A UPR-Induced Soluble ER-Phagy Receptor Acts with VAPs to Confer ER Stress Resistance.

Autophagic degradation of the endoplasmic reticulum (ER-phagy) is triggered by ER stress in diverse organisms. However, molecular mechanisms governing ER stress-induced ER-phagy remain insufficiently understood. Here we report that ER stress-induced ER-phagy in the fission yeast Schizosaccharomyces pombe requires Epr1, a soluble Atg8-interacting ER-phagy receptor. Epr1 localizes to the ER through interacting with integral ER membrane proteins VAPs. Bridging an Atg8-VAP association is the main ER-phagy role of Epr1, as it can be bypassed by an artificial Atg8-VAP tether. VAPs contribute to ER-phagy not only by tethering Atg8 to the ER membrane, but also by maintaining the ER-plasma membrane contact. Epr1 is upregulated during ER stress by the unfolded protein response (UPR) regulator Ire1. Loss of Epr1 reduces survival against ER stress. Conversely, increasing Epr1 expression suppresses the ER-phagy defect and ER stress sensitivity of cells lacking Ire1. Our findings expand and deepen the molecular understanding of ER-phagy.

The ortholog of human REEP1-4 is required for autophagosomal enclosure of ER-phagy/nucleophagy cargos in fission yeast.

Selective macroautophagy of the endoplasmic reticulum (ER) and the nucleus, known as ER-phagy and nucleophagy, respectively, are processes whose mechanisms remain inadequately understood. Through an imaging-based screen, we find that in the fission yeast Schizosaccharomyces pombe, Yep1 (also known as Hva22 or Rop1), the ortholog of human REEP1-4, is essential for ER-phagy and nucleophagy but not for bulk autophagy. In the absence of Yep1, the initial phase of ER-phagy and nucleophagy proceeds normally, with the ER-phagy/nucleophagy receptor Epr1 coassembling with Atg8. However, ER-phagy/nucleophagy cargos fail to reach the vacuole. Instead, nucleus- and cortical-ER-derived membrane structures not enclosed within autophagosomes accumulate in the cytoplasm. Intriguingly, the outer membranes of nucleus-derived structures remain continuous with the nuclear envelope-ER network, suggesting a possible outer membrane fission defect during cargo separation from source compartments. We find that the ER-phagy role of Yep1 relies on its abilities to self-interact and shape membranes and requires its C-terminal amphipathic helices. Moreover, we show that human REEP1-4 and budding yeast Atg40 can functionally substitute for Yep1 in ER-phagy, and Atg40 is a divergent ortholog of Yep1 and REEP1-4. Our findings uncover an unexpected mechanism governing the autophagosomal enclosure of ER-phagy/nucleophagy cargos and shed new light on the functions and evolution of REEP family proteins.

Molecular and structural mechanisms of ZZ domain-mediated cargo selection by Nbr1.

In selective autophagy, cargo selectivity is determined by autophagy receptors. However, it remains scarcely understood how autophagy receptors recognize specific protein cargos. In the fission yeast Schizosaccharomyces pombe, a selective autophagy pathway termed Nbr1-mediated vacuolar targeting (NVT) employs Nbr1, an autophagy receptor conserved across eukaryotes including humans, to target cytosolic hydrolases into the vacuole. Here, we identify two new NVT cargos, the mannosidase Ams1 and the aminopeptidase Ape4, that bind competitively to the first ZZ domain of Nbr1 (Nbr1-ZZ1). High-resolution cryo-EM analyses reveal how a single ZZ domain recognizes two distinct protein cargos. Nbr1-ZZ1 not only recognizes the N-termini of cargos via a conserved acidic pocket, similar to other characterized ZZ domains, but also engages additional parts of cargos in a cargo-specific manner. Our findings unveil a single-domain bispecific mechanism of autophagy cargo recognition, elucidate its underlying structural basis, and expand the understanding of ZZ domain-mediated protein-protein interactions.

Reactivation of transposable elements following hybridization in fission yeast.

