-C2, tryptophan-like C3, and tyrosine-like C4. In the drinking water treatment plants, the advanced treatment using ozone and biological activated carbon (O3-BAC) was more effective in removing DOC than the conventional process, with the removals of C1 and C3 improved by 17.7%-25.1% and 19.2%-27.0%. The absorption coefficient and C1-C4 correlated significantly with DOC in water treatments, suggesting that absorption and fluorescence could effectively track the changes in bulk DOM. DOM generally remained stable in each drinking water distribution system, suggesting the importance of the treated water quality in determining that of the corresponding network. The optical indices changed notably between distribution networks of different treatment plants, which enabled the identification of changing water sources. A comparison of DOM in the direct and secondary water supplies suggested limited impacts of secondary water supply, although the changes in organic carbon and absorption indices were detected in some locations. These results have implications for better understanding the changes of DOM in the whole water supply system to help ensure the supplied water quality.


Asunto(s)
Abastecimiento de Agua , Calidad del Agua , Purificación del Agua/métodos , Sustancias Húmicas/análisis , Agua Potable/química , Agua Potable/análisis , Carbono/análisis
5.
Sichuan Da Xue Xue Bao Yi Xue Ban ; 55(1): 118-124, 2024 Jan 20.
Artículo en Zh | MEDLINE | ID: mdl-38322537

RESUMEN

Objective: To explore the mechanism of spleen tissue inflammatory response induced by altitude hypoxia in mice. Methods: C57BL/6 mice were randomly assigned to a plain, i.e., low-altitude, normoxia group and an altitude hypoxia group, with 5 mice in each group. In the plain normoxia group, the mice were kept in a normoxic environment at the altitude of 400 m above sea level (with an oxygen concentration of 19.88%). The mice in the altitude hypoxia group were kept in an environment at the altitude of 4200 m above sea level (with an oxygen concentration of 14.23%) to establish the animal model of altitude hypoxia. On day 30, spleen tissues were collected to determine the splenic index. HE staining was performed to observe the histopathological changes in the spleen tissues of the mice. Real time fluorogenic quantitative PCR (RT-qPCR) and Western blot were conducted to determine the mRNA and protein expressions of interleukin (IL)-6, IL-12, and IL-1ß in the spleen tissue of the mice. High-throughput transcriptome sequencing was performed with RNA sequencing (RNA-seq). KEGG enrichment analysis was performed for the differentially expressed genes (DEGs). The DEGs in the key pathways were verified by RT-qPCR. Results: Compared with the plain normoxia group, the mice exposed to high-altitude hypoxic environment had decreased spleen index (P<0.05) and exhibited such pathological changes as decreased white pulp, enlarged germinal center, blurred edge, and venous congestion. The mRNA and protein expression levels of IL-6, IL-12, and IL-1ß in the spleen tissue of mice in the altitude hypoxia group were up-regulated (P<0.05). According to the results of transcriptome sequencing and KEGG pathway enrichment analysis, 4218 DEGs were enriched in 178 enrichment pathways (P<0.05). DEGs were significantly enriched in multiple pathways associated with immunity and inflammation, such as T cell receptor signaling pathway, TNF signaling pathway, and IL-17 signaling pathway (P<0.05) in the spleen of mice exposed to high-altitude hypoxic environment. Among them, IL-17 signaling pathway and the downstream inflammatory factors were highly up-regulated (P<0.05). Compared with the plain normoxia group, the mRNA expression levels of key genes in the IL-17 signaling pathway, including IL-17, IL-17R, and mitogen-activated protein kinase genes (MAPKs), and the downstream inflammatory factors, including matrix metallopeptidase 9 (MMP9), S100 calcium binding protein A8 gene (S100A8), S100 calcium binding protein A9 gene (S100A9), and tumor necrosis factor α (TNF-α), were up-regulated or down-regulated (P<0.05) in the altitude hypoxia group. According to the validation of RT-qPCR results, the mRNA expression levels of DEGs were consistent with the RNA-seq results. Conclusion: Altitude hypoxia can induce inflammatory response in the mouse spleen tissue by activating IL-17 signaling pathway and promoting the release of downstream inflammatory factors.


Asunto(s)
Mal de Altura , Interleucina-17 , Transducción de Señal , Animales , Ratones , Mal de Altura/complicaciones , Proteínas de Unión al Calcio , Hipoxia , Interleucina-12/metabolismo , Interleucina-17/metabolismo , Interleucina-1beta/metabolismo , Ratones Endogámicos C57BL , Oxígeno , ARN Mensajero/metabolismo , Bazo
6.
Beilstein J Org Chem ; 20: 597-606, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-38505237

RESUMEN

Penicillium strains are renowned for producing diverse secondary metabolites with unique structures and promising bioactivities. Our chemical investigations, accompanied by fermentation media optimization, of a newly isolated fungus, Penicillium shentong XL-F41, led to the isolation of twelve compounds. Among these are two novel indole terpene alkaloids, shentonins A and B (1 and 2), and a new fatty acid 3. Shentonin A (1) is distinguished by an unusual methyl modification at the oxygen atom of the typical succinimide ring, a feature not seen in the structurally similar brocaeloid D. Additionally, shentonin A (1) exhibits a cis relationship between H-3 and H-4, as opposed to the trans configuration in brocaeloid D, suggesting a divergent enzymatic ring-expansion process in their respective fungi. Both shentonins A (1) and B (2) also feature a reduction of a carbonyl to a hydroxy group within the succinimide ring. All isolated compounds were subjected to antimicrobial evaluations, and compound 12 was found to have moderate inhibitory activity against Candia albicans. Moreover, genome sequencing of Penicillium shentong XL-F41 uncovered abundant silent biosynthetic gene clusters, indicating the need for future efforts to activate these clusters and unlock the full chemical potential of the fungus.

7.
Plant Physiol ; 188(4): 2325-2341, 2022 03 28.
Artículo en Inglés | MEDLINE | ID: mdl-34958388

RESUMEN

To overcome pathogen infection, plants deploy a highly efficient innate immune system, which often uses hydrogen peroxide (H2O2), a versatile reactive oxygen species, to activate downstream defense responses. H2O2 is a potential substrate of aquaporins (AQPs), the membrane channels that facilitate the transport of small compounds across plasma membranes or organelle membranes. To date, however, the functional relationship between AQPs and H2O2 in plant immunity is largely undissected. Here, we report that the rice (Oryza sativa) AQP OsPIP2;2 transports pathogen-induced apoplastic H2O2 into the cytoplasm to intensify rice resistance against various pathogens. OsPIP2;2-transported H2O2 is required for microbial molecular pattern flg22 to activate the MAPK cascade and to induce the downstream defense responses. In response to flg22, OsPIP2;2 is phosphorylated at the serine residue S125, and therefore gains the ability to transport H2O2. Phosphorylated OsPIP2;2 also triggers the translocation of OsmaMYB, a membrane-anchored MYB transcription factor, into the plant cell nucleus to impart flg22-induced defense responses against pathogen infection. On the contrary, if OsPIP2;2 is not phosphorylated, OsmaMYB remains associated with the plasma membrane, and plant defense responses are no longer induced. These results suggest that OsPIP2;2 positively regulates plant innate immunity by mediating H2O2 transport into the plant cell and mediating the translocation of OsmaMYB from plasma membrane to nucleus.


Asunto(s)
Acuaporinas , Oryza , Acuaporinas/genética , Acuaporinas/metabolismo , Regulación de la Expresión Génica de las Plantas , Peróxido de Hidrógeno/metabolismo , Oryza/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Factores de Transcripción/genética , Factores de Transcripción/metabolismo
8.
Crit Rev Food Sci Nutr ; : 1-21, 2023 Apr 10.
Artículo en Inglés | MEDLINE | ID: mdl-37035930

RESUMEN

Human milk oligosaccharides (hMOs) in mothers' milk play a crucial role in guiding the colonization of microbiota and gut-immune barrier development in infants. Non-digestible carbohydrates (NDCs) such as synthetic single hMOs, galacto-oligosaccharides (GOS), inulin-type fructans and pectin oligomers have been added to infant formula to substitute some hMOs' functions. HMOs and NDCs can modulate the gut-immune barrier, which is a multiple-layered functional unit consisting of microbiota, a mucus layer, gut epithelium, and the immune system. There is increasing evidence that the structures of the complex polysaccharides may influence their efficacy in modulating the gut-immune barrier. This review focuses on the role of different structures of individual hMOs and commonly applied NDCs in infant formulas in (i) direct regulation of the gut-immune barrier in a microbiota-independent manner and in (ii) modulation of microbiota composition and microbial metabolites of these polysaccharides in a microbiota-dependent manner. Both have been shown to be essential for guiding the development of an adequate immune barrier, but the effects are very dependent on the structural features of hMO or NDC. This knowledge might lead to tailored infant formulas for specific target groups.