Hybridization is thought to reactivate transposable elements (TEs) that were efficiently suppressed in the genomes of the parental hosts. Here, we provide evidence for this "genomic shock hypothesis" in the fission yeast Schizosaccharomyces pombe In this species, two divergent lineages (Sp and Sk) have experienced recent, likely human-induced, hybridization. We used long-read sequencing data to assemble genomes of 37 samples derived from 31 S. pombe strains spanning a wide range of ancestral admixture proportions. A comprehensive TE inventory revealed exclusive presence of long terminal repeat (LTR) retrotransposons. Sequence analysis of active full-length elements, as well as solo LTRs, revealed a complex history of homologous recombination. Population genetic analyses of syntenic sequences placed insertion of many solo LTRs before the split of the Sp and Sk lineages. Most full-length elements were inserted more recently, after hybridization. With the exception of a single full-length element with signs of positive selection, both solo LTRs and, in particular, full-length elements carry signatures of purifying selection indicating effective removal by the host. Consistent with reactivation upon hybridization, the number of full-length LTR retrotransposons, varying extensively from zero to 87 among strains, significantly increases with the degree of genomic admixture. This study gives a detailed account of global TE diversity in S. pombe, documents complex recombination histories within TE elements, and provides evidence for the "genomic shock hypothesis."

SUMO-Targeted DNA Translocase Rrp2 Protects the Genome from Top2-Induced DNA Damage.

The action of DNA topoisomerase II (Top2) creates transient DNA breaks that are normally concealed inside Top2-DNA covalent complexes. Top2 poisons, including ubiquitously present natural compounds and clinically used anti-cancer drugs, trap Top2-DNA complexes. Here, we show that cells actively prevent Top2 degradation to avoid the exposure of concealed DNA breaks. A genome-wide screen revealed that fission yeast cells lacking Rrp2, an Snf2-family DNA translocase, are strongly sensitive to Top2 poisons. Loss of Rrp2 enhances SUMOylation-dependent ubiquitination and degradation of Top2, which in turn increases DNA damage at sites where Top2-DNA complexes are trapped. Rrp2 possesses SUMO-binding ability and prevents excessive Top2 degradation by competing against the SUMO-targeted ubiquitin ligase (STUbL) for SUMO chain binding and by displacing SUMOylated Top2 from DNA. The budding yeast homolog of Rrp2, Uls1, plays a similar role, indicating that this genome protection mechanism is widely employed, a finding with implications for cancer treatment.

WNT5A regulates the proliferation, apoptosis and stemness of human stem Leydig cells via the ß-catenin signaling pathway.

Stem Leydig cells (SLCs) are essential for maintaining normal spermatogenesis as the significant component of testis microenvironment and gonadal aging. Although progress has been achieved in the regulation of male germ cells in mammals and humans, it remains unknown about the genes and signaling pathways of human SLCs. Here we have demonstrated, for the first time, that WNT5A (Wnt family member 5a) mediates the proliferation, apoptosis, and stemness of human SLCs, namely NGFR+ Leydig cells. We revealed that NGFR+ Leydig cells expressed NGFR, PDGFRA, NES, NR2F2, and THY1, hallmarks for SLCs. RNA-sequencing showed that WNT5A was expressed at a higher level in human SLCs than non-SLCs, while immunohistochemistry and Western blots further illustrated that WNT5A was predominantly expressed in human SLCs. Notably, CCK-8, EdU and Western blots displayed that WNT5A enhanced the proliferation and DNA synthesis and retained stemness of human SLCs, whereas flow cytometry and TUNEL analyses demonstrated that WNT5A inhibited the apoptosis of these cells. WNT5A knockdown caused an increase in LC lineage differentiation of human SLCs and reversed the effect of WNT5A overexpression on fate decisions of human SLCs. In addition, WNT5A silencing  resulted in the decreases in nuclear translocation of ß-catenin and expression levels of c-Myc, CD44, and Cyclin D1. Collectively, these results implicate that WNT5A regulates the proliferation, apoptosis and stemness of human SLCs through the activation of the ß-catenin signaling pathway. This study thus provides a novel molecular mechanism underlying the fate determinations of human SLCs, and it offers a new insight into the niche regulation of human testis.

Rapid in situ RNA imaging based on Cas12a thrusting strand displacement reaction.