9.
Microb Ecol ; 86(4): 2770-2780, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37542538

RESUMEN

Biofilms on the inner surface of a drinking water distribution system (DWDS) affect water quality and stability. Understanding the niche differentiation of biofilm microbial communities is necessary for the efficient control of DWDS biofilms. However, biofilm studies are difficult to conduct in the actual DWDS because of inaccessibility to the pipes buried underground. Taking the opportunity of infrastructure construction and relevant pipeline replacement in China, biofilms in a DWDS (a water main and its branch pipes) were collected in situ, followed by analysis on the abundances and community structures of bacterial and archaeal using quantitative PCR and high-throughput sequencing, respectively. Results showed that archaea were detected only in the biofilms of the water main, with a range of 9.4×103~1.1×105 copies/cm2. By contrast, bacteria were detected in the biofilms of branch pipes and the distal part of the water main, with a range of 8.8×103~9.6×106 copies/cm2. Among the biofilm samples, the archaeal community in the central part of the water main showed the highest richness and diversity. Nitrosopumilus was found to be predominant (86.22%) in the biofilms of the proximal part of the water main. However, Methanobrevibacter (87.15%) predominated in the distal part of the water main. The bacterial community of the water main and branch pipes was primarily composed of Firmicutes and Proteobacteria at the phylum level, respectively. Regardless of archaea or bacteria, only few operational taxonomic units (OTUs) (<0.5% of total OTUs) were shared by all the biofilms, indicating the niche differentiation of biofilm microorganisms. Moreover, the high Mn content in the biofilms of the distal sampling location (D3) in the water main was linked to the predominance of Bacillus. Functional gene prediction revealed that the proportion of infectious disease-related genes was 0.44-0.67% in the tested biofilms. Furthermore, functional genes related to the resistance of the bacterial community to disinfections and antibiotics were detected in all the samples, that is, glutathione metabolism-relating genes (0.14-0.65%) and beta-lactam resistance gene (0.01-0.05%). The results of this study indicate the ubiquity of archaea and bacteria in the biofilms of water main and branch pipes, respectively, and pipe diameters could be a major influencing factor on bacterial community structure. In the water main, the key finding was the predominant existence of archaea, particularly Nitrosopumilus and methanogen. Hence, their routine monitoring and probable influences on water quality in pipelines with large diameter should be given more attention. Besides, since Mn-related Bacillus and suspected pathogenic Enterococcus were detected in the biofilm, supplementation of disinfectant may be a feasible strategy for inhibiting their growth and ensuring water quality. In addition, the monitoring on their abundance variation could help to determine the frequency and methods of pipeline maintenance.


Asunto(s)
Bacillus , Agua Potable , Calidad del Agua , Bacterias/genética , Proteobacteria , Biopelículas , Archaea/genética , Abastecimiento de Agua , Microbiología del Agua
10.
Support Care Cancer ; 31(12): 663, 2023 Nov 02.
Artículo en Inglés | MEDLINE | ID: mdl-37914831

RESUMEN

OBJECTIVE: Opioid-induced nausea and vomiting are frequently observed as an adverse effect in the treatment of cancer-related pain. The factors that affect OINV in cancer patients remain unclear. In this study, we developed a nomogram for predicting the occurrence of OINV in this population using retrospective clinical data. METHODS: We collected data from 416 cancer pain patients, 70% of whom used the training set to analyze demographic and clinical variables. We used multivariate logistic regression to identify significant factors associated with OINV. Then, we construct a prediction nomogram. The validation set comprises the remaining 30%. The reliability of the nomogram is evaluated by bootstrap resampling. RESULTS: Using multivariate logistic regression, we identified five significant factors associated with OINV. The C-index was 0.835 (95% confidence interval [CI], 0.828-0.842) for the training set and 0.810 (95% CI, 0.793-0.826) for the validation set. The calibrated curves show a good agreement between the predicted and actual occurrence of OINV. CONCLUSION: In a retrospective study based on five saliency-found variables, we developed and proved a reliable nomogram model to predict OINV in cancer pain patients. Future prospective studies should assess the model's reliability and usefulness in clinical practice.


Asunto(s)
Antieméticos , Dolor en Cáncer , Neoplasias , Humanos , Analgésicos Opioides/efectos adversos , Dolor en Cáncer/tratamiento farmacológico , Dolor en Cáncer/inducido químicamente , Estudios Retrospectivos , Antieméticos/uso terapéutico , Nomogramas , Estudios Prospectivos , Reproducibilidad de los Resultados , Vómitos/inducido químicamente , Vómitos/tratamiento farmacológico , Náusea/inducido químicamente , Náusea/tratamiento farmacológico , Neoplasias/complicaciones , Neoplasias/tratamiento farmacológico
11.
Appl Microbiol Biotechnol ; 107(11): 3817-3828, 2023 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-37074383

RESUMEN

Biofilms inhabiting pipeline walls are critical to drinking water quality and safety. With massive pipeline replacement underway, however, biofilm formation process in newly built pipes and its effects on water quality are unclear. Moreover, differences and connections between biofilms in newly built and old pipes are unknown. In this study, early succession (≤ 120 days) of biofilm bacterial communities (abundance and diversity) in upper, middle and bottom areas of a newly built cement-lined ductile iron pipeline were evaluated using improved Propella™ biofilm reactor and multi-area analysis. A comparison with old pipelines (grey cast iron, 10 years) was performed. In the newly built pipeline, the abundance of biofilm bacteria did not change significantly between 40 and 80 days, but increased significantly between 80 and 120 days. The biofilm bacterial abundance (per unit area) in the bottom area was always higher than that in the upper and middle areas. Based on alpha diversity index and PCoA results, biofilm bacterial community richness, diversity and composition did not change significantly during the 120-day operation. Besides, biofilm shedding from the walls of newly built pipeline significantly increased bacterial abundance in the outlet water. Opportunistic pathogen-containing genera, such as Burkholderia, Acinetobacter and Legionella, were identified in both water and biofilm samples from newly built pipelines. The comparison between new and old pipelines suggested a higher bacterial abundance per unit area at the middle and bottom areas in old pipelines. Moreover, the bacterial community composition of biofilms in old pipelines was similar to that of newly built pipelines. These results contribute to accurate prediction and management of biofilm microbial communities in drinking water pipelines, ensuring the biosafety of drinking water. KEY POINTS: • Biofilm bacterial communities in different areas of pipe wall were revealed. • The abundance of biofilm bacteria increased significantly between 80 and 120 days. • Biofilm bacterial community compositions of newly built and old pipes were similar.


Asunto(s)
Agua Potable , Abastecimiento de Agua , Bacterias , Biopelículas , Hierro , Microbiología del Agua
12.
J Liposome Res ; : 1-10, 2023 Nov 15.
Artículo en Inglés | MEDLINE | ID: mdl-37966062

RESUMEN

Eugenol, as a natural antibacterial agent, has been widely studied for its inhibitory effect on the common food-borne pathogen Staphylococcus aureus (S. aureus). However, the widespread application of eugenol is still limited by its instability and volatility. Herein, γ-polyglutamic acid coated eugenol cationic liposomes (pGA-ECLPs) were successfully constructed by self-assembly with an average particle size of 170.7 nm and an encapsulation efficiency of 36.2%. The formation of pGA shell significantly improved the stability of liposomes, and the encapsulation efficiency of eugenol only decreased by 20.7% after 30 days of storage at 4 °C. On the other hand, the pGA layer can be hydrolyzed by S. aureus, achieving effective control of release through response to bacterial stimuli. The application experiments further confirmed that pGA-ECLPs effectively prolonged the antibacterial effect of eugenol in fresh chicken without causing obvious sensory effects on the food. The above results of this study provide an important reference for extending the action time of natural antibacterial substances and developing new stimuli-responsive antibacterial systems.