RNA In situ imaging through DNA self-assembly is advantaged in illustrating its structures and functions with high-resolution, while the limited reaction efficiency and time-consuming operation hinder its clinical application. Here, we first proposed a new strand displacement reaction (SDR) model (Cas12a thrusting SDR, CtSDR), in which Cas12a could overcome the inherent reaction limitation and dramatically enhance efficiency through energy replenishment and by-product consumption. The target-initiated CtSDR amplification was established for RNA analysis, with order of magnitude lower limit of detection (LOD) than the Cas13a system. The CtSDR-based RNA in situ imaging strategy was developed to monitor intra-cellular microRNA expression change and delineate the landscape of oncogenic RNA in 66 clinic tissue samples, possessing a clear advantage over classic in situ hybridization (ISH) in terms of operation time (1 h versus 14 h) while showing comparable sensitivity and specificity. This work presents a promising approach to developing advanced molecular diagnostic tools.

Near-Field Probing of Microwave Oscillators with Josephson Microscopy.

Voltage-controlled oscillators, serving as fundamental components in semiconductor chips, find extensive applications in diverse modules such as phase-locked loops, clock generators, and frequency synthesizers within high-frequency integrated circuits. This study marks the first implementation of superconducting Josephson probe microscopy for near-field microwave detection on multiple voltage-controlled oscillators. Focusing on spectrum tracking, various phenomena, such as stray spectra and frequency drifts, were found under nonsteady operating states. Parasitic electromagnetic fields, originating from power supply lines and frequency divider circuits, were identified as sources of interference between units. The investigation further determined optimal working states by analyzing features of the microwave distributions. Our research not only provides insights into the optimization of circuit design and performance enhancement in oscillators but also emphasizes the significance of nondestructive near-field microwave microscopy as a pivotal tool in characterizing integrated millimeter-wave chips.

Cotyledonary somatic embryo is one kind of intermediate material similar to callus in the process of in vitro tissue culture from Rosa hybrida 'John F. Kennedy'.

BACKGROUND: Rose is recognized as an important ornamental plant worldwide, and it is also one of the most widely used flowers in gardens. At present, the improvement of rose traits is still difficult and uncertain, and molecular breeding can provide new ideas for the improvement of modern rose varieties. Somatic embryos are quite good receptors for genetic transformation. However, little is known about the molecular mechanisms underlying during the regeneration process of rose somatic embryos. To elucidate the molecular regulation mechanism of somatic embryo plantlet regeneration, the relationship between the differences in traits of the two different regenerated materials and the significantly differentially expressed genes (DEGs) related to phytohormone pathways in the process of regeneration were be investigated. RESULTS: These representative two regenerated samples from single-piece cotyledonary somatic embryo (SPC) culture of Rosa hybrida 'John F. Kennedy', were harvested for transcriptome analysis, with the SPC explants at the initial culture (Day 0) as the control. The differentially expressed genes (DEGs) in the materials from two different types for regeneration approach (SBF type: the regeneration approach type of single bud formed from SPC explants; MBF type: the regeneration approach type of multiple buds formed from SPC explants) were be screened by means of the transcriptome sequencing technology. In this study, a total of about 396.24 million clean reads were obtained, of which 78.95-82.92% were localized to the reference genome, compared with the initial material (CK sample), there were 5594 specific genes in the material of SBF type and 6142 specific genes in the MBF type. The DEGs from the SBF type material were mainly concentrated in the biological processes of GO terms such as phytohormones, substance transport, cell differentiation, and redox reaction. The KEGG enrichment analysis revealed these DEGs were more active in ubiquinone and other terpenoid-quinone biosynthesis, fatty acid elongation, steroid biosynthesis, and glycosphingolipid biosynthesis-globo and isoglobo series. In contrast, the DEGs induced by the MBF type material were mainly associated with the biological processes such as phytohormones, phosphorylation, photosynthesis and signal transduction. According to KEGG analysis, these DEGs of MBF type were significantly enriched in the porphyrin and chlorophyll metabolism, brassinosteroid biosynthesis, carotenoid biosynthesis, and peroxisome. Furthermore, the results from the phytohormone pathways analysis showed that the auxin-responsive factor SAUR and the cell wall modifying enzyme gene XTH were upregulated for expression but the protein phosphatase gene PP2C was downregulated for expression in SBF type; the higher expression of the ethylene receptor ETR, the ethylene transduction genes EBF1/2, the transcription factor EIN3, and the ethylene-responsive transcription factor ERF1/2 were induced by MBF type. CONCLUSIONS: According to the GO and KEGG analysis, it indicated the DEGs between two different regenerated materials from somatic embryos were significantly different which might be causing morphological differences. That was somatic embryos from Rosa hybrida 'John F. Kennedy' could regenerate plantlet via both classic somatic embryogenesis (seed-like germination) and organogenesis, cotyledonary somatic embryos should be considered as one kind of intermediate materials similiar to callus, rather than the indicator materials for somatic embryogenesis.