13.
Int J Mol Sci ; 24(10)2023 May 10.
Artículo en Inglés | MEDLINE | ID: mdl-37239892

RESUMEN

Ethylene Insensitive 2 (EIN2) is an integral membrane protein that regulates ethylene signaling towards plant development and immunity by release of its carboxy-terminal functional portion (EIN2C) into the nucleus. The present study elucidates that the nuclear trafficking of EIN2C is induced by importin ß1, which triggers the phloem-based defense (PBD) against aphid infestations in Arabidopsis. In plants, IMPß1 interacts with EIN2C to facilitate EIN2C trafficking into the nucleus, either by ethylene treatment or by green peach aphid infestation, to confer EIN2-dependent PBD responses, which, in turn, impede the phloem-feeding activity and massive infestation by the aphid. In Arabidopsis, moreover, constitutively expressed EIN2C can complement the impß1 mutant regarding EIN2C localization to the plant nucleus and the subsequent PBD development in the concomitant presence of IMPß1 and ethylene. As a result, the phloem-feeding activity and massive infestation by green peach aphid were highly inhibited, indicating the potential value of EIN2C in protecting plants from insect attacks.


Asunto(s)
Áfidos , Proteínas de Arabidopsis , Arabidopsis , Animales , Arabidopsis/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Áfidos/fisiología , Floema/metabolismo , Etilenos/metabolismo , Regulación de la Expresión Génica de las Plantas
14.
Plant J ; 108(2): 330-346, 2021 10.
Artículo en Inglés | MEDLINE | ID: mdl-34273211

RESUMEN

Plant aquaporins are a recently noted biological resource with a great potential to improve crop growth and defense traits. Here, we report the functional modulation of the rice (Oryza sativa) aquaporin OsPIP1;3 to enhance rice photosynthesis and grain production and to control bacterial blight and leaf streak, the most devastating worldwide bacterial diseases in the crop. We characterize OsPIP1;3 as a physiologically relevant CO2 -transporting facilitator, which supports 30% of rice photosynthesis on average. This role is nullified by interaction of OsPIP1;3 with the bacterial protein Hpa1, an essential component of the Type III translocon that supports translocation of the bacterial Type III effectors PthXo1 and TALi into rice cells to induce leaf blight and streak, respectively. Hpa1 binding shifts OsPIP1;3 from CO2 transport to effector translocation, aggravates bacterial virulence, and blocks rice photosynthesis. On the contrary, the external application of isolated Hpa1 to rice plants effectively prevents OsPIP1;3 from interaction with Hpa1 secreted by the bacteria that are infecting the plants. Blockage of the OsPIP1;3-Hpa1 interaction reverts OsPIP1;3 from effector translocation to CO2 transport, abrogates bacterial virulence, and meanwhile induces defense responses in rice. These beneficial effects can combine to enhance photosynthesis by 29-30%, reduce bacterial disease by 58-75%, and increase grain yield by 11-34% in different rice varieties investigated in small-scale field trials conducted during the past years. Our results suggest that crop productivity and immunity can be coordinated by modulating the physiological and pathological functions of a single aquaporin to break the growth-defense tradeoff barrier.


Asunto(s)
Oryza/fisiología , Fotosíntesis/fisiología , Proteínas de Plantas/metabolismo , Xanthomonas/patogenicidad , Proteínas Bacterianas/metabolismo , Transporte Biológico , Dióxido de Carbono/metabolismo , China , Regulación de la Expresión Génica de las Plantas , Interacciones Huésped-Patógeno/fisiología , Oryza/microbiología , Enfermedades de las Plantas/microbiología , Hojas de la Planta/fisiología , Proteínas de Plantas/genética , Plantas Modificadas Genéticamente , Semillas/genética , Semillas/crecimiento & desarrollo , Virulencia , Xanthomonas/metabolismo
15.
Environ Microbiol ; 24(12): 6290-6306, 2022 12.
Artículo en Inglés | MEDLINE | ID: mdl-36335568