Regulating Ir-O Covalency to Boost Acidic Oxygen Evolution Reaction.

The unsatisfactory oxygen evolution reaction (OER) activity of IrO2 has intensively raised the cost and energy consumption of hydrogen generation from proton exchange membrane water electrolyzers. Here, the acidic OER activity of the rutile IrO2 is significantly enhanced by the incorporation of trivalent metals (e.g., Gd, Nd, and Pr) to increase the Ir-O covalency, while the high-valence (pentavalent or higher) metal incorporation decreases the Ir-O covalency resulting in worse OER activity. Experimental and theoretical analyses indicate that enhanced Ir-O covalency activates lattice oxygen and triggers lattice oxygen-mediated mechanism to enhance OER kinetics, which is verified by the finding of a linear relationship between the natural logarithm of intrinsic activity and Ir-O covalency described by charge transfer energy. By regulating the Ir-O covalency, the obtained Gd-IrO2-δ merely needs 260 mV of overpotential to reach 10 mA cm-2 and shows impressive stability during a 200-h test in 0.5 м H2SO4. This work provides an effective strategy for significantly enhancing the OER activity of the widely used IrO2 electrocatalysts through the rational regulation of Ir-O covalency.

FeSe2 and Its Composites for Pollutants Removal: Synthesis, Mechanisms, and Application Potential.

In recent years, the research of FeSe2 and its composites in environmental remediation has been gradually carried out. And the FeSe2 materials show great catalytic performance in photocatalysis, electrocatalysis, and Fenton-like reactions for pollutants removal. Therefore, the studies and applications of FeSe2 materials are reviewed in this work, including the common synthesis methods, the role of Fe and Se species as well as the catalyst structure, and the potential for practical environmental applications. Hereinto, it is worth noting in particular that the lower-valent Se (Se2- ), unsaturated Se (Se- ), and Se vacancies (VSe ) can play different roles in promoting pollutants removal. In addition, the FeSe2 material also demonstrates high stability, reusability, and adaptability over a wider pH range as well as universality to different pollutants. In view of the overall great properties and performance of FeSe2 materials compared with other typical Fe-based materials, it deserves and needs further research. And finally, this paper presents some challenges and perspectives in future development, looking forward to providing helpful guidance for the subsequent research of FeSe2 and its composites for environmental application.

Ammonia-Induced FCC Ru Nanocrystals for Efficient Alkaline Hydrogen Electrocatalysis.

The urgent development of effective electrocatalysts for hydrogen evolution and hydrogen oxidation reaction (HER/HOR) is needed due to the sluggish alkaline hydrogen electrocatalysis. Here, an unusual face-centered cubic (fcc) Ru nanocrystal with favorable HER/HOR performance is offered. Guided by the lower calculated surface energy of fcc Ru than that of hcp Ru in NH3, the carbon-supported fcc Ru electrocatalyst is facilely synthesized in the NH3 reducing atmosphere. The specific HOR kinetic current density of fcc Ru can reach 23.4 mA cmPGM -2, which is around 20 and 21 times greater than that of hexagonal close-packed (hcp) Ru and Pt/C, respectively. Additionally, the HER specific activity is enhanced more than six times in fcc Ru electrocatalyst when compared to Pt/C. Experimental and theoretical analysis indicate that the phase transition from hcp Ru to fcc Ru can negatively shift the d band center, weaken the interaction between catalysts and key intermediates and therefore enhances the HER/HOR kinetics.

The Surface Confinement of FeO Assists in the Generation of Singlet Oxygen and High-Valent Metal-Oxo Species for Enhanced Fenton-Like Catalysis.