RESUMEN

Vesicular trafficking is a conserved material transport process in eukaryotic cells. The GGA family proteins are clathrin adaptors that are involved in eukaryotic vesicle transport, but their functions in phytopathogenic filamentous fungi remain unexplored. Here, we examined the only GGA family protein in Fusarium graminearum, FgGga1, which localizes to both the late Golgi and endosomes. In the absence of FgGga1, the fungal mutant exhibited defects in vegetative growth, DON biosynthesis, ascospore discharge and virulence. Fluorescence microscopy analysis revealed that FgGga1 is associated with trans-Golgi network (TGN)-to-plasma membrane, endosome-to-TGN and endosome-to-vacuole transport. Mutational analysis on the five domains of FgGga1 showed that the VHS domain was required for endosome-to-TGN transport while the GAT167-248 and the hinge domains were required for both endosome-to-TGN and endosome-to-vacuole transport. Importantly, the deletion of the FgGga1 domains that are required in vesicular trafficking also inhibited vegetative growth and virulence of F. graminearum. In addition, FgGga1 interacted with the ascospore discharge regulator Ca2+ ATPase FgNeo1, whose transport to the vacuole is dependent on FgGga1-mediated endosome-to-vacuole transport. Our results suggest that FgGga1 is required for fungal development and virulence via FgGga1-mediated vesicular trafficking, and FgGga1-mediated endosome-to-vacuole transport facilitates ascospore discharge in F. graminearum.


Asunto(s)
Fusarium , Virulencia/genética , Fusarium/metabolismo , Red trans-Golgi/metabolismo , Esporas Fúngicas/genética , Esporas Fúngicas/metabolismo , Transporte de Proteínas , Proteínas Fúngicas/genética , Proteínas Fúngicas/metabolismo
16.
Mar Drugs ; 20(4)2022 Mar 31.
Artículo en Inglés | MEDLINE | ID: mdl-35447920

RESUMEN

Alzheimer´s disease is a global neurodegenerative health concern. To prevent the disease, the simultaneous inhibition of acetylcholinesterase and oxidative stress is an efficient approach. In this study, the inhibition effect of all-trans astaxanthin mainly from marine organisms on acetylcholinesterase and oxidative stress was evaluated by a chemical-based method in vitro and cell assay model. The results show that all-trans astaxanthin was a reversible competitive inhibitor and exhibited a strong inhibition effect with half inhibitory concentration (IC50 value) of 8.64 µmol/L. Furthermore, all-trans astaxanthin inhibited oxidative stress through reducing malondialdehyde content and increasing the activity of superoxide dismutase as well as catalase. All-trans astaxanthin could induce the changes of the secondary structure to reduce acetylcholinesterase activity. Molecular-docking analysis reveals that all-trans astaxanthin prevented substrate from binding to acetylcholinesterase by occupying the space of the active pocket to cause the inhibition. Our finding suggests that all-trans astaxanthin might be a nutraceutical supplement for Alzheimer´s disease prevention.


Asunto(s)
Acetilcolinesterasa , Enfermedad de Alzheimer , Enfermedad de Alzheimer/tratamiento farmacológico , Antioxidantes/química , Antioxidantes/farmacología , Humanos , Estrés Oxidativo , Xantófilas/farmacología
17.
Ecotoxicol Environ Saf ; 243: 113968, 2022 Sep 15.
Artículo en Inglés | MEDLINE | ID: mdl-35981483

RESUMEN

Effects of vitamin C supplementation on the oral bioaccessibility of lead (Pb) present in contaminated soils were examined using a number of in vitro assays (PBET, SBRC, UBM and IVG). In the presence of vitamin C, an increase in Pb bioaccessibility was observed in the gastric phase by 1.3-fold (30.5%-85.5%) and in the intestinal phase by 3.1-fold (0.9%-58.9%). Lead mobilization was regulated by reductive dissolution of Fe(III) and sequestration of Pb on secondary Fe minerals. Sequential extraction by the Bureau Community of Reference (BCR) provided more evidence that reducible fraction and residual fraction were major contributor of gastric Pb bioaccessibility, as well as reduced fractions in intestinal Pb bioaccessibility. In addition, higher non-carcinogenic risks may occur based on target hazard quotient (THQ ≥ 1). For people exposed to Pb present in soil, the management of vitamin C supplements is of serious concern.


Asunto(s)
Contaminantes del Suelo , Ácido Ascórbico , Disponibilidad Biológica , Suplementos Dietéticos , Compuestos Férricos , Humanos , Plomo/toxicidad , Suelo , Contaminantes del Suelo/análisis
18.
Molecules ; 27(7)2022 Apr 06.
Artículo en Inglés | MEDLINE | ID: mdl-35408741

RESUMEN

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.