Transition metal compounds (TMCs) have long been potential candidate catalysts in persulfate-based advanced oxidation process (PS-AOPs) due to their Fenton-like catalyze ability for radical generation. However, the mechanism involved in TMCs-catalyzed nonradical PS-AOPs remains obscure. Herein, the growth of FeO on the Fe3O4/carbon precursor is regulated by restricted pyrolysis of MIL-88A template to activate peroxymonosulfate (PMS) for tetracycline (TC) removal. The higher FeO incorporation conferred a 2.6 times higher degradation performance than that catalyzed by Fe3O4 and also a higher interference resistance to anions or natural organic matter. Unexpectedly, the quenching experiment, probe method, and electron paramagnetic resonance quantitatively revealed that the FeO reassigned high nonradical species (1O2 and FeIV═O) generation to replace original radical system created by Fe3O4. Density functional theory calculation interpreted that PMS molecular on strongly-adsorbed (200) and (220) facets of FeO enjoyed unique polarized electronic reception for surface confinement effect, thus the retained peroxide bond energetically supported the production of 1O2 and FeIV═O. This work promotes the mechanism understanding of TMCs-induced surface-catalyzed persulfate activation and enables them better perform catalytic properties in wastewater treatment.

Chimeric virus-like particles of human norovirus constructed by structure-guided epitope grafting elicit cross-reactive immunity against both GI.1 and GII.4 genotypes.

IMPORTANCE: Human norovirus (HuNoV) is highly infectious and can result in severe illnesses in the elderly and children. So far, there is no effective antiviral drug to treat HuNoV infection, and thus, the development of HuNoV vaccines is urgent. However, NoV evolves rapidly, and currently, at least 10 genogroups with numerous genotypes have been found. The genetic diversity of NoV and the lack of cross-protection between different genotypes pose challenges to the development of broadly protective vaccines. In this study, guided by structural alignment between GI.1 and GII.4 HuNoV VP1 proteins, several chimeric-type virus-like particles (VLPs) were designed through surface-exposed loop grafting. Mouse immunization studies show that two of the designed chimeric VLPs induced cross-immunity against both GI.1 and GII.4 HuNoVs. To our knowledge, this is the first designed chimeric VLPs that can induce cross-immune activities across different genogroups of HuNoV, which provides valuable strategies for the development of cross-reactive HuNoV vaccines.

Reinstatement of the fission yeast species Schizosaccharomyces versatilis Wickerham et Duprat, a sibling species of Schizosaccharomyces japonicus.

Schizosaccharomyces japonicus Yukawa et Maki (1931) and Schizosaccharomyces versatilis Wickerham et Duprat (1945) have been treated as varieties of S. japonicus or as conspecific, based on various approaches including mating trials and nDNA/nDNA optical reassociation studies. However, the type strains of S. japonicus and S. versatilis differ by five substitutions (99.15% identity) and one 1-bp indel in the sequences of the D1/D2 domain of the 26S rRNA gene, and 23 substitutions (96.3% identity) and 31-bp indels in the sequences of internal transcribed spacer (ITS) of rRNA, suggesting that they may not be conspecific. To reassess their taxonomic status, we conducted mating trials and whole-genome analyses. Mating trials using the type strains showed a strong but incomplete prezygotic sterility barrier, yielding interspecies mating products at two orders of magnitude lower efficiency than intraspecies matings. These mating products, which were exclusively allodiploid hybrids, were unable to undergo the haplontic life cycle of the parents. We generated chromosome-level gap-less genome assemblies for both type strains. Whole genome sequences yielded an average nucleotide identity (ANI) of 86.4%, indicating clear separation of S. japonicus and S. versatilis. Based on these findings, we propose the reinstatement of S. versatilis as a distinct species (holotype strain: CBS 103T and ex-types: NRRL Y-1026, NBRC 1607, ATCC 9987, PYCC 7100; Mycobank no.: 847838).

Pharmaceutical SH2 domain-containing protein tyrosine phosphatase 2 inhibition suppresses primary and metastasized liver tumors by provoking hepatic innate immunity.

BACKGROUND AND AIMS: SH2 domain-containing protein tyrosine phosphatase 2 (Shp2) is the first identified pro-oncogenic tyrosine phosphatase that acts downstream of receptor tyrosine kinases (RTKs) to promote Ras-extracellular signal-regulated kinase signaling. However, this phosphatase was also shown to be antitumorigenic in HCC. This study is aimed at deciphering paradoxical Shp2 functions and mechanisms in hepatocarcinogenesis and at exploring its value as a pharmaceutical target in HCC therapy. APPROACHES AND RESULTS: We took both genetic and pharmaceutical approaches to examine the effects of Shp2 inhibition on primary liver cancers driven by various oncogenes and on metastasized liver tumors. We show here that the catalytic activity of Shp2 was essential for relay of oncogenic signals from RTKs in HCC and that chemical inhibition of Shp2 robustly suppressed HCC driven by RTKs. However, in contrast to a tumor-promoting hepatic niche generated by genetically deleting Shp2 in hepatocytes, treatment with a specific Shp2 inhibitor had a tumor-suppressing effect on metastasized liver tumor progression. Mechanistically, the Shp2 inhibitor enhanced antitumor innate immunity by down-regulating inflammatory cytokines, suppressing the chemokine (C-C motif) receptor 5 signaling axis, but up-regulating interferon-ß secretion. CONCLUSIONS: These results unveil complex mechanisms for the tumor-suppressing effect of pharmaceutical Shp2 inhibition in the liver immune environment. We provide a proof of principle for clinical trials with specific Shp2 inhibitors in patients with primary and metastasized liver cancer.

Association between Whole Grain Intake and Chronic Kidney Disease.

BACKGROUND: The relationship between whole grain intake and chronic kidney disease (CKD) remains uncertain. OBJECTIVE: This study aimed to evaluate the association between whole grain intake and risk of CKD in Chinese adults. METHODS: The present cross-sectional study used data from the China Health and Nutrition Survey conducted in 2009. Whole grain intake was measured using 3 consecutive 24-h dietary recalls and a household food inventory. A multivariable logistic regression model was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs) for risk of CKD. In addition, a restricted cubic spline was used to investigate the dose‒response relationship between whole grain and risk of CKD. RESULTS: A total of 6747 participants were included, 728 of whom had CKD. Compared with those in the lowest whole grain intake group, those in the higher grain intake group had an inverse association with risk of CKD (Q2: adjusted OR 0.70, 95% CI: 0.54, 0.89; Q3: adjusted OR 0.54, 95% CI: 0.42, 0.69; and Q4: adjusted OR 0.29, 95% CI: 0.21, 0.41). The association between whole grain intake and CKD seems to be stronger for individuals who were male (P for interaction = 0.008) or smokers (P for interaction = 0.013). In addition, the restricted cubic spline suggested an obvious L-shaped correlation. CONCLUSIONS: Increased whole grain intake was associated with a decreased risk of CKD in Chinese adults.

Identification of four novel large deletions and complex variants in the α-globin locus in Chinese population.

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Differential diagnosis of ascites: etiologies, ascitic fluid analysis, diagnostic algorithm.

Ascites is the pathological accumulation of fluid within the peritoneal cavity. It often occurs as results of liver cirrhosis, malignant neoplasia, tuberculous infection, cardiac insufficiency, renal diseases, etc. Determining the etiology is an essential step in the management of patients with new-onset ascites. Abdominal paracentesis with appropriate ascitic fluid analysis is probably the most cost-effective method of determining the cause of ascites. We performed a literature search of PubMed and identified articles published in the field of ascites, to evaluate diagnostic values of various parameters in defining the etiologies of ascites and then provides diagnostic algorithm for patients with new-onset ascites. In patients with ascites, the constituent ratio of underlying etiology varies between developed and developing countries. It is a challenge to define the etiologies of ascites in developing countries. Routine ascitic fluid analysis should include the serum ascites albumin gradient (SAAG), total protein concentration, cell count and differential. Optional ascitic fluid analysis includes cholesterol, fluid culture, cytology, tumor markers, lactate dehydrogenase, adenosine deaminase (ADA), triglyceride, amylase, glucose, brain natriuretic peptide (BNP), etc. Our review evaluated diagnostic values of the above parameters in defining the etiologies of ascites. Diagnostic algorithm established in this review would provide a practical and convenient diagnostic strategy for clinicians in diagnosing patients with new-onset ascites.