Asunto(s)
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleótidos , Extractos Vegetales
19.
Acta Pharmacol Sin ; 42(11): 1921-1929, 2021 11.
Artículo en Inglés | MEDLINE | ID: mdl-33633363

RESUMEN

Immune checkpoint inhibition is an important strategy in cancer therapy. Blockade of CTLA-4 and PD-1/PD-L1 is well developed in clinical practice. In the last few years, LAG-3 has received much interest as an emerging novel target in immunotherapy. It was recently reported that FGL1 is a major ligand of LAG-3, which is normally secreted by the liver but is upregulated in several human cancers. FGL1 is a crucial biomarker and target for cancer immunotherapy. As the efficacy of immunotherapy is limited to specific types of patients, the subset of patients needs to be selected appropriately to receive precise treatment according to different biomarkers. To date, there is no test to accurately assess FGL1 expression levels. Nanobodies have some outstanding features, such as high stability, solubility and affinity for diagnostic and therapeutic applications. Here, we report the development and validation of a rapid, sensitive, and cost-effective nanobody-based immunoassay for the detection of FGL1 in human serum. In this study, human FGL1 recombinant protein was expressed and purified for the first time as an immunized antigen. Then, we constructed a nanobody phage display library and screened several nanobodies that bind FGL1 with high affinity. We selected two nanobodies targeting different epitopes of FGL1, one as a capture and the other conjugated with HRP as a probe. The double nanobody-based sandwich ELISA to detect the concentration of FGL1 showed a good response relationship in the range of 15.625-2000 ng/mL, and the recoveries from the spiked sample were in the range of 78% and 100%. This assay could be used as a potential approach for evaluating FGL1 expression for patient stratification and for predicting the therapeutic efficacy of targeting the LAG3/FGL1 axis.


Asunto(s)
Fibrinógeno/inmunología , Fibrinógeno/metabolismo , Anticuerpos de Dominio Único/inmunología , Anticuerpos de Dominio Único/metabolismo , Animales , Camelus , Ensayo de Inmunoadsorción Enzimática/métodos , Células HEK293 , Humanos , Inmunoensayo/métodos
20.
Phytopathology ; 111(12): 2317-2331, 2021 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-34058861

RESUMEN

Plants employ aquaporins (AQPs) of the plasma membrane intrinsic protein (PIP) family to import environmental substrates, thereby affecting various processes, such as the cellular responses regulated by the signaling molecule hydrogen peroxide (H2O2). Common wheat (Triticum aestivum) contains 24 candidate members of the PIP family, designated as TaPIP1;1 to TaPIP1;12 and TaPIP2;1 to TaPIP2;12. None of these TaPIP candidates have been characterized for substrate selectivity or defense responses in their source plant. Here, we report that T. aestivum AQP TaPIP2;10 facilitates the cellular uptake of H2O2 to confer resistance against powdery mildew and Fusarium head blight, two devastating fungal diseases in wheat throughout the world. In wheat, the apoplastic H2O2 signal is induced by fungal attack, while TaPIP2;10 is stimulated to translocate this H2O2 into the cytoplasm, where it activates defense responses to restrict further attack. TaPIP2;10-mediated transport of H2O2 is essential for pathogen-associated molecular pattern-triggered plant immunity (PTI). Typical PTI responses are induced by the fungal infection and intensified by overexpression of the TaPIP2;10 gene. TaPIP2;10 overexpression causes a 70% enhancement in wheat resistance to powdery mildew and an 86% enhancement in resistance to Fusarium head blight. By reducing the disease severities, TaPIP2;10 overexpression brings about >37% increase in wheat grain yield. These results verify the feasibility of using an immunity-relevant AQP to concomitantly improve crop productivity and immunity.


Asunto(s)
Acuaporinas , Resistencia a la Enfermedad/genética , Enfermedades de las Plantas/microbiología , Triticum , Acuaporinas/genética , Fusarium/patogenicidad , Peróxido de Hidrógeno , Enfermedades de las Plantas/genética , Proteínas de Plantas/genética , Triticum/genética , Triticum/microbiología
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